ID: 1184322383

View in Genome Browser
Species Human (GRCh38)
Location 22:43752464-43752486
Sequence AGACATCCGCCCTTCTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184322373_1184322383 30 Left 1184322373 22:43752411-43752433 CCCGGCTGCCCACTTCTCCTTTC No data
Right 1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 52
1184322378_1184322383 -1 Left 1184322378 22:43752442-43752464 CCCTCTATTTTCCATTTTGTTCA 0: 1
1: 0
2: 7
3: 82
4: 742
Right 1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 52
1184322379_1184322383 -2 Left 1184322379 22:43752443-43752465 CCTCTATTTTCCATTTTGTTCAG No data
Right 1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 52
1184322374_1184322383 29 Left 1184322374 22:43752412-43752434 CCGGCTGCCCACTTCTCCTTTCT 0: 1
1: 0
2: 7
3: 70
4: 643
Right 1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 52
1184322375_1184322383 22 Left 1184322375 22:43752419-43752441 CCCACTTCTCCTTTCTAACAAAA 0: 1
1: 0
2: 2
3: 37
4: 456
Right 1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 52
1184322377_1184322383 13 Left 1184322377 22:43752428-43752450 CCTTTCTAACAAAACCCTCTATT 0: 1
1: 0
2: 1
3: 23
4: 201
Right 1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 52
1184322376_1184322383 21 Left 1184322376 22:43752420-43752442 CCACTTCTCCTTTCTAACAAAAC 0: 1
1: 0
2: 2
3: 37
4: 384
Right 1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184322383 Original CRISPR AGACATCCGCCCTTCTTGGG TGG Intronic
900422374 1:2561147-2561169 AGACTTCAGAGCTTCTTGGGAGG + Intronic
906522361 1:46474993-46475015 AGACATCAGGCTCTCTTGGGGGG + Intergenic
912839445 1:113026007-113026029 AAACATACGCCCATCTGGGGAGG - Intergenic
914815690 1:151060352-151060374 ATCCTTCCGCCCTTCTTAGGAGG + Exonic
916587967 1:166165308-166165330 GGCTATCCGCCCTTCTTGGCCGG + Intronic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
923331101 1:232925572-232925594 AGACATCTGCTCTTCTTCAGGGG + Intergenic
1070653637 10:78255748-78255770 AGACCTCAGCCTTTCTTAGGAGG + Intergenic
1072619235 10:97068643-97068665 AGGCATCTCCCCTTCTTGTGGGG + Intronic
1074956706 10:118397737-118397759 AGACACCCACCATTCTTGGAGGG - Intergenic
1075050322 10:119178641-119178663 GGCCATTCGCCCTTCTTGGAGGG - Intronic
1075914408 10:126155093-126155115 ACACACCAGCGCTTCTTGGGGGG + Intronic
1078586288 11:12592678-12592700 AGACATCATCTCTTCTTGGAAGG - Intergenic
1091438687 12:495599-495621 AGAGATGCTCCCTTCTTAGGGGG + Intronic
1092987631 12:13861748-13861770 AACCATATGCCCTTCTTGGGTGG + Intronic
1096257736 12:50073355-50073377 AGACACCCGCCCTCCCTGGCAGG + Intronic
1096796159 12:54079302-54079324 CGACATCCGACCCTCCTGGGGGG - Intergenic
1102810204 12:115817702-115817724 GGCCAGCCGCCCTTTTTGGGTGG + Intergenic
1126436189 15:48640716-48640738 AGACTTCTGCCCTTGTTGTGTGG - Intronic
1126693531 15:51306843-51306865 AGACTTAAGCCCTTCTTGGAAGG + Intronic
1139514142 16:67443495-67443517 TGACATCCTCCCTTCTGGAGGGG + Intronic
1141482880 16:84318503-84318525 AGCCATCAGCCCTTCTTCGCTGG - Intronic
1146103268 17:30006769-30006791 TGGCATCCCCCCTACTTGGGAGG - Intronic
1146383636 17:32350057-32350079 AGACCTCCGCCCTGAGTGGGTGG - Intergenic
1150291895 17:63987161-63987183 AGTCAACAGCCCTTGTTGGGGGG - Intergenic
1154036835 18:10811352-10811374 AGACATACACCCTTTTTGGAAGG - Intronic
1160885122 19:1342532-1342554 AGTAATCCCCCCTACTTGGGAGG + Intergenic
1161748619 19:6077423-6077445 AGGCACACGCCCCTCTTGGGTGG - Intronic
1161749868 19:6087819-6087841 GCACATTCGCCCTTCTTAGGTGG + Intronic
1162406758 19:10479486-10479508 CGTCATCCGCCCTTCTTGAGGGG + Intergenic
1163777250 19:19225689-19225711 TGACACTCGCCCTTGTTGGGGGG + Intronic
926715961 2:15923695-15923717 ACACATCAGCCCAGCTTGGGAGG + Intergenic
933225294 2:79741485-79741507 AGACATCCCGCATTCTTGGATGG - Intronic
940418870 2:153455518-153455540 TGACTTCCACCCTTCATGGGAGG + Intergenic
946523084 2:220487804-220487826 AGTCATCCACTCTTCTGGGGGGG - Intergenic
1180260866 21:46667874-46667896 AGAACTCCGCCGTTCCTGGGAGG + Intergenic
1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG + Intronic
1184369121 22:44071446-44071468 AGACCTCCTCCTTTCGTGGGTGG - Intronic
958467284 3:94473372-94473394 AGCCCTCAACCCTTCTTGGGAGG + Intergenic
959452722 3:106523280-106523302 ACGCATCCTTCCTTCTTGGGTGG + Intergenic
967648944 3:191961873-191961895 AGACATCCCATGTTCTTGGGAGG + Intergenic
990333655 5:54751453-54751475 AGACCTATGCCTTTCTTGGGTGG + Intergenic
998827414 5:146117322-146117344 AGACACCGGCCCTGCTTGGATGG - Intronic
1001009616 5:168086033-168086055 AGTCATCCCCCCTTTTTGGGGGG + Intronic
1001145160 5:169177433-169177455 GGAAATCAGCACTTCTTGGGAGG + Intronic
1002921279 6:1575183-1575205 AGAACTCTGCCCTTGTTGGGGGG - Intergenic
1012575111 6:100785978-100786000 AGGCATACCCTCTTCTTGGGAGG + Intronic
1021458918 7:20863159-20863181 TGACATCTACCATTCTTGGGAGG + Intergenic
1028838962 7:95405850-95405872 AGACATGTGCCCTTCTTGGGTGG - Intronic
1033045562 7:137959147-137959169 AGACATCACCTCTTCATGGGAGG - Intronic
1042364523 8:67921197-67921219 AGAAATCAGTCCTTCTTGGAAGG + Intergenic
1049657675 8:143805927-143805949 AGGCATGCGCCCTTCTTGTAGGG - Intronic
1189700723 X:43714906-43714928 AGACATCCACCCTTCTGGTTTGG - Intronic
1195349436 X:103982943-103982965 GGAAACCCGCCCTTCTTGGTTGG + Intergenic
1195358007 X:104055896-104055918 GGAAACCCGCCCTTCTTGGTTGG - Intergenic
1199690998 X:150308967-150308989 TGGCATCTCCCCTTCTTGGGAGG + Intergenic