ID: 1184326427

View in Genome Browser
Species Human (GRCh38)
Location 22:43790983-43791005
Sequence GAAGATCAACACTTCCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184326424_1184326427 15 Left 1184326424 22:43790945-43790967 CCTGAGATGGGAAAGACTGCAGG No data
Right 1184326427 22:43790983-43791005 GAAGATCAACACTTCCATTTTGG 0: 1
1: 0
2: 0
3: 23
4: 195
1184326423_1184326427 21 Left 1184326423 22:43790939-43790961 CCATTACCTGAGATGGGAAAGAC 0: 2
1: 4
2: 32
3: 117
4: 435
Right 1184326427 22:43790983-43791005 GAAGATCAACACTTCCATTTTGG 0: 1
1: 0
2: 0
3: 23
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184326427 Original CRISPR GAAGATCAACACTTCCATTT TGG Intronic
901150650 1:7098960-7098982 AAACATCAACACTTCCCTCTTGG - Intronic
902445583 1:16461714-16461736 GAAGATCAGCACTTGGATTGTGG + Intergenic
906437933 1:45812797-45812819 GAAAATCAAGACTTCATTTTTGG - Intronic
906606503 1:47176090-47176112 AAAGATCAAGAATTCCATTTTGG + Intergenic
907954904 1:59218778-59218800 GAAGGTCAACACCTTGATTTTGG - Intergenic
908410446 1:63859294-63859316 GAAGATCCCCTCTTCTATTTTGG + Intronic
909430041 1:75576967-75576989 GAAGATCAAGAATTCAGTTTTGG - Intronic
909843520 1:80360543-80360565 GGAGTTCAACACATACATTTGGG - Intergenic
911648138 1:100357104-100357126 GAAGATCAGGCATTCCATTTTGG + Intronic
911816661 1:102360846-102360868 GAACATCAACACATGAATTTTGG + Intergenic
912486393 1:110032561-110032583 AAAGATCAAGACTTCAGTTTTGG - Intronic
913220559 1:116657092-116657114 GAAAATCAAGATTTCCTTTTGGG + Intronic
916403555 1:164474654-164474676 GATGAACAACATTTCCATTTTGG + Intergenic
917344660 1:174016790-174016812 TAAGATTGACATTTCCATTTGGG - Intronic
918234745 1:182569883-182569905 GAAGACCAAGAGTTTCATTTGGG - Intergenic
919325066 1:196097317-196097339 GAAGTTCAACAGTACCATTAAGG - Intergenic
921245663 1:213236419-213236441 GAAAATCAAGGATTCCATTTTGG + Intronic
921757991 1:218881652-218881674 GAAGATCACCCCTGCCATTGTGG - Intergenic
923369119 1:233292713-233292735 GAAGAACAAAGCCTCCATTTGGG + Intronic
923790398 1:237106512-237106534 GAAGATCAAGAGTTTCATTCTGG + Intronic
1063026602 10:2185013-2185035 AAAGATGAACACATCCATATTGG + Intergenic
1065493984 10:26310532-26310554 ACAGATCAAAACGTCCATTTAGG + Intergenic
1067540162 10:47145076-47145098 AAAGATCACCACTTCTATTAGGG - Intergenic
1069112208 10:64462043-64462065 AAAGATCAAGAGTTCAATTTGGG - Intergenic
1071711923 10:88058454-88058476 GAAATCCAAGACTTCCATTTTGG + Intergenic
1071787924 10:88923769-88923791 CAAGAACAACACTTCTATTCAGG + Intronic
1076072315 10:127500032-127500054 GAGGAAAACCACTTCCATTTTGG - Intergenic
1077630747 11:3809524-3809546 GAAGATCTAGTCTTCAATTTGGG + Intronic
