ID: 1184328755

View in Genome Browser
Species Human (GRCh38)
Location 22:43812229-43812251
Sequence GCAGCCCCTCTGAGACCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328755_1184328760 19 Left 1184328755 22:43812229-43812251 CCGCGGGGTCTCAGAGGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328755_1184328757 -5 Left 1184328755 22:43812229-43812251 CCGCGGGGTCTCAGAGGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328755 Original CRISPR GCAGCCCCTCTGAGACCCCG CGG (reversed) Exonic
900185003 1:1328770-1328792 GCCGTCCCTCTGCCACCCCGAGG - Exonic
900371159 1:2332833-2332855 GGGGCCCCTCTGAGACCCTGGGG - Intronic
900396779 1:2456332-2456354 GGAGCCCCTCCAAGACCCTGCGG - Intronic
901004641 1:6165889-6165911 TCACCCTCTTTGAGACCCCGGGG + Intronic
901499668 1:9644032-9644054 GCAGCCACTCTGAGCACCCAGGG - Intergenic
902282796 1:15386653-15386675 CCAGCCCAGCTGAGACCGCGTGG - Intronic
903383381 1:22911680-22911702 GATGCCCCTCTGAAACCCTGTGG - Intronic
903682273 1:25104945-25104967 GCAGCACCTATGAGACCCTCAGG + Intergenic
904011371 1:27392362-27392384 GCAGCCTCTCTGAGACTTCAAGG + Intergenic
904356693 1:29944913-29944935 GAAGACCCTCTGAGACTCTGGGG + Intergenic
905169302 1:36099791-36099813 GCAGCCCACCTTAGAGCCCGTGG + Intronic
905877582 1:41442833-41442855 TCAGCACCTCTGAGACTCTGGGG - Intergenic
907325923 1:53638584-53638606 GCAGGGCCTCTGAGGCCCCATGG + Intronic
910108144 1:83653577-83653599 GCTCCTCCTCTGAGCCCCCGAGG + Intergenic
910758310 1:90713131-90713153 CCAGCCCCTCTCAGTCCCCAGGG + Intronic
912815281 1:112823789-112823811 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
915300271 1:154947668-154947690 GCAGGTCCTCCCAGACCCCGAGG - Exonic
915912841 1:159924987-159925009 GCGTGCCCTCTGAGTCCCCGAGG - Intronic
918316597 1:183327896-183327918 CCAGCTCCTCTGAAACCCAGGGG - Intronic
919860648 1:201737604-201737626 GCAGCCCCCCAGAGACCATGTGG - Intronic
921363415 1:214351496-214351518 GCAGCACCTCTGAGATCACAGGG + Exonic
922048444 1:221968344-221968366 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
923032046 1:230256960-230256982 GAGGTCCCTCTGGGACCCCGAGG + Intronic
924577357 1:245292489-245292511 GCACCTGCTCTGAGATCCCGAGG - Intronic
1063106378 10:2996303-2996325 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
1063817295 10:9790188-9790210 TCAGCTCCTCTGACACCCCTGGG - Intergenic
1064093782 10:12407563-12407585 GAAGCCTCTCTGAGACCCTGAGG + Intronic
1064194348 10:13233398-13233420 GCAGTCCCTTTGATACCCTGGGG + Intronic
1067053695 10:43039454-43039476 GCAGCTCCTCTGGGACCTAGGGG - Intergenic
1072317053 10:94213411-94213433 GCAGCCACCCTGAGAACCCAGGG - Intronic
1072455874 10:95575346-95575368 GCTGCCCCTGAGAGACCCCTGGG + Intergenic
1073321575 10:102619310-102619332 GCAGCCCCTCAGCGAGCCTGAGG + Intronic
