ID: 1184328749

View in Genome Browser
Species Human (GRCh38)
Location 22:43812222-43812244
Sequence CTCTGAGACCCCGCGGCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328749_1184328757 2 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328749_1184328760 26 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328749_1184328756 -8 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328749 Original CRISPR CTCTGAGACCCCGCGGCTTG GGG (reversed) Exonic
900358344 1:2275450-2275472 GTCTGAGACCCCGAGCCCTGGGG + Intronic
900691518 1:3983340-3983362 CTCTCGGACCCCGAGGCTTGGGG + Intergenic
903331801 1:22600406-22600428 CCCTGAGCCCCCTTGGCTTGTGG + Intronic
904009828 1:27383210-27383232 CTCCGGGACCCCGCGCCTTGCGG - Exonic
906611374 1:47206082-47206104 CTCTGAGAGGCCGAGGCTGGAGG + Intergenic
915479809 1:156176865-156176887 CTGTGAGACCCTGCGCCCTGGGG + Exonic
917817541 1:178725633-178725655 CTCTGAGAACCCGCGGCCGAGGG - Intronic
1063064568 10:2595118-2595140 CCCTGAGACCCAGGAGCTTGAGG + Intergenic
1069898224 10:71692007-71692029 CTCTGAGACCCCTGGGAATGAGG - Intronic
1070681529 10:78452432-78452454 CTCTGAGTCCCTGAGGCTTGGGG - Intergenic
1079016221 11:16870989-16871011 CTCTGAGACAGAGGGGCTTGGGG - Intronic
1081606703 11:44531593-44531615 GTCTTAGACGCCGGGGCTTGGGG - Intergenic
1081642611 11:44766560-44766582 CTCTTATACACCGAGGCTTGAGG - Intronic
1084128908 11:67118834-67118856 CTCTGCGACCCCGCCCCTCGCGG - Intergenic
1084376825 11:68783413-68783435 CTCTGCTACCCCGGGGCATGCGG + Intronic
1089620626 11:119720250-119720272 CCCTCAGTCCCCGCGTCTTGTGG - Intronic
1091304525 11:134529144-134529166 CTCTGAGACTCCAGGCCTTGGGG + Intergenic
1094365359 12:29674150-29674172 CTCTGTGACCCCAGGGCCTGTGG - Intronic
1095771897 12:45969235-45969257 TTCTGATTCCCCGCGGCTTGAGG - Intronic
1100466214 12:94848200-94848222 CTCTGAGAGGCCGAGGCGTGTGG + Intergenic
1102187938 12:110964461-110964483 CTCAGAGACCCCAAGCCTTGTGG - Intergenic
1103321208 12:120093722-120093744 CTCTTAGACCCTGCGGCCAGAGG - Exonic
1104831384 12:131754330-131754352 CTGTGAGACCCCTGGGCTTCAGG - Intronic
1107402540 13:40083444-40083466 CTCTAAGACACTGGGGCTTGAGG - Intergenic
1108053160 13:46464507-46464529 CTCTGAGTCCCCGCCTCGTGGGG - Intergenic
1110892020 13:80706119-80706141 CTCTCAGTCCCCGCGTCGTGGGG - Intergenic
1111227663 13:85295069-85295091 CTCTGAGACCCCACTGTTGGTGG - Intergenic
1121719735 14:96100885-96100907 CTCTGGGACCTCGTGGTTTGTGG - Intergenic
1122830695 14:104394206-104394228 CTCTGAGACACAGAGGCATGGGG - Intergenic
1123034607 14:105466806-105466828 CTCTGTGTCCCCGCGGCGGGCGG + Intronic
1124380549 15:29161363-29161385 CCCTGAGACCCCAGGGCATGGGG + Intronic
1127787154 15:62365706-62365728 CTCTGCCACCCCTCGGCTGGAGG + Intergenic
1129516118 15:76158827-76158849 CTCTGAGGCCCCCTGGCTTTGGG - Intronic
1129532819 15:76282296-76282318 CTCTGATATCCCTGGGCTTGTGG - Intronic
1129927004 15:79373558-79373580 CTCTGAGATGCTGCGGCTTTGGG + Intronic
1130718922 15:86366916-86366938 CTCTGCGACACCCGGGCTTGTGG + Intronic
1132114237 15:99124124-99124146 CTCACAGTCCCCGAGGCTTGGGG + Intronic
1133199004 16:4190987-4191009 CTCTGAAACCCAGCGCCTTTGGG + Exonic
1134511291 16:14849828-14849850 CTTTGAGAGCCCGAGGCTGGTGG - Intronic
1134642599 16:15841379-15841401 CTTTGAGAGCCCGAGGCTGGTGG - Intronic
1134698934 16:16248327-16248349 CTTTGAGAGCCCGAGGCTGGTGG - Intronic
1136222243 16:28836038-28836060 CTCTGGGGCACCGCGCCTTGGGG - Exonic
1140033833 16:71358537-71358559 CGCTGAGACCCCTCGGCGCGGGG - Intergenic
1141914094 16:87082181-87082203 CTCTGAGACCCAGGGGCTTAAGG - Intergenic
1142159314 16:88548391-88548413 CTCTGAGACCCTGGAGCCTGTGG - Intergenic
1142249883 16:88986369-88986391 CTGAGAGACCCCCCGGCTTGTGG - Intergenic
1144874042 17:18387764-18387786 CTCTGAGAGGCCGAGGCTGGAGG + Intronic
1145973843 17:28972853-28972875 CTCTGAGACCCACCTGCTTCAGG - Intronic