1077884131 11:6373453-6373475 AAAGATCAAAAGCTCCATTTTGG + Intergenic
1078898700 11:15621555-15621577 GAATATCACCACTTTCCTTTAGG - Intergenic
1079593807 11:22215569-22215591 GAAGATAAAGAATTACATTTTGG - Intronic
1079926889 11:26505328-26505350 GAAGATAAACAATTTCATTTTGG + Intronic
1084345145 11:68542050-68542072 ACAGGTCATCACTTCCATTTAGG - Intronic
1085380055 11:76108008-76108030 AAAGATCAACACTTTCATGATGG - Intronic
1086163641 11:83751758-83751780 GAAGATCAAAAGGTCAATTTTGG + Intronic
1087586908 11:100133312-100133334 GAGGATTAACTGTTCCATTTAGG + Intronic
1087795270 11:102449948-102449970 GAAAATCAGTAGTTCCATTTTGG - Intronic
1088009490 11:104982620-104982642 CATGCTCCACACTTCCATTTAGG + Intergenic
1088386029 11:109257275-109257297 GCAGTTCAACACTTTCCTTTTGG + Intergenic
1088794557 11:113256738-113256760 GAAAATCACCCTTTCCATTTTGG + Intronic
1090298520 11:125612503-125612525 GTAGATCAAGACATCAATTTAGG - Intronic
1090476506 11:127026649-127026671 GGAGATCAAGAATTCCATTTTGG + Intergenic
1090588923 11:128244408-128244430 AAAAATCAACAATTCCAATTGGG + Intergenic
1093144963 12:15554291-15554313 GAACATCAAGACTTCAGTTTTGG + Intronic
1095357139 12:41288493-41288515 GAAGAACTACAGTTCCAATTAGG - Intronic
1096988167 12:55775793-55775815 GAAGAGCAACTCTGCTATTTTGG + Intronic
1098225006 12:68312303-68312325 GAAGATCAAGAATTCCGTTCTGG - Intronic
1098230334 12:68366570-68366592 GGAAATCAAAAGTTCCATTTTGG - Intergenic
1098597658 12:72293451-72293473 GAAGCTCAGAAATTCCATTTTGG + Intronic
1099815193 12:87637732-87637754 GAAAATCAACTCTTTTATTTTGG + Intergenic
1100824890 12:98465342-98465364 GAAAATCAACACCTTGATTTTGG - Intergenic
1100828537 12:98497058-98497080 GATGATCAACATTTCAGTTTTGG - Intronic
1101002278 12:100368490-100368512 GAACATCAACATATCTATTTTGG + Intronic
1104166055 12:126230591-126230613 GAAGATCAAGAGTTCAACTTTGG + Intergenic
1104644388 12:130486546-130486568 GAAAATCAAGAATTCTATTTCGG - Intronic
1104835017 12:131784075-131784097 CATGATCAACACTACCACTTGGG - Intronic
1106667886 13:31871627-31871649 GAAGCTCAGCAGTTCCATCTGGG + Intergenic
1107680345 13:42842021-42842043 GAAGATCCACACTACCATGAAGG + Intergenic
1110578814 13:77094180-77094202 GCCGACCAACAGTTCCATTTTGG - Intronic
1112984818 13:105435399-105435421 GAATATCAATGCTTCCATTTTGG - Intergenic
1113331003 13:109327559-109327581 GAGGAACACCACTGCCATTTGGG + Intergenic
1114283568 14:21218317-21218339 AAAGATCAACACTGACATATGGG - Intronic
1115332150 14:32209776-32209798 GAAAATGAACAATTCTATTTTGG - Intergenic
1115762903 14:36593490-36593512 GGACATCAAAACTTCCATTCAGG + Intergenic
1117096214 14:52300975-52300997 GAAGCTCACCACCTCCGTTTTGG - Intergenic
1117587219 14:57221768-57221790 GAAGATAAAGAGTTTCATTTTGG + Intronic