1075287592 10:121200811-121200833 GCAGAACCTCTGAGACCCTTGGG - Intergenic
1076255293 10:129018523-129018545 GCAGCCTCTCTTATACCCAGGGG - Intergenic
1076332683 10:129682061-129682083 ACAGCCACTCGGAGACCACGTGG + Intronic
1076456702 10:130604959-130604981 TCAACTCCTCTGAGACTCCGAGG - Intergenic
1076542098 10:131220827-131220849 GCAAACCCTCGGAGCCCCCGAGG - Intronic
1077011732 11:381799-381821 GCAGCCCCTCCCAGCCCCGGTGG + Exonic
1079847656 11:25490542-25490564 GCAGCCACTCCCAGAGCCCGTGG - Intergenic
1080174912 11:29351477-29351499 TCAGACCCTCAGAGTCCCCGGGG + Intergenic
1080588121 11:33699682-33699704 GCAGCCCCCCTGGGACTCTGTGG - Intronic
1080994425 11:37581943-37581965 GCAGCCACTCTGAGATGCCCTGG - Intergenic
1081641139 11:44755331-44755353 TCAGCCCCACTGAGACCCTGAGG + Intronic
1083301706 11:61742987-61743009 TTAGCCCCTCAGGGACCCCGCGG + Intronic
1084421678 11:69063602-69063624 GCCTCCCCTCTGAGAGCCCTGGG + Intronic
1084492993 11:69488465-69488487 GCTGCTCCTCTGAGCCCCCGAGG + Intergenic
1084515819 11:69637547-69637569 CCAGCCCCTCTCAGACCAAGTGG - Intergenic
1085208040 11:74748926-74748948 GCAGCCGCTCTGAGTCGGCGGGG + Exonic
1085620872 11:78037226-78037248 CCAGCCACTCTCAGACCTCGTGG + Intronic
1085988048 11:81808603-81808625 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
1087127848 11:94644005-94644027 GCAGCCACTCACAGAGCCCGTGG + Intergenic
1087396176 11:97602263-97602285 CCAGCACCTCTGAGAGCCCCAGG - Intergenic
1088036687 11:105325725-105325747 GCAGCCACTCTGTGACACGGAGG + Intergenic
1091320012 11:134642768-134642790 GCAGCACGTCGGAGACCCTGCGG + Intergenic
1091835062 12:3579919-3579941 ACAGCAGCTCTGAGACCCCAGGG - Intronic
1092041651 12:5390254-5390276 CCATCCCCTCTGAGACTCAGGGG - Intergenic
1092279946 12:7091315-7091337 ACGGCCTCTCTGAGAGCCCGGGG - Intronic
1092936259 12:13367008-13367030 GCAGGCCCTCTGAGGCTCCTGGG + Intergenic
1094400710 12:30058366-30058388 GCAGCCACTCCTAGACCCCCTGG + Intergenic
1095351941 12:41223849-41223871 GCAGCCCCTTTATGACCCTGTGG + Intronic
1096599700 12:52720892-52720914 GCAGCCCCTCTGAGGAGACGAGG + Intergenic
1097700028 12:62810356-62810378 GGAGCCCCTCTGAGATTCCCAGG - Intronic
1099286517 12:80718756-80718778 TCAGCTCCTCTGACACCCAGAGG - Intronic
1102059312 12:109920797-109920819 GAGGCACCTCTGAGACACCGTGG - Intronic
1102116709 12:110408589-110408611 GCAGCCACTCCCAGACCCCCTGG - Intergenic
1102539916 12:113611051-113611073 CCAGCGCCTCTGGTACCCCGGGG - Intergenic
1105028662 12:132867512-132867534 GCAGCCACTGTGAAACCTCGAGG + Intronic
1106586762 13:31064023-31064045 GCAGCCATTTTGAGACCCTGAGG - Intergenic
1110312827 13:74070782-74070804 GCAGACCTTCTGAGACTCTGGGG + Intronic
1113428636 13:110230560-110230582 GCACCTCCTCTAAGACCACGGGG + Intronic
