ID: 1184324678

View in Genome Browser
Species Human (GRCh38)
Location 22:43774379-43774401
Sequence GGGTCTGCAGCCAATCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184324678_1184324683 4 Left 1184324678 22:43774379-43774401 CCATGGAGATTGGCTGCAGACCC 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1184324683 22:43774406-43774428 CCCATGAGCCACAGCACAGCAGG 0: 1
1: 2
2: 1
3: 26
4: 231
1184324678_1184324690 14 Left 1184324678 22:43774379-43774401 CCATGGAGATTGGCTGCAGACCC 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1184324690 22:43774416-43774438 ACAGCACAGCAGGCTCTGGGGGG 0: 1
1: 1
2: 2
3: 49
4: 333
1184324678_1184324685 10 Left 1184324678 22:43774379-43774401 CCATGGAGATTGGCTGCAGACCC 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1184324685 22:43774412-43774434 AGCCACAGCACAGCAGGCTCTGG 0: 1
1: 1
2: 5
3: 47
4: 375
1184324678_1184324686 11 Left 1184324678 22:43774379-43774401 CCATGGAGATTGGCTGCAGACCC 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1184324686 22:43774413-43774435 GCCACAGCACAGCAGGCTCTGGG 0: 1
1: 0
2: 2
3: 47
4: 387
1184324678_1184324689 13 Left 1184324678 22:43774379-43774401 CCATGGAGATTGGCTGCAGACCC 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1184324689 22:43774415-43774437 CACAGCACAGCAGGCTCTGGGGG No data
1184324678_1184324688 12 Left 1184324678 22:43774379-43774401 CCATGGAGATTGGCTGCAGACCC 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1184324688 22:43774414-43774436 CCACAGCACAGCAGGCTCTGGGG 0: 1
1: 0
2: 9
3: 71
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184324678 Original CRISPR GGGTCTGCAGCCAATCTCCA TGG (reversed) Intronic
900606020 1:3523881-3523903 GGGTCTGCAGCCAGGGTCCTGGG + Intronic
900687580 1:3958468-3958490 GGGTCTGCAGGGACTCTCTAGGG + Intergenic
901378182 1:8854715-8854737 GGGTCTGCACCCCTTGTCCATGG - Intergenic
903826170 1:26147146-26147168 GGGCCTGCTGCCCATCTGCAGGG + Intergenic
906559196 1:46742628-46742650 GTGTCTTCAGGTAATCTCCAAGG - Intergenic
908742420 1:67342443-67342465 GGGGCTGCACCCAATCAGCACGG - Intronic
912393216 1:109319286-109319308 ATGTCTGCTGACAATCTCCAGGG + Intronic
914260319 1:145993689-145993711 TGGTCAGCAGGCAATCTCCTGGG - Exonic
915284956 1:154846642-154846664 GTGTCTGCAGCCAGTTTCCATGG + Intronic
915762051 1:158324043-158324065 GGGTCTGGAGCCAAATTACAGGG + Intergenic
915827164 1:159090116-159090138 AGGGCTGCAGCCAATCCCCCTGG - Intronic
920354294 1:205358996-205359018 AGGTCTGTAGTCTATCTCCAGGG - Intergenic
922903454 1:229156197-229156219 GGGTCTCCAGCCGAGCTCCTGGG + Intergenic
923230180 1:231978681-231978703 GAGTCTGTAGCCAATCTGAAGGG - Intronic