1146846044 17:36182878-36182900 GTCTGCGGCCCCGCGGCTGGGGG - Intronic
1152307674 17:79530768-79530790 CTCTGTGGTCCCGCGGCATGTGG - Intergenic
1160514029 18:79468852-79468874 CTCTGTGACCCCCAGGATTGTGG + Intronic
1160514043 18:79468888-79468910 CTCTGGGACCCCCGGGATTGTGG + Intronic
1160514055 18:79468925-79468947 CTCTGGGACCCCCGGGATTGTGG + Intronic
1160514068 18:79468962-79468984 CTCTGGGACCCCCAGGATTGTGG + Intronic
1160514080 18:79468999-79469021 CTCTGGGACCCCCGGGATTGTGG + Intronic
1160514092 18:79469036-79469058 CTCTGGGACCCCCGGGATTGTGG + Intronic
1162416996 19:10544165-10544187 CTCTGGGACCCCGCGGCCTGCGG - Exonic
1166053329 19:40274106-40274128 CTCTGAGAGTCCGCTGCTCGTGG - Intronic
1168553268 19:57317589-57317611 CGCGGAGACCGAGCGGCTTGAGG - Intergenic
1168705301 19:58467258-58467280 CTCTGAGAAACAGAGGCTTGGGG - Exonic
934728771 2:96642830-96642852 CTCCGAGATGCTGCGGCTTGTGG + Intergenic
937784483 2:125879121-125879143 CTCTGAGAAGCCGAGGCTGGTGG + Intergenic
1169143395 20:3238352-3238374 CTCGGAGACCCCGGGGGTCGGGG + Intronic
1175927196 20:62476558-62476580 CACTGGGACCCCGAGCCTTGTGG - Intergenic
1176117066 20:63437512-63437534 CACTGACACTCCGCGGCTTGTGG + Intronic
1176159368 20:63640745-63640767 CTCTGAGACCACCTGGCGTGAGG - Exonic
1180011683 21:45055352-45055374 CTCTGAGCCCCCGCGCCTTCAGG + Intergenic
1181778880 22:25178717-25178739 CTCTGAGACCACCCGGCCTGAGG - Intronic
1184328749 22:43812222-43812244 CTCTGAGACCCCGCGGCTTGGGG - Exonic
950104062 3:10377272-10377294 CTCTGAGGCTCCGCAGCTGGAGG - Intronic
950417272 3:12875830-12875852 CTCTGCGACTCTGTGGCTTGGGG + Intergenic
959530704 3:107431448-107431470 CTCTGGGTTCCCGCGGCCTGTGG + Intergenic
965253153 3:166368719-166368741 CTCTGAGACTCCCTGGCTTCAGG + Intergenic
967493625 3:190120344-190120366 CTGTGAGACCCAGCGCCTCGGGG - Exonic
969056322 4:4405032-4405054 CTCTGAGTCCCCCCAGTTTGTGG - Intronic
974924006 4:68275526-68275548 CTTTGGGAGCCCGCGGCTGGTGG - Intergenic
976874116 4:89833718-89833740 CTTTGAGAGCCCGAGGCTGGTGG - Intronic
984969127 4:185170739-185170761 CTTTGAGACGCCGAGGCTGGTGG + Intronic
985210435 4:187586757-187586779 CTCACAGACCCCGCGGCGGGAGG - Intergenic
989750293 5:44884308-44884330 CTCTGAGCTCCCTCTGCTTGCGG - Intergenic
992550116 5:77851879-77851901 CTCCGACAGCCCGGGGCTTGCGG + Intronic
1001564190 5:172688933-172688955 CACTGAGACCCCACAGCTTGTGG - Exonic
1006691988 6:35896205-35896227 CTTGGAGACCCCACGGATTGAGG - Intronic
1007342653 6:41201275-41201297 CTGTGAGTCCTCCCGGCTTGGGG - Intergenic
1016990735 6:149926040-149926062 CTCCCTGACCCCGCCGCTTGCGG + Intergenic
1017764559 6:157595982-157596004 CACTCAGAGGCCGCGGCTTGCGG - Intronic
1020789092 7:12603384-12603406 CTTTGAGAGGCCGAGGCTTGCGG - Intronic
1033406056 7:141072767-141072789 CTCGGAGCCGCCGCGGCTAGAGG + Intergenic
1034129078 7:148699093-148699115 CACTGCGACACCGCGGCTCGGGG - Intronic
1034303870 7:150036132-150036154 CTCTGAGTCCCCGCCTCGTGGGG + Intergenic
1034801274 7:154058094-154058116 CTCTGAGTCCCCGCCTCATGGGG - Intronic
1047460542 8:125060241-125060263 CTCTGAGAGCCCGAGGCAGGTGG + Intronic
1049145958 8:141001208-141001230 CACTGTGAGCCCGCGGCGTGAGG - Intronic
1049698239 8:143994068-143994090 CTCTCACACCCCGCGGCTCTAGG + Intronic
1049749598 8:144276945-144276967 CTCTGTGACCCGGCGGGATGGGG - Intronic
1053736256 9:41104763-41104785 CTCTGAGACCCCGCCTCGCGGGG - Intergenic
1054692117 9:68326637-68326659 CTCTGAGACCCCGCCTCGCGGGG + Intergenic
1061828243 9:133275008-133275030 CTCCGAGACCCTGCGTCCTGGGG - Intronic
1062060570 9:134493195-134493217 CTTTGAGACCCCGGTGTTTGGGG + Intergenic
1062558745 9:137129792-137129814 CACTGAGAGCTCACGGCTTGCGG + Intergenic
1062610180 9:137370009-137370031 CTCTGTGGCCTCGCAGCTTGGGG + Intronic
1200079755 X:153570377-153570399 CTCTAACACCCGGTGGCTTGGGG - Intronic