1116573485 14:46546316-46546338 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
1116702373 14:48258706-48258728 GCAGCCACTCCCAGAGCCCGTGG - Intergenic
1117794533 14:59378349-59378371 GCAGCCCAGATGAGTCCCCGAGG - Intergenic
1120695283 14:87637940-87637962 ACAGCCCCTCTGAAACCCACAGG + Intergenic
1122231877 14:100310215-100310237 GCAGCTCCTCTGAGTCCCTGGGG + Intergenic
1122693782 14:103543254-103543276 GCATCCCCTCTGTGTCCCCAGGG - Intergenic
1124003597 15:25779428-25779450 GCATCCCCTCTCAGTTCCCGGGG - Intronic
1124344665 15:28914223-28914245 GCAGCCCCTGTGAGGGCCCCTGG - Intronic
1126530121 15:49702459-49702481 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
1127716176 15:61651391-61651413 GCAGCCTGTCTGAGGCACCGTGG - Intergenic
1128093218 15:64933114-64933136 GCACCTCCTCCGAGACCCTGTGG - Intronic
1128703754 15:69822889-69822911 GCAGCCCTTGTGAGAGCCCAAGG - Intergenic
1128762236 15:70225192-70225214 GCAGCCCCTCTCACACCCGAGGG + Intergenic
1129323116 15:74785773-74785795 GGAGCCCCTGTGAAACCCCCTGG + Intronic
1132231063 15:100184628-100184650 GCAGAACCTCTGAGATCCAGAGG + Intronic
1132553186 16:561513-561535 GCAGCCCCTCGGGGAGCCCCAGG + Intronic
1132574112 16:656891-656913 CCAGCCCCACGGAGACCCCACGG + Intronic
1132646594 16:1002078-1002100 GAAGCCCCTCGGAGGCCCAGGGG - Intergenic
1133025563 16:2987658-2987680 CCAGCCTCTCTGAGAGTCCGCGG - Intergenic
1136061097 16:27726978-27727000 CCAGCCCATCTGAGACCATGTGG + Intronic
1137592108 16:49700038-49700060 AAAGACCCTCTGAGACCCAGAGG + Intronic
1140951079 16:79818012-79818034 GCAGCCCATCTGAGGCCATGAGG + Intergenic
1141914099 16:87082188-87082210 GCCCCACCTCTGAGACCCAGGGG - Intergenic
1142143334 16:88482322-88482344 GCAGCTGCTCTCAGACACCGAGG + Intronic
1142213879 16:88821561-88821583 GCAGCCCCTCAGGGATCCCTTGG - Intronic
1144172517 17:12672038-12672060 GGAGCCCATCTGGGACTCCGTGG + Intronic
1144673365 17:17145547-17145569 GCAGCCCCGCTGAGACCCTCAGG - Intronic
1144776220 17:17786088-17786110 GCAGCCCCTCTCAGCACCAGCGG - Intronic
1146252921 17:31365667-31365689 GCAGCCCCTCTGCTCCCCTGGGG - Intronic
1146626297 17:34438032-34438054 GCAGCCTCTCTGAGGCCCAAAGG + Intergenic
1147816329 17:43213319-43213341 GCAGCCCCTCTGAGTCTCCTTGG + Intronic
1148353494 17:46958144-46958166 CCAGCTCCTCTGAGGCCCCCTGG - Intronic
1148460762 17:47837930-47837952 GCAGCCCCTGTGTGGCCTCGAGG + Exonic
1148791398 17:50175284-50175306 GCAGCTCCTCTGTGTTCCCGTGG - Exonic
1150108156 17:62477765-62477787 GCACCCCCTCTGATCCCCCAAGG - Intronic
1151288930 17:73134528-73134550 GCAGCCCCTCTTGGACCACAAGG + Intergenic
1151829109 17:76539107-76539129 CCAGCCCCTCCAAGACCCCCAGG - Intronic
1151956676 17:77383573-77383595 GCAGCCCCCGTCAGACCCCAGGG - Intronic
1152628751 17:81400129-81400151 GCTGCCCCTCCGAGACCCCCGGG - Intronic