1062799099 10:366516-366538 GGGTCTGGAGCAAAACTGCACGG + Intronic
1065987240 10:30967120-30967142 GGGTCAGCAGCTAATTTACAGGG - Intronic
1066063640 10:31746126-31746148 GGGTCTGCAGGCATGGTCCAGGG + Intergenic
1066316589 10:34253539-34253561 GGGTCTGCAGCATCTCTTCATGG + Intronic
1068461392 10:57334249-57334271 GGGTGTGCAGGCAAGCTGCAAGG + Intergenic
1068545132 10:58335675-58335697 GGGCCTGCAGCCTTTCTCCGCGG + Intronic
1071668580 10:87585484-87585506 AGGACTGGAGCCAATCTGCAGGG + Intergenic
1073454622 10:103629057-103629079 GGATAGGCAGGCAATCTCCAGGG + Intronic
1074719055 10:116248936-116248958 GAGTCTGCAGGCCAGCTCCAGGG + Intronic
1074917431 10:117971111-117971133 GGGTCCTCTGCCAATCTGCAGGG - Intergenic
1075684269 10:124353167-124353189 GGGCCAGAAGCCCATCTCCAGGG + Intergenic
1075926291 10:126254181-126254203 GGGTCTGCAGGCAGCCTCCCTGG + Intronic
1078929401 11:15901575-15901597 GGGTCTGGGGACCATCTCCAAGG - Intergenic
1079082225 11:17421754-17421776 GGCTCTGCAGCCAAGCTGCCTGG - Intronic
1079161767 11:18001536-18001558 GGGTCTGCTTGCAATCTCCGTGG - Intronic
1081570204 11:44286089-44286111 GTGTCTGGAGCCCAGCTCCAGGG - Intronic
1081609809 11:44554506-44554528 AGGTCTGCATCCAATGTTCACGG - Intergenic
1083598414 11:63931372-63931394 GGGACAGCAGCCAAGCTGCAGGG + Intergenic
1084493392 11:69490131-69490153 GGGCCTGGACCAAATCTCCAAGG - Intergenic
1085020253 11:73202144-73202166 GGGTCTCCTCCCTATCTCCAAGG - Intergenic
1085450143 11:76626988-76627010 GGGCCTGCTGCCACTCACCAAGG + Intergenic
1085678783 11:78551133-78551155 GGTTGTACAGCCAATCACCACGG - Intronic
1085713776 11:78853971-78853993 GGGTCTCGTGCCAAGCTCCAGGG + Intronic
1089470294 11:118715231-118715253 GGATCTGCAGCCATTCCCCAGGG - Intergenic
1090874472 11:130776552-130776574 ATTTCTGCAGCCAATCCCCAGGG + Intergenic
1091105895 11:132919548-132919570 GGAGCTGCAGCCAATCGCCCTGG - Intronic
1091862583 12:3799470-3799492 AGGTCTGCAGTAAATATCCAGGG - Intronic
1095745882 12:45658227-45658249 GAGTCTGCAGCCAAACTTCCTGG - Intergenic
1100242735 12:92726176-92726198 GGCTCTGCAGCCAAGTTCCATGG - Intronic
1102190060 12:110980964-110980986 GGGTCTGCAGCCACTCACCTGGG - Intergenic
1104535424 12:129613894-129613916 GGTTCTGGAGCCAGTCTCCTGGG - Intronic
1105835069 13:24203045-24203067 TGATCTGCAGCCAACCACCATGG - Intronic
1105860126 13:24401953-24401975 TGATCTGCAGCCAACCACCATGG + Intergenic
1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG + Exonic
1106847258 13:33749454-33749476 GGTCCTGCAACCAATCCCCAGGG + Intergenic
1109773406 13:67006523-67006545 GGGACTGCAGAAAATCGCCAGGG - Intronic
1109865288 13:68256824-68256846 GGGTCCTCAGAGAATCTCCAAGG + Intergenic