1120018231 14:79498477-79498499 GGGGATCAAGAATTCCATTTTGG - Intronic
1120019303 14:79510312-79510334 AAAGATCAGCACTCACATTTAGG + Intronic
1120660797 14:87249006-87249028 GGAAATCAGCACTTCCAGTTTGG + Intergenic
1120762130 14:88294492-88294514 GAAAATCAACAATTCTCTTTTGG + Intronic
1121406128 14:93720402-93720424 GAAGAACAACACCTCCTTCTTGG + Exonic
1121424670 14:93841246-93841268 GAACTTCAACATATCCATTTGGG - Intergenic
1121499873 14:94426334-94426356 GCAGATCAGTACTTCCATTCTGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1128365872 15:67002356-67002378 GAAGATCATCAGTACCATCTTGG - Intergenic
1128369746 15:67031978-67032000 GAAGATCAGGAGTTCCATTTTGG - Intergenic
1131567714 15:93502077-93502099 GAAGATCAGCACTCACTTTTGGG + Intergenic
1133878887 16:9762328-9762350 GAAGATCCACACTTAGATCTCGG + Exonic
1134851515 16:17482709-17482731 GAAGTTCAAGAATTCCATTTTGG - Intergenic
1135524369 16:23202854-23202876 GAAGATGACCACTTCGATTTGGG + Intronic
1139195672 16:64915905-64915927 AAAGGTCAACATTTCCATTTGGG + Intergenic
1140908886 16:79433511-79433533 GAAAAGCATCACTTCCATTATGG - Intergenic
1140939058 16:79703956-79703978 GAAGATCATCAATAGCATTTAGG + Intergenic
1142861542 17:2765145-2765167 AAAGATTATGACTTCCATTTGGG - Intergenic
1143989836 17:10947650-10947672 GAAGATCAGCAGTTCAGTTTAGG + Intergenic
1144385285 17:14743903-14743925 GAAGATCAACACATCCAACTGGG - Intergenic
1146239691 17:31208454-31208476 GAAGGTCAATACTTCCATACTGG - Intronic
1148292575 17:46467776-46467798 GGAGATGAACACTTGCATATAGG + Intergenic
1148314759 17:46685469-46685491 GGAGATGAACACTTGCATATAGG + Intronic
1150175779 17:63054261-63054283 GAAGAGCAGCTCTTCTATTTGGG - Intronic
1151138417 17:71969561-71969583 AAAAATCAAGATTTCCATTTTGG + Intergenic
1153087213 18:1302145-1302167 GAAAATCAATAATTCCCTTTTGG - Intergenic
1155791489 18:29976263-29976285 GAAAATCAAAACTTCCAAATAGG - Intergenic
1156201565 18:34838525-34838547 AAAAATAAAGACTTCCATTTAGG - Intronic
1158728335 18:59995355-59995377 GAAGACCTCCACTTCCACTTAGG - Intergenic
1159238384 18:65707266-65707288 GAAGTTGAACATTTCCATTTTGG - Intergenic
1159437263 18:68435098-68435120 GAGGATCAATACTTTCCTTTGGG - Intergenic
1163614317 19:18317903-18317925 GGAAATCAACACTTTCATTTTGG + Intronic
1165802903 19:38563807-38563829 GAAGCTAAACACATCCATTCTGG + Intronic
1168275322 19:55274679-55274701 GAACATCAACCCATGCATTTTGG - Intronic
925676395 2:6366667-6366689 GAAGATCAAGAGCTTCATTTGGG + Intergenic
926842830 2:17101721-17101743 GAAGATCAAAAGTTCAGTTTTGG + Intergenic
927030272 2:19113981-19114003 GAAGATTTACACTTTCATGTTGG + Intergenic
928040946 2:27876689-27876711 TAAGAACATCATTTCCATTTAGG + Intronic
931336832 2:61354032-61354054 GCAGAGCAACACATTCATTTTGG + Intronic