1154345894 18:13543238-13543260 CCAGCCCCTTTTAGATCCCGTGG - Intronic
1155428339 18:25729030-25729052 GCAGCCATTTTGAGACCCTGGGG - Intergenic
1156938566 18:42739042-42739064 GCAGCCACTCCCAGAGCCCGTGG + Intergenic
1157201555 18:45664081-45664103 TCAGCCTCTCCGAGACCCAGGGG - Intronic
1157612247 18:48964386-48964408 ACAGCCCATCTGGGACCCCAGGG - Intergenic
1161371585 19:3914974-3914996 GGAGCCCCTCAGGGACCCCCCGG + Intronic
1164630400 19:29758085-29758107 ACAGCCCCTCTGCCACCCCTGGG - Intergenic
1164722084 19:30439742-30439764 TCAGCTCCTCTGAAACCCTGGGG + Intronic
1165108613 19:33488519-33488541 GTAGCCCCTCTGAGGGCCTGGGG + Intronic
1165249270 19:34516380-34516402 GCAGCCACTCTCAGAGCCCCTGG + Intergenic
1165824324 19:38697180-38697202 GCAGCCCCTCTGAGGACAGGTGG + Intronic
1167769871 19:51508486-51508508 GCAGCCCCCAGGAGACCCAGAGG + Intergenic
1167904800 19:52650193-52650215 CCAGTCCCACTGAGAGCCCGTGG + Intronic
925170033 2:1744595-1744617 CCGGCCCCTCTGAATCCCCGAGG + Intronic
925235290 2:2272380-2272402 GCAGCACCTCTGAGAGCACCAGG - Intronic
926302215 2:11612631-11612653 CCAGCTCCTCAGAGACCCCCAGG - Intronic
927715460 2:25349193-25349215 GAAGCCACACTGAGACCCCATGG - Intergenic
927866016 2:26588183-26588205 GCAGCCTCTCAGAGACCCTGCGG + Intronic
931398077 2:61905759-61905781 GCAGCTCCTCTGTGATGCCGGGG - Exonic
932298053 2:70643121-70643143 GCAGCCCCTCAGAGTGCCTGTGG + Intronic
932408358 2:71529085-71529107 GCTGCCCCTCTGAGCCCTGGAGG + Intronic
933666631 2:84970565-84970587 CCAGCCCCACTGAGAGGCCGCGG - Intergenic
934750918 2:96793569-96793591 GCCTCCTCTCTGAGACCCCTTGG - Intronic
936008793 2:108911610-108911632 GCAGTCCCTCAGTCACCCCGGGG + Intronic
941935862 2:170980958-170980980 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
943061600 2:183046277-183046299 GCAGCCACTCCCAGACCCCCTGG + Intergenic
946282007 2:218672401-218672423 GCACCCGCTCTCAGACCCCCTGG - Exonic
1169277521 20:4243739-4243761 CCAGCTCCTCTGGGACCCCCAGG - Intronic
1172193511 20:33076683-33076705 GCAGCCCCAGTGTGACCCCCTGG + Intergenic
1173029221 20:39339176-39339198 GCAGCCTCTCTAAGACCCAAGGG + Intergenic
1173253352 20:41376034-41376056 ACAGCCCCTCTGCTGCCCCGAGG + Intergenic
1173579205 20:44135029-44135051 GCAGCCTCCCTGAGCCCCCCAGG - Intronic
1173667144 20:44771185-44771207 GCAACCCCTCTGGGAGCCCTAGG - Intronic
1173729116 20:45316596-45316618 GCAGCCTCTCTTGGGCCCCGGGG + Intronic
1175111996 20:56654966-56654988 ACAGCCCCTCAGAGACCCTCCGG + Intergenic
1175253041 20:57621201-57621223 GTAGCACCTGTGAGTCCCCGAGG - Intergenic
1176084839 20:63291155-63291177 GCAGCACCCCTCAGACCACGTGG - Intergenic
1176222298 20:63975411-63975433 GCAGCGCCTCTTGGACCCTGCGG - Exonic
1176413411 21:6461160-6461182 GCAGCTCCGATGACACCCCGTGG + Intergenic
1179688908 21:43069483-43069505 GCAGCTCCGATGACACCCCGTGG + Intronic