1113339966 13:109412736-109412758 GCGGCTGCAGCCACTCGCCACGG - Intergenic
1113415347 13:110124606-110124628 AGGTCTGCAGCCTGTCTCCTAGG + Intergenic
1114673391 14:24426321-24426343 AGGTGTGCAGCTATTCTCCAAGG + Intergenic
1116973598 14:51093809-51093831 GGGTCTGCAGCCAGTGGCCGCGG - Intronic
1117665023 14:58047607-58047629 GGCTCTGCAGCCAGTCTCCTTGG - Intronic
1118704821 14:68471143-68471165 GGATGTGCAGCCCATGTCCAGGG + Intronic
1118865934 14:69703563-69703585 GAGACGGCAGCTAATCTCCATGG - Exonic
1121113869 14:91330406-91330428 GCCTTTGCAGCCACTCTCCATGG - Intronic
1122177205 14:99929795-99929817 AGATCTGTAGCCCATCTCCAAGG + Intronic
1122854531 14:104553878-104553900 GGGTTTGGAGCAAATCCCCAGGG - Intronic
1122875033 14:104659984-104660006 GGGCCTGCAGACCAGCTCCATGG - Intergenic
1124340734 15:28887705-28887727 GGGGCTCCAGGCAATGTCCAGGG + Intronic
1128440142 15:67699297-67699319 GGGGCAGCAGCCAAGCTTCAGGG + Intronic
1128954688 15:71927489-71927511 GGTTCTGGAACCAATCCCCATGG - Intronic
1130061852 15:80576124-80576146 GGGTCTGAATCCCATCTCCAAGG - Intronic
1130836411 15:87654251-87654273 GGGCCTGCAGACAATCCCCATGG + Intergenic
1131300875 15:91198742-91198764 AGGTCTCCAGCCATTCTCCCTGG - Intronic
1137274825 16:46926570-46926592 GGGTCTGCACACAATTTTCATGG - Intronic
1137512795 16:49116099-49116121 GGGTCTGCAGCTATTCTCCTAGG - Intergenic
1138751944 16:59433149-59433171 GGGTCTCCAGCCAAGTTTCATGG - Intergenic
1139056084 16:63186108-63186130 GGTTCTGGAGCCAATCTCCCAGG - Intergenic
1139476297 16:67204171-67204193 GGGACTGCAGCCTTTCTCCAAGG + Intergenic
1141154042 16:81584591-81584613 GGGACTGCAGCTGATCTACACGG - Intronic
1144072629 17:11688481-11688503 GGCTTTGCAGCCAGTCTTCATGG + Intronic
1144575519 17:16427238-16427260 GGGTCTGAAGCCAGACTCCCTGG - Intronic
1146460009 17:33038913-33038935 GGGAGTCCAGCCAATCTCCTAGG + Intronic
1148864309 17:50620594-50620616 GGGTCTGCAGCCTCTCACCTAGG - Intronic
1149467329 17:56890488-56890510 GGGTCTGCAGCCTGTGGCCAGGG + Exonic
1149543201 17:57484085-57484107 GGCTCTGCAGCCAAACTACCTGG - Intronic
1151027503 17:70695927-70695949 AGGTCTGCTGCCAATATACAAGG + Intergenic
1151180542 17:72324327-72324349 GAGTGTGCAGCCACTCTTCATGG - Intergenic
1151348940 17:73520198-73520220 GGGGCTGCACCCAATCTGGAGGG + Intronic
1151354969 17:73553000-73553022 GGAGCTGCAGCCAATCCCAAAGG - Intronic
1151457879 17:74237368-74237390 GGGTCTGCAGGTAATCGCCCCGG - Exonic
1152511757 17:80794789-80794811 GTGTCAGAAGCCCATCTCCAAGG + Intronic
1157035486 18:43968134-43968156 AAGTCTGGAGACAATCTCCAGGG - Intergenic
1157704233 18:49789194-49789216 TGGTCTGCAGCTATTCTGCAGGG + Intronic
