ID: 1184328750

View in Genome Browser
Species Human (GRCh38)
Location 22:43812223-43812245
Sequence CCTCTGAGACCCCGCGGCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328750_1184328757 1 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328750_1184328760 25 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328750_1184328756 -9 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328750 Original CRISPR CCTCTGAGACCCCGCGGCTT GGG (reversed) Exonic