933005294 2:76985110-76985132 GAAGATAAAGAATTCCTTTTGGG - Intronic
935640393 2:105284593-105284615 GGAGATCAAGACGTGCATTTGGG - Intronic
939025137 2:137003613-137003635 GAAGATTCTGACTTCCATTTGGG + Intronic
940698237 2:157007853-157007875 CAAGTTCAACATTTCCTTTTAGG - Intergenic
946268977 2:218573434-218573456 GGAGATCAACACGTGGATTTGGG - Intronic
947690082 2:232127278-232127300 AAAGATCAATAATTCTATTTCGG - Intronic
1168863475 20:1063384-1063406 GAAGATTCAGACTTCCACTTTGG - Intergenic
1169411056 20:5370753-5370775 GAAGATCAAGAGTTCAGTTTTGG - Intergenic
1172786997 20:37475039-37475061 GAAAATCAGGAGTTCCATTTGGG - Intergenic
1173262843 20:41451880-41451902 GAAGATCAAGAGTTTCATTTGGG - Exonic
1173889497 20:46495103-46495125 GAAGTTAAATACTTCAATTTAGG + Intergenic
1177442180 21:21140310-21140332 GAAGCTAAACATTTCTATTTTGG + Intronic
1180603670 22:17038830-17038852 AAATATCAGCCCTTCCATTTAGG - Intergenic
1180822093 22:18837330-18837352 GAAAATCAAGATTTCCTTTTGGG + Intergenic
1181190882 22:21138716-21138738 GAAAATCAAGATTTCCTTTTGGG - Intergenic
1181208324 22:21271791-21271813 GAAAATCAAGATTTCCTTTTGGG + Intergenic
1182088543 22:27578215-27578237 AAATATCATCACTTCCAATTTGG + Intergenic
1183839027 22:40482354-40482376 GAAGCTCACCACTTCATTTTGGG + Intronic
1184326427 22:43790983-43791005 GAAGATCAACACTTCCATTTTGG + Intronic
1203218607 22_KI270731v1_random:23621-23643 GAAAATCAAGATTTCCTTTTGGG - Intergenic
1203272225 22_KI270734v1_random:63215-63237 GAAAATCAAGATTTCCTTTTGGG + Intergenic
949352213 3:3135515-3135537 GAATATGAACACTTCCCCTTGGG + Intronic
949863205 3:8524983-8525005 GAATATCAAAACATCAATTTGGG - Intronic
950232839 3:11291725-11291747 ACAGATGAACACTTCCATTAGGG - Intronic
950998842 3:17534167-17534189 GAATAACATCACTTTCATTTAGG + Intronic
951337456 3:21442153-21442175 AAATATCAACACTTGAATTTTGG + Intronic
955524541 3:59807161-59807183 GAAGATCAAAAATTACATTTTGG + Intronic
958525330 3:95251544-95251566 GAAGCTCAAAACTTCCAAATAGG - Intergenic
961460946 3:127050108-127050130 GGATATCAACACTTCCAGTGGGG + Intergenic
963180545 3:142350862-142350884 GAAGAACAAGAGTTCAATTTTGG + Intronic
963564127 3:146906300-146906322 GAATTTCAACACATCAATTTTGG + Intergenic
963609619 3:147450036-147450058 TAAGACCCACACTTACATTTCGG - Intronic
964216830 3:154294514-154294536 GAAGATGAATACTTCCATGCTGG + Intronic
967795593 3:193595300-193595322 AAAGATCAATACTAACATTTGGG + Intronic
968153292 3:196356792-196356814 GAAGTTCAAAACGTTCATTTGGG + Exonic
969102839 4:4782533-4782555 GAACATCAACACTCTCATGTGGG - Intergenic
970059030 4:12009123-12009145 AAAGATCAACTTTCCCATTTAGG + Intergenic
970877564 4:20889642-20889664 AAATATCAGCCCTTCCATTTAGG - Intronic
