ID: 1184326746

View in Genome Browser
Species Human (GRCh38)
Location 22:43793632-43793654
Sequence CAACTAACACTACTGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184326743_1184326746 -10 Left 1184326743 22:43793619-43793641 CCCGCAGCATCTCCAACTAACAC 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1184326746 22:43793632-43793654 CAACTAACACTACTGTAGCCTGG No data
1184326742_1184326746 -9 Left 1184326742 22:43793618-43793640 CCCCGCAGCATCTCCAACTAACA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1184326746 22:43793632-43793654 CAACTAACACTACTGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184326746 Original CRISPR CAACTAACACTACTGTAGCC TGG Intronic
No off target data available for this crispr