ID: 1184328750

View in Genome Browser
Species Human (GRCh38)
Location 22:43812223-43812245
Sequence CCTCTGAGACCCCGCGGCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328750_1184328756 -9 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328750_1184328757 1 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328750_1184328760 25 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328750 Original CRISPR CCTCTGAGACCCCGCGGCTT GGG (reversed) Exonic
900358343 1:2275449-2275471 CGTCTGAGACCCCGAGCCCTGGG + Intronic
900691517 1:3983339-3983361 GCTCTCGGACCCCGAGGCTTGGG + Intergenic
900990417 1:6095952-6095974 ACTCTGAGACCCCTGGGCCTGGG + Intronic
903288224 1:22290329-22290351 CCTCTGGGACCACGCTGCCTGGG + Intergenic
910108147 1:83653583-83653605 CCTCTGAGCCCCCGAGGCACTGG + Intergenic
917817542 1:178725634-178725656 ACTCTGAGAACCCGCGGCCGAGG - Intronic
1062972542 10:1660007-1660029 CCTGTGAGACCCCGGGGCAGGGG + Intronic
1066658739 10:37719910-37719932 CCTCTGAGACCATGCGGCTCTGG + Intergenic
1070681530 10:78452433-78452455 CCTCTGAGTCCCTGAGGCTTGGG - Intergenic
1075702424 10:124478109-124478131 CCTCTGCAAGCCCGGGGCTTGGG - Intronic
1077559137 11:3246283-3246305 TCTCTGAGACCCCACGGGTAGGG + Intergenic
1080678513 11:34450698-34450720 CCTCTGAGACCCTGTGTCCTTGG + Intronic
1083252690 11:61478423-61478445 CCTCAGAGAGCCCACGGTTTAGG - Intronic
1086966210 11:93031171-93031193 CCTCTGAGACACAGCAGCATCGG - Intergenic
1087039424 11:93784394-93784416 CTTCTGAGGCACCGCGGCTGCGG + Exonic
1088690274 11:112320808-112320830 CCTGTGCGTCCCTGCGGCTTGGG - Intergenic
1089494044 11:118899587-118899609 CCTCTGGCACCCCCTGGCTTGGG - Intronic
1089938845 11:122394428-122394450 GCACTGAGACCCGGGGGCTTGGG + Intergenic
1090394642 11:126410822-126410844 CCTCTGAGATTCCACGGCATTGG - Intronic
1090598161 11:128341907-128341929 CCTCTGGGACCCCGCAGCTCAGG - Intergenic
1091304524 11:134529143-134529165 CCTCTGAGACTCCAGGCCTTGGG + Intergenic
1091582984 12:1800082-1800104 CCTCTGAGCCCTCCCGACTTGGG + Intronic
1091752711 12:3032707-3032729 CCTCTGAGTGCCAGCGGCCTGGG + Intronic
1092365369 12:7872806-7872828 CCTCCCAGACCCCGCGACTGCGG + Intronic
1096573282 12:52537088-52537110 CCTCTGAGACTCTGCGGATTTGG - Intergenic
1102515003 12:113440457-113440479 CCTCTGTGCCCCTGCTGCTTTGG + Intergenic
1108053130 13:46464429-46464451 CCTCTGAGTCCCCGCCTCGTTGG - Intergenic
1108053161 13:46464508-46464530 CCTCTGAGTCCCCGCCTCGTGGG - Intergenic
1122830696 14:104394207-104394229 CCTCTGAGACACAGAGGCATGGG - Intergenic
1129516119 15:76158828-76158850 ACTCTGAGGCCCCCTGGCTTTGG - Intronic
1129660373 15:77549772-77549794 CCTCTCAGACCCAGCTGCGTGGG - Intergenic
1129927003 15:79373557-79373579 TCTCTGAGATGCTGCGGCTTTGG + Intronic
1130643978 15:85707246-85707268 CTTCTGAGACACAGAGGCTTGGG + Intronic
1133199003 16:4190986-4191008 TCTCTGAAACCCAGCGCCTTTGG + Exonic
1139340881 16:66267186-66267208 CCTCTGAGACCACAGGGCTGTGG + Intergenic
1147550641 17:41439125-41439147 GCTCTGAGAGCCCGGGGCTGGGG + Intronic
1152384815 17:79966087-79966109 CCTTTGAGTCCCCCCAGCTTCGG + Intronic
1152931848 17:83113984-83114006 CCTCTGAGACACCCCGGCCTGGG - Intergenic
1161470473 19:4454545-4454567 CCTCTAAGTCCCAGCGACTTGGG - Intronic
1162564303 19:11436687-11436709 CTTCTCTGACCCCGAGGCTTGGG - Intronic
1163443664 19:17334334-17334356 CCTCCGAGAGCCCCAGGCTTGGG - Intronic
