ID: 1184328749

View in Genome Browser
Species Human (GRCh38)
Location 22:43812222-43812244
Sequence CTCTGAGACCCCGCGGCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328749_1184328757 2 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328749_1184328756 -8 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328749_1184328760 26 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328749 Original CRISPR CTCTGAGACCCCGCGGCTTG GGG (reversed) Exonic