1157910798 18:51615708-51615730 GGGGCTCCAGCCAAGCTTCAGGG - Intergenic
1158270138 18:55704115-55704137 GTGTATGCAGTCACTCTCCAGGG + Intergenic
1159870613 18:73756745-73756767 GGGTCTGCAGCAAGCCTCCAGGG + Intergenic
1160573307 18:79832963-79832985 TGGGCTGCACCCAGTCTCCAAGG + Intergenic
1161136376 19:2622450-2622472 GGGGATTCAGCCCATCTCCAGGG + Intronic
1161167997 19:2798781-2798803 GGGTCTGGAGCCCAGCTCCATGG - Intronic
1161304178 19:3557676-3557698 GGAACCGCAGCCAATCGCCAAGG + Intronic
1163363569 19:16863463-16863485 GGTTCTGGAACCAATCTCCCAGG + Intronic
1163669211 19:18617701-18617723 GGTTCTGCAGTCCATCTCCCAGG + Intronic
1166968573 19:46546701-46546723 GTGGCTGCAGCCAACCTCAAGGG + Intronic
1168468068 19:56620011-56620033 GGGTCTGAACCCAAGCTCCACGG + Intronic
927461004 2:23298096-23298118 GGCTCTGCAGCCTCTCCCCAGGG - Intergenic
933705350 2:85285519-85285541 GGTTCTGCAGCCAGTCGCCAAGG + Intronic
933787937 2:85858702-85858724 GGGATGGCAGCCAATCTCAAAGG - Intronic
934624265 2:95834402-95834424 GGGTCTCCAGCCAATCCCACCGG - Intergenic
934809453 2:97267510-97267532 GGGTCTCCAGCCAATCCCACCGG + Intergenic
934809738 2:97268745-97268767 GGGTCTCCAGCCAATCCCACTGG + Intergenic
934827957 2:97439240-97439262 GGGTCTCCAGCCAATCCCACTGG - Intergenic
937888436 2:126916243-126916265 GGGATTCCAGCCAATCTCTAGGG - Intergenic
938983947 2:136554692-136554714 GGATCTTCAGCCAATGTCCCTGG - Intergenic
939225890 2:139363638-139363660 GGGACTGCAGCAAAGCTTCAGGG + Intergenic
946955718 2:224928007-224928029 GTGTGTGGAGTCAATCTCCACGG - Intronic
947248962 2:228079711-228079733 GGGCCTGCAGCCTATATTCAAGG - Intronic
1168752106 20:290151-290173 GGGTCTCCAGCCTATATCCGCGG + Intronic
1170651843 20:18250232-18250254 GATTCTGGAGCCAACCTCCAGGG + Intergenic
1171205346 20:23274840-23274862 TGCTCTGCAGCAAATCTGCAGGG - Intergenic
1172799240 20:37564639-37564661 GGGGCCGCAGCCGCTCTCCACGG - Intergenic
1172996044 20:39071219-39071241 GGGTCTGAGGTCAGTCTCCATGG - Intergenic
1175334286 20:58185120-58185142 GTCTCTGCAGACAATCACCATGG + Intergenic
1175915704 20:62424771-62424793 GGGTCTCCACCCACTCTCCCAGG + Intronic
1177932849 21:27306172-27306194 GGATTTGTAGCCAATTTCCATGG + Intergenic
1179140762 21:38722932-38722954 GGGTCTACAGCCAAACACCTAGG + Intergenic
1179967472 21:44815726-44815748 GGGGCTGCAGCCATTCCCCCCGG - Intronic
1181477144 22:23175774-23175796 GCTTCTGCAGCCAAGTTCCAGGG + Intergenic
1181820968 22:25475467-25475489 GACTCTGCAGGCAATGTCCATGG + Intergenic
1181868095 22:25875217-25875239 GGCTCTGCAGCCAGACTGCAAGG + Intronic
1182118702 22:27773228-27773250 GGGTCTGGAGCCACTCTGAAAGG + Intronic
1182921668 22:34085795-34085817 GGGAATGCAGCCAATGTCGAGGG - Intergenic