971374954 4:26049271-26049293 GAAGAGCGACACATCCTTTTAGG + Intergenic
973291398 4:48474355-48474377 GAAGTACATCACTTCCATGTTGG - Intergenic
973930634 4:55790180-55790202 GAAGCTAAACAACTCCATTTTGG + Intergenic
974157195 4:58089349-58089371 ATAGAACAACACTTTCATTTTGG - Intergenic
974221581 4:58980198-58980220 GAAGTTGACCACTTACATTTGGG - Intergenic
975202864 4:71611489-71611511 GAAGATAAAGAGTTCCATTTTGG + Intergenic
976250973 4:83051621-83051643 GAATATCAAGAGTTTCATTTTGG + Intronic
977091165 4:92677545-92677567 GGAGATCAAGAGTTCAATTTGGG - Intronic
977983780 4:103358800-103358822 GTAGATCAATACATCAATTTGGG + Intergenic
978266006 4:106824763-106824785 GAATATCAGAACTTCCATTTAGG - Intergenic
980335864 4:131472565-131472587 GAACATCAACATATCAATTTTGG + Intergenic
981759401 4:148176939-148176961 GAAGAAGAACAATTACATTTTGG + Intronic
983380488 4:166985850-166985872 GGATATCAACATTTCCAATTTGG + Intronic
985288279 4:188359741-188359763 CCAGATCAACTCTTCCATTAGGG - Intergenic
986906526 5:12501049-12501071 GAAGATGATCAGTTCAATTTGGG - Intergenic
987623390 5:20366169-20366191 GAAGATCATCAATTTCATTTTGG - Intronic
988249413 5:28736294-28736316 GATGATCAACAAATCCATTATGG + Intergenic
989235299 5:39141427-39141449 GTAAATCAACACTTCAATTCTGG + Intronic
989469858 5:41803095-41803117 GAAGATGAACAGTTATATTTGGG + Exonic
990427477 5:55701320-55701342 GAAAATCAGAAATTCCATTTTGG - Intronic
995865925 5:116690446-116690468 GAATATCAAGACTGCTATTTTGG + Intergenic
996759777 5:126975610-126975632 GAAGATCTTCACTGCCATCTTGG + Intronic
998498326 5:142610472-142610494 GAAGATGGCCAGTTCCATTTTGG - Intronic
1001342504 5:170861219-170861241 CAAGTTCAGCATTTCCATTTGGG - Intergenic
1007015090 6:38457593-38457615 AAAAATCAAGACTTCCATTTGGG + Intronic
1010456367 6:76060659-76060681 GAAGATTAAAACTCACATTTTGG + Intronic
1012432593 6:99181134-99181156 GAAGTTTCACATTTCCATTTGGG + Intergenic
1012759086 6:103274497-103274519 GGAGATCAAAAGTGCCATTTAGG - Intergenic
1014856870 6:126412543-126412565 AAAGCTCAACAATTCCATGTAGG - Intergenic
1016279591 6:142400342-142400364 GAAGATAAACACTAATATTTTGG + Intronic
1017167870 6:151426634-151426656 GAAACTTAACATTTCCATTTTGG + Intronic
1017289190 6:152715620-152715642 GAAAAACAAGAATTCCATTTAGG + Intronic
1017308237 6:152945756-152945778 GAAAAACAACACTATCATTTTGG + Intergenic
1018600470 6:165533197-165533219 CAAGAACATCACTTTCATTTAGG - Intronic
1020553138 7:9633409-9633431 GGAGATCAAGAGTTTCATTTTGG - Intergenic
1021922510 7:25500183-25500205 GAAGATCAAAATTTCAGTTTAGG - Intergenic
1022802223 7:33787553-33787575 GAAGTTGAACATTTCCCTTTCGG + Intergenic
1024378469 7:48666278-48666300 GAACATCAACACACACATTTTGG + Intergenic
