ID: 1184326765

View in Genome Browser
Species Human (GRCh38)
Location 22:43793800-43793822
Sequence CCTTCAGATGAACCGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184326765 Original CRISPR CCTTCAGATGAACCGATGGA TGG (reversed) Intronic
902599042 1:17528631-17528653 TCTTCAGATGAATGAATGGATGG - Intergenic
907630290 1:56074303-56074325 CCTGCACATTAACAGATGGAGGG - Intergenic
918051463 1:180976520-180976542 CCTGCATATGAACCGAGGGGAGG - Exonic
920189585 1:204184615-204184637 CCTTGGGATGAAACCATGGAAGG - Intergenic
920444077 1:206002465-206002487 CAGACAGATGAACAGATGGATGG - Intronic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1075009731 10:118857473-118857495 CCTGCAGAAGAACCGATGGTGGG + Intergenic
1075668637 10:124248108-124248130 CCGACAGATGGACGGATGGATGG + Intergenic
1076900643 10:133335897-133335919 CGTGCAGATGGACAGATGGATGG + Intronic
1090601769 11:128379656-128379678 CCTTCAGAAGAACAGAAAGATGG - Intergenic
1091544538 12:1492593-1492615 CCTCCAGAAAAACGGATGGAAGG + Exonic
1098154301 12:67581482-67581504 AATTCAGATGAACTCATGGAAGG - Intergenic
1099894629 12:88629519-88629541 CCCTCATATGCACAGATGGATGG + Intergenic
1101286220 12:103315436-103315458 ACTACAGATGAACCCATTGAAGG - Intronic
1104765444 12:131327359-131327381 CAGACAGATGAACAGATGGATGG + Intergenic
1104813879 12:131634704-131634726 CAGACAGATGAACAGATGGATGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1113566078 13:111320479-111320501 CACTCAGATGAACAGATGTAGGG - Intronic
1118420288 14:65594624-65594646 CATGCAGATGAACTGAAGGATGG + Intronic
1118455180 14:65939250-65939272 CCTTGACATGAACCGAAGGAAGG + Intergenic
1128122406 15:65162161-65162183 GCATCAGATGGTCCGATGGAGGG - Intronic
1128917538 15:71577952-71577974 TCCTCAGATGATCCGATGGAGGG + Intronic
1137466486 16:48714504-48714526 CCTTGAGAAGAAAGGATGGAGGG - Intergenic
1139698499 16:68692446-68692468 CCTCCAGATGACCTGATGGCAGG - Intronic
1143395792 17:6594788-6594810 ACATAAGATGAACTGATGGATGG + Intronic
1151045241 17:70912149-70912171 GCTGCAGATTACCCGATGGAAGG - Intergenic
1160335556 18:78035652-78035674 CCTTCAGATGAACATAGGGTAGG + Intergenic
931610677 2:64096270-64096292 ACATCAGATGGACAGATGGATGG - Exonic
933808652 2:86018241-86018263 CCTTCAGAGGCCACGATGGAAGG + Intergenic
934613984 2:95760242-95760264 CAGACAGATGAACCAATGGATGG + Intergenic
934646942 2:96064311-96064333 CAGACAGATGAACCAATGGATGG - Intergenic
934674437 2:96239623-96239645 CCCTCAGCTGAACCCATGGAAGG - Intergenic
934840343 2:97620382-97620404 CAGACAGATGAACCAATGGATGG - Intergenic
939280148 2:140053744-140053766 CCTAAAAATGAACCGATGAAAGG + Intergenic
948796966 2:240410093-240410115 CGTTTAGATGAAGCTATGGAGGG - Intergenic
1175862148 20:62156296-62156318 CCTTCAGATGAACTGCAGGAAGG - Intronic
1178715527 21:34960627-34960649 CCTTAAGATGAAGCAATAGAGGG + Intronic
1179182037 21:39053730-39053752 CGAACAGATGAACAGATGGAGGG - Intergenic
1181002469 22:19994345-19994367 CATACAGATGAATGGATGGATGG + Intronic
1181482171 22:23207111-23207133 ACTTCAAATGAACAGATGAATGG - Intronic
1181928629 22:26380846-26380868 CCTTCAGAAGAACCGTGAGAGGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184326765 22:43793800-43793822 CCTTCAGATGAACCGATGGATGG - Intronic
952963716 3:38608394-38608416 TCTTCAGAGGAACAGAAGGAAGG - Intronic
955423691 3:58765537-58765559 CCTTCACAGGAACAAATGGATGG - Intronic
955505936 3:59633225-59633247 TCATCAGATGAAGAGATGGAAGG - Intergenic
957009145 3:74985201-74985223 CCTGCACAGGAACCCATGGAGGG + Intergenic
960819542 3:121713893-121713915 ATTTAAGATGAACTGATGGATGG + Intronic
969450547 4:7270473-7270495 CCCTCAGAGGAAGCGCTGGAGGG - Intronic
978190892 4:105910274-105910296 CCTTCAGATGAACTGAAGCAAGG + Intronic
981221431 4:142241417-142241439 CCTTGAGATGAACACATAGAAGG + Intronic
982167530 4:152628304-152628326 CCCTCAGAGGCAGCGATGGATGG + Exonic
994588153 5:101738010-101738032 CCATCTGATGAACAGAGGGATGG + Intergenic
994742684 5:103641710-103641732 CCCACAGATGAATGGATGGAGGG - Intergenic
1003690623 6:8350159-8350181 CCTTCAGATGGATCGTTGCATGG - Intergenic
1007918065 6:45579567-45579589 CCTTCAGATAAATTGTTGGAAGG - Intronic
1008647767 6:53532606-53532628 CATTCAGATTAACTGCTGGAGGG - Intronic
1013178684 6:107699872-107699894 CCTGCAGAGGAAACGATGGCAGG - Intergenic
1017418673 6:154249596-154249618 CCTTCAGATGAACAAATGAGAGG + Intronic
1017966189 6:159268899-159268921 CAAGCAGATGAACAGATGGATGG - Intronic
1019710192 7:2514786-2514808 CCGACAGATGAATGGATGGATGG - Intronic
1023304184 7:38806286-38806308 CATTCAGAGGAACAGATGAAAGG + Intronic
1030093617 7:105878185-105878207 ACTTAAGATGGACAGATGGAAGG - Intronic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1038198265 8:25387956-25387978 CATTCAGATGAAACAATGGTGGG - Intronic
1041948390 8:63472955-63472977 CCTTCAGATGGCCCACTGGAGGG - Intergenic
1044149835 8:88762125-88762147 ACTTCAGAGAAACCAATGGAAGG + Intergenic
1047635460 8:126756823-126756845 CCTTTTGAAGAACTGATGGAAGG - Intergenic
1048312208 8:133332632-133332654 CCTCCAGATGAACCAATACAGGG - Intergenic
1050002208 9:1089506-1089528 GCTTCAGAGGAAGCAATGGAAGG + Intergenic
1051397729 9:16643940-16643962 CTTTCAGAAGAACCTATGGGAGG + Intronic
1059048606 9:110897575-110897597 CATTCAGATAAACAGATGAATGG - Intronic
1059410782 9:114130976-114130998 CCTTAAGAGGAACCTCTGGAGGG - Intergenic
1187450217 X:19389390-19389412 CCTTCAGAGGAACACAGGGAGGG + Intronic
1188491781 X:30745507-30745529 CCTTCAGCAGAACTGAAGGAAGG - Intergenic