1180791795 22:18578653-18578675 GCAGCCCCTCGCAGGCCCCAGGG + Intergenic
1181064115 22:20297662-20297684 GCAGGCCCTCTCTGACCCCCAGG - Intergenic
1181229941 22:21416656-21416678 GCAGCCCCTCGCAGGCCCCAGGG - Intergenic
1181248708 22:21518210-21518232 GCAGCCCCTCGCAGGCCCCAGGG + Intergenic
1181396653 22:22627851-22627873 GCTGCCCCTCTGAGCCCGCCTGG - Intergenic
1182417284 22:30229421-30229443 GCAGCCCCTCCGAGGACCAGAGG + Intergenic
1183684196 22:39351963-39351985 TCAGCCCCTCTGAGCACCCATGG + Intronic
1184328755 22:43812229-43812251 GCAGCCCCTCTGAGACCCCGCGG - Exonic
1184856862 22:47151023-47151045 ACATCCTCTCTGAGACCCCATGG - Intronic
1184993479 22:48185883-48185905 GCAGCCTCTCAGAGATCCAGAGG + Intergenic
1185368106 22:50446194-50446216 GGGGGCCCTCTGAGACCCCAGGG + Exonic
950421300 3:12901270-12901292 GCAGCCCCTCTGGGGGCCCCAGG + Intronic
950467166 3:13162367-13162389 GCAGCCCCTCCGAGTCCATGTGG + Intergenic
952990040 3:38823918-38823940 GCAGCCCCTGTGGGCCCCTGAGG + Intergenic
955003843 3:54951571-54951593 GCAGCCCCACTGAGAACCACAGG + Intronic
955230846 3:57097723-57097745 GCAGCCCCTCGGACATGCCGCGG - Exonic
961349942 3:126293443-126293465 ACAGCTCCTCCCAGACCCCGAGG - Intergenic
961711595 3:128832511-128832533 GCAGCCCCTCCCAGAGCCCCTGG - Intergenic
961840005 3:129701773-129701795 GCAGCACCTTTGAGTCCCCTGGG - Intronic
964438156 3:156675160-156675182 GGAGCCCTTCCCAGACCCCGGGG + Exonic
964544249 3:157816016-157816038 CCAGCCTCTCTGAGAGCCCAGGG - Intergenic
965861938 3:173159228-173159250 GCAGCCACTCTCAGAGCCCATGG - Intergenic
966928237 3:184659368-184659390 CCAGCCCCTCTGTGACTCCCAGG + Intronic
968181118 3:196596144-196596166 GGAGTCTATCTGAGACCCCGAGG - Intergenic
969867736 4:10086531-10086553 GCAGCCCCTCCTAGAAGCCGTGG + Intronic
970029203 4:11657053-11657075 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
975373681 4:73617407-73617429 GCAGCGCCTCCCAGACCCAGTGG - Intronic
975860125 4:78668469-78668491 GCAGCCCCTCTGAAACCATGTGG - Intergenic
981033701 4:140151089-140151111 GCGGCCCAGCTCAGACCCCGGGG - Intronic
983638878 4:169925727-169925749 GAAGCCCCTCAGTGACCCCAAGG - Intergenic
985097267 4:186425665-186425687 TAAGCTCCTCTGAGACCCAGAGG + Intergenic
986642681 5:9888018-9888040 GCAGCCCCGCTGAGAGCACCAGG + Intergenic
987323542 5:16792513-16792535 GAGGCCCCTCTGAAACCCTGGGG - Intronic
991618193 5:68518318-68518340 GCAGCCCCTCTTTGACCTCTTGG + Intergenic
995610291 5:113902402-113902424 GAAGCCCCTCTGAGACCATAGGG + Intergenic
996978472 5:129461395-129461417 GCAGCCCCGCTGGATCCCCGCGG - Exonic
997587886 5:135054582-135054604 GCAGCACGTCTGAGTCCCTGGGG + Intronic
999196143 5:149782881-149782903 GCAGCCCCTCAGAGGCCCACTGG - Intronic
1000756524 5:165167866-165167888 CCAGCCCCACTGAGACCCTGTGG + Intergenic