1024558296 7:50622462-50622484 GAAGAGCAACAAGTCCTTTTCGG - Intronic
1031309272 7:120174245-120174267 GAAGGTCTAGACTTGCATTTTGG + Intergenic
1031759280 7:125690938-125690960 GAAGATGAAGATTTCCATTCTGG - Intergenic
1032406975 7:131663444-131663466 GAACTTCAACACATACATTTTGG + Intergenic
1032817431 7:135491123-135491145 GAAAAGCAAGAATTCCATTTTGG + Intronic
1033942832 7:146677207-146677229 GAAGAACCCCACTTCCAGTTTGG - Intronic
1037064755 8:14564246-14564268 GAATATCAACACTCCCAGTAAGG - Intronic
1038083581 8:24168434-24168456 TAAGTTCAACACTTCTTTTTGGG - Intergenic
1039309936 8:36306455-36306477 GAACTTCATCATTTCCATTTTGG - Intergenic
1040652225 8:49462108-49462130 GAAGGTAAAATCTTCCATTTTGG - Intergenic
1043391810 8:79799022-79799044 GAGGATGAATCCTTCCATTTGGG + Intergenic
1044051462 8:87511123-87511145 GAAGCAGAACACTTCCATTAGGG - Intronic
1044473625 8:92601300-92601322 GAATATAAACACTTACCTTTAGG + Intergenic
1045558787 8:103240635-103240657 GAAAATCAACAGTTCTCTTTGGG + Intergenic
1046442432 8:114275547-114275569 GATTATCAACATTTACATTTAGG + Intergenic
1046673751 8:117086251-117086273 GAAGATGAACACTCCCGTTAGGG + Intronic
1046723788 8:117652791-117652813 GAAGATAATCACTTGCATTTTGG - Intergenic
1047208545 8:122822259-122822281 GAAGGTCAAGACCTCCACTTGGG + Intronic
1048263582 8:132966043-132966065 GTAGATGAAGACTACCATTTTGG + Intronic
1050595114 9:7197313-7197335 GAAAAACAAAAATTCCATTTGGG - Intergenic
1050836525 9:10087275-10087297 GAAGATGAGCATTTCCATTTGGG - Intronic
1051144747 9:14015183-14015205 GAAGATCAAGACTTTGATTTTGG - Intergenic
1051783108 9:20712206-20712228 GAAGACAAAGAATTCCATTTTGG - Intronic
1052987361 9:34497564-34497586 GAAGATCGAGACCTCTATTTGGG - Intronic
1054959212 9:70948742-70948764 GAAGCTAAAGACTACCATTTGGG - Intronic
1054990572 9:71320828-71320850 GAAGATCAACACTTTCTCGTTGG - Intronic
1056885250 9:90436283-90436305 GAAGATAAATACTTCCTTTAAGG - Intergenic
1057768139 9:97941701-97941723 GATGATCAAGAGTTTCATTTTGG + Intronic
1059117901 9:111615925-111615947 GCAGATTAACACTTCCTTGTGGG + Intergenic
1059483021 9:114606884-114606906 AAAGATCAAAACTTACATCTTGG - Intergenic
1059816369 9:117920264-117920286 GAAGGTCAACAGTTACATATCGG - Intergenic
1060456628 9:123804664-123804686 AAAGATCAGGAGTTCCATTTTGG - Intronic
1190882315 X:54500544-54500566 GAAGATCAAGAGTTCAGTTTTGG + Intergenic
1191586228 X:62829497-62829519 GAAAATCAAGACTTCTATTTTGG + Intergenic
1194046287 X:89008667-89008689 GAAGTTCAATACTTACATTTAGG - Intergenic
1198882220 X:141293956-141293978 GAATTTCAACACGTGCATTTTGG - Intergenic
1199526839 X:148802260-148802282 GAATAACAACACTTTCACTTTGG - Intronic
1200738913 Y:6831870-6831892 GAAGCACTACACTTCCATGTGGG - Intergenic