1183403187 22:37616823-37616845 GGGACTGCAGCCCTCCTCCAAGG - Intronic
1184324678 22:43774379-43774401 GGGTCTGCAGCCAATCTCCATGG - Intronic
954611992 3:51949409-51949431 GGGCCTCCAGCCACACTCCAGGG + Intergenic
958695806 3:97526407-97526429 GGGACTGAAACCAATCTTCAGGG + Intronic
961810981 3:129521517-129521539 GCCTCTGCAGCCACTCTCCTTGG - Intergenic
962620633 3:137174570-137174592 GGGGCTGCAGCCAGTCTGCAGGG + Intergenic
965653565 3:170959872-170959894 GGGTGTACAGCAAATCACCATGG - Intergenic
966212596 3:177468657-177468679 GGGTCTCCTGCAAATATCCATGG - Intergenic
966622870 3:181984602-181984624 GTGTATCCAGCAAATCTCCAGGG + Intergenic
967821421 3:193842657-193842679 GGTTCGGCAGCCAATCTCCTGGG + Intergenic
968987075 4:3881248-3881270 GGGTCTGCCGCCATGCCCCAGGG + Intergenic
969489814 4:7492683-7492705 TTGTCAGCAGCCAGTCTCCAAGG - Intronic
969728755 4:8940895-8940917 GGGTCTGCCGCCATGCCCCAGGG - Intergenic
970307450 4:14748332-14748354 GGGTCTGGAGCCATTCTACCCGG - Intergenic
970520433 4:16878364-16878386 TGGTCTCCAGCCAAACTCTATGG - Intronic
970594102 4:17584180-17584202 GGCTCTGCAGCCAGTCAGCATGG + Intronic
970667856 4:18358443-18358465 GGGTCTGGAGCCAAGTTTCAGGG + Intergenic
972484682 4:39529740-39529762 GGGACTGTAGACAATCTCCGAGG + Intergenic
975717396 4:77218093-77218115 GGGTGTGCAACCTATCTACATGG + Intronic
978901865 4:113960820-113960842 GGCACTTCTGCCAATCTCCAGGG - Intronic
980671639 4:136016770-136016792 GAGTCTACACCCAAACTCCAAGG + Intergenic
982216754 4:153088927-153088949 GAGGCAGCATCCAATCTCCAGGG - Intergenic
983123615 4:163920544-163920566 GGGTCAGCAGTCTGTCTCCAGGG - Intronic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
985870842 5:2555197-2555219 TGGTGTTCAGCCAATGTCCAGGG - Intergenic
988330708 5:29836389-29836411 GAGTCTGCAGCCAATTGTCAGGG + Intergenic
988962079 5:36380512-36380534 AGGTCTCCTGCCTATCTCCAAGG + Intergenic
989344340 5:40412246-40412268 TGGTCTGGTGTCAATCTCCAGGG - Intergenic
994478338 5:100299566-100299588 GGTCCTGGAACCAATCTCCAAGG - Intergenic
994954916 5:106515929-106515951 GGGTCTGGAACCAATCCCCCAGG + Intergenic
997416225 5:133730945-133730967 GAGTCTGCATCCATTCCCCAGGG - Intergenic
999173039 5:149611552-149611574 GGCTCTGTAGCCGAGCTCCATGG + Intronic
999264076 5:150255233-150255255 GGGTCTCCAGCCAGACTGCAGGG - Intronic
1002663496 5:180806539-180806561 GGTTCTGCTGCAAACCTCCAGGG - Intronic
1003126870 6:3362737-3362759 GGACCTGCAGCCTTTCTCCATGG - Intronic
1003220929 6:4160419-4160441 GGGTCTGTAGCCTCTTTCCATGG + Intergenic
1003383178 6:5643708-5643730 TGGTTTGGAGCCAATTTCCAAGG + Intronic
1003460404 6:6323187-6323209 TGGTCAGCAGCCTCTCTCCAGGG - Intergenic
