ID: 1184326495

View in Genome Browser
Species Human (GRCh38)
Location 22:43791494-43791516
Sequence CCTTCAACGGTGAACGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184326495_1184326499 0 Left 1184326495 22:43791494-43791516 CCTCCAACGTTCACCGTTGAAGG No data
Right 1184326499 22:43791517-43791539 AGATGAAGAAGAACCAGCAAAGG 0: 2
1: 6
2: 39
3: 154
4: 826
1184326495_1184326501 20 Left 1184326495 22:43791494-43791516 CCTCCAACGTTCACCGTTGAAGG No data
Right 1184326501 22:43791537-43791559 AGGAGACTGAGAAAGACCAGAGG 0: 1
1: 0
2: 5
3: 44
4: 579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184326495 Original CRISPR CCTTCAACGGTGAACGTTGG AGG (reversed) Intronic
No off target data available for this crispr