1163458640 19:17423553-17423575 CGGCTGAGACCTCGGGGCTTGGG - Exonic
1165720296 19:38074155-38074177 CCTCTGAGTCCCAGAGGCTGCGG + Intronic
1168145915 19:54420222-54420244 CCTCTGGGACCCCCCGTCTGTGG - Intronic
928008291 2:27582907-27582929 CCTCTGAGACCCCGCCCCACTGG - Intergenic
933738456 2:85513927-85513949 CCACTTAGGCCCCGTGGCTTTGG + Intergenic
935137799 2:100322386-100322408 CCTCTCAGTCCCGCCGGCTTAGG + Exonic
935386301 2:102502908-102502930 CCTCTGCAACCCTGCGGCTTTGG - Intronic
941292833 2:163697656-163697678 CCTTTGAAATCCCGCAGCTTTGG + Intronic
948528892 2:238590290-238590312 CCTCTGACACCCCGGGGGTTGGG - Intergenic
1168962695 20:1879909-1879931 CCTCTGAGTCCCTGGGGCTCAGG + Intergenic
1170167017 20:13370629-13370651 ATTCTGAGGCCCCGGGGCTTAGG - Intergenic
1179952013 21:44713472-44713494 CCTCTGAGACCACGCCCCTGAGG + Intergenic
1180085194 21:45505179-45505201 CCTCAGGGACCCCCCGGCATCGG + Exonic
1180126333 21:45792837-45792859 CCCCTCAAACCCCCCGGCTTTGG + Intronic
1183751172 22:39721565-39721587 CCTCTGAGACTCCGTGGCACAGG + Intergenic
1184328750 22:43812223-43812245 CCTCTGAGACCCCGCGGCTTGGG - Exonic
1185341063 22:50291340-50291362 CCTCTGAGACCTGGTGGATTTGG - Intronic
950577209 3:13839328-13839350 CCTCTGAGACCCCCAGCCTCAGG - Intronic
962023751 3:131526730-131526752 CCTCTGAGTCCCCTCGGCCTTGG + Intergenic
962821856 3:139055879-139055901 CATCTGAGACCCTGAGGCTCAGG + Intronic
964386351 3:156152137-156152159 CCTATGAGATCCCTCAGCTTTGG - Intronic
969268096 4:6079051-6079073 CCTTTGAGAGCCAGTGGCTTTGG - Intronic
970238542 4:13983632-13983654 CCTCTGAGAGCCAGAGGCTTAGG - Intergenic
995536477 5:113141543-113141565 CCTCTGAGCTCCTGAGGCTTAGG - Intronic
1007967443 6:46015689-46015711 TCTCTCAGACCCCGCTGCTCGGG - Intronic
1015624964 6:135171604-135171626 CCTCTAAGTCCCAGCTGCTTGGG + Intergenic
1017145196 6:151228407-151228429 CCTCTGAGAGCCTGCTGGTTGGG + Intergenic
1017703325 6:157096686-157096708 CCTCAGGGACCCCGCAGCTCAGG - Intronic
1020274164 7:6615083-6615105 CCTCCTAGACCCCGGGGCTGGGG - Intergenic
1022096135 7:27142767-27142789 CCTCTGGAACCCCACGCCTTGGG - Intronic
1022100553 7:27166694-27166716 CCTAAGAGACCCCGCAGCTCCGG + Intronic
1035353279 7:158261427-158261449 CCTGTGAGCCCCTGAGGCTTGGG - Intronic
1038336593 8:26650644-26650666 CCTATGAGACTCCTCGTCTTGGG - Intronic
1047951477 8:129939411-129939433 CCTCTGTGGCCCCGCGGCCCCGG - Intronic
1049755182 8:144308253-144308275 CCTCTGAGCCACCGCGGCCACGG + Intronic
1049805488 8:144536909-144536931 CCTTTGAGACCACTTGGCTTAGG - Intronic
1050952789 9:11618511-11618533 CCTCAGAGACCCCGCGCCAGCGG - Intergenic
1051079440 9:13278772-13278794 CCTCGGGGTCCCCGCGGCTAAGG + Intronic
1061234575 9:129334976-129334998 TCTCTGAGACCCTGGGGATTAGG - Intergenic
1061828244 9:133275009-133275031 CCTCCGAGACCCTGCGTCCTGGG - Intronic
1062060569 9:134493194-134493216 CCTTTGAGACCCCGGTGTTTGGG + Intergenic
1185893324 X:3838558-3838580 CCCCGGAGTCCCCGCGGCTGGGG - Intronic
1185898438 X:3876982-3877004 CCCCGGAGTCCCCGCGGCTGGGG - Intergenic
1185903553 X:3915411-3915433 CCCCGGAGTCCCCGCGGCTGGGG - Intergenic
1190274317 X:48890711-48890733 CCCCTGAGGCCCCGCAGCTAGGG + Intergenic
1190411000 X:50137038-50137060 TGTCTGAGACCCTGCGGCTCTGG + Intergenic
1195221277 X:102746639-102746661 CCTGTGGGACCCCGTGTCTTGGG + Intronic
1200079756 X:153570378-153570400 CCTCTAACACCCGGTGGCTTGGG - Intronic