1003785054 6:9476108-9476130 AGGTTTGCAGCAAATTTCCAGGG + Intergenic
1004030111 6:11859958-11859980 GGATCTATAGCCAATTTCCATGG + Intergenic
1013332612 6:109120186-109120208 GGTTCTGCAGCAAAACTCCTTGG - Intronic
1017028361 6:150200317-150200339 GAGACTACTGCCAATCTCCAGGG - Intronic
1021965530 7:25914788-25914810 GGTACTGCAGCCAATCTCAAAGG + Intergenic
1022379920 7:29850466-29850488 GGTTTTGGAGCCAAACTCCAGGG + Intronic
1024263269 7:47587579-47587601 CCCTCTCCAGCCAATCTCCAAGG - Intergenic
1029052078 7:97700041-97700063 GGGTCTCCAGCCACTCCCAAAGG + Intergenic
1029528357 7:101109124-101109146 GGGTCTGGGGCCAGTCTCCTAGG + Intergenic
1030289374 7:107857051-107857073 GGGTCTGCAGCCATTCACAGAGG - Intergenic
1032800927 7:135316835-135316857 GGGCCGGCAGCCATGCTCCAGGG + Intergenic
1035125796 7:156607284-156607306 GGGCCTGGAGCCAAGCTGCAGGG - Intergenic
1035270748 7:157718671-157718693 GACACTGCAGCCACTCTCCATGG + Intronic
1035270760 7:157718732-157718754 GACACTGCAGCCACTCTCCATGG + Intronic
1036205850 8:6805346-6805368 AGGACTGCAGCCAACCCCCAGGG - Intergenic
1038461678 8:27722577-27722599 GGGTCTGAGGCCAATGGCCAGGG - Intergenic
1039986774 8:42454321-42454343 GGTCCTACAGCCAATCTCCGAGG + Intronic
1046669605 8:117043268-117043290 GGGTCTGGATCCAATGTCCTTGG - Intronic
1047403114 8:124562579-124562601 GGGTTTGAAGCCTGTCTCCATGG - Intronic
1049521076 8:143091825-143091847 GGGTCTGCTCCCAGTCTTCATGG + Intergenic
1059353201 9:113680333-113680355 GAGTTTGCAACCAATCTCGAGGG + Intergenic
1059385398 9:113960444-113960466 GGGTCTGGATCCAATCTGCATGG + Intronic
1061041837 9:128145066-128145088 GGGACTGCGGCCCAGCTCCATGG + Intergenic
1062337713 9:136079699-136079721 GCTTCTGCAGCCACGCTCCAGGG - Intronic
1185601007 X:1339305-1339327 GGGACCGCAGCCCACCTCCAAGG - Intronic
1187416124 X:19094850-19094872 GGGGCTGCAGCCAAGTTCCCTGG - Intronic
1189710584 X:43807533-43807555 GGCTCTGGAGCCAGTCTCCCTGG + Intronic
1192503183 X:71666308-71666330 AGGCCTGCTGCCATTCTCCAGGG + Intergenic
1192503625 X:71668259-71668281 AGGCCTGCTGCCATTCTCCAGGG - Intergenic
1192510845 X:71719580-71719602 AGGCCTGCCGCCATTCTCCAGGG - Intergenic
1192515852 X:71761973-71761995 AGGCCTGCCGCCATTCTCCAGGG + Intergenic
1193428306 X:81368163-81368185 GTGTCTGTAGCAGATCTCCAAGG + Intergenic
1195100926 X:101553123-101553145 GGGTCTGGGGCCAAACTTCAGGG + Exonic
1199665880 X:150095996-150096018 GGGTGTGCAGGCAATCACCAAGG - Intergenic
1199677535 X:150200590-150200612 GGGCCTGCCACCATTCTCCATGG + Intergenic
1202373554 Y:24213906-24213928 GGTTCAGCAGCCCCTCTCCAGGG - Intergenic
1202497227 Y:25456214-25456236 GGTTCAGCAGCCCCTCTCCAGGG + Intergenic