1001175887 5:169468609-169468631 GCAGCCCCTCTGTGGTCCCTAGG - Intergenic
1001517518 5:172366252-172366274 GAAGCCCCTCTCAGACCCTGGGG - Intronic
1001678300 5:173536639-173536661 TCAGCTCCACTGAGACCCCCGGG - Intergenic
1002900491 6:1406392-1406414 CCAGCTGCTCTGAGAGCCCGCGG + Intergenic
1003349001 6:5298135-5298157 GCAGCCCCACTGTGACTCTGAGG - Intronic
1003551676 6:7107201-7107223 GCCGCCCCTCTGGGTCTCCGAGG - Intergenic
1006176796 6:32127464-32127486 TCAGCCCCTCTGAGCCCCCATGG - Exonic
1006430066 6:33990057-33990079 GCAGCCCCTCTGATGGCCCCTGG + Intergenic
1007777966 6:44234289-44234311 GCAGCCCCTCTGAGGCCAAGAGG - Intergenic
1007784210 6:44270805-44270827 TGAGCTCCTCCGAGACCCCGGGG - Exonic
1009916877 6:70006404-70006426 GCAGCCCACCTGAGAGCCAGGGG - Intronic
1010244831 6:73653586-73653608 GAAGCCCCTCGGGAACCCCGGGG - Intronic
1013808054 6:114015636-114015658 GCAGCCCCTCTCAGAGCCCCTGG - Intergenic
1015545047 6:134353282-134353304 TCAGCCCCTCAGAGACTCCGTGG + Intergenic
1016714213 6:147204516-147204538 GGAGCCCCTCCGAGACCATGAGG + Exonic
1017007811 6:150040706-150040728 GCAGCCCCACAGAGACCAGGAGG - Intergenic
1017172027 6:151465842-151465864 GAAGCCCTGGTGAGACCCCGAGG + Intronic
1018578103 6:165280777-165280799 GCAGCCATATTGAGACCCCGAGG + Intronic
1018901007 6:168051726-168051748 GCAGCCTCTCTGGGAGCCCAGGG + Intergenic
1019292385 7:257145-257167 GCAGCCCACCTGAGACCCTGGGG + Intronic
1020105288 7:5419890-5419912 GCAGCTCCTGAGAGACCCCAAGG + Intronic
1020212453 7:6166749-6166771 GCAGTCCCTCTGGGACCCTCTGG + Intronic
1023879712 7:44311615-44311637 ACAGCCCCTCTGGGTACCCGGGG - Intronic
1025015112 7:55433144-55433166 GCAGCCCCTCTCAGACGAGGAGG + Exonic
1025261696 7:57424697-57424719 GCAGGCCCTCCAGGACCCCGCGG - Intergenic
1025724667 7:64045722-64045744 GCAGCAGCTCCGAGTCCCCGTGG + Intronic
1026482038 7:70787576-70787598 GCAGCCCCTCGCAGTCCCCATGG + Intronic
1033084746 7:138331411-138331433 GCAGCCACTCTCAGAGCCCCTGG + Intergenic
1033431573 7:141294329-141294351 GCAGCCCTTCTGAGACAGCCAGG + Intronic
1033920478 7:146385707-146385729 GCAGCTTCTCTGAAACCCCAAGG - Intronic
1034131802 7:148725453-148725475 GCAGCCCATGTGAGACCCTCTGG + Intronic
1035125827 7:156607387-156607409 CCAGCGCCTCTGAGGCCTCGCGG + Intergenic
1035227302 7:157440809-157440831 GGAGCCCCCCTCAGACCCTGCGG - Intergenic
1037581395 8:20247784-20247806 GCTGGCCCTTAGAGACCCCGAGG - Exonic
1037985612 8:23288890-23288912 GCAGTCCATCTGGGACCCAGAGG + Intronic
1038391991 8:27210444-27210466 GCAGCCACTTTGTGACCACGAGG + Intergenic
1039592043 8:38757340-38757362 GCTCCCACTCTCAGACCCCGAGG + Intronic
1039983543 8:42428884-42428906 TCAGCCTCCCTGACACCCCGTGG + Intronic
1044625835 8:94234583-94234605 GCAGCATCTCTGAGTCACCGCGG - Intergenic
1045426640 8:102073639-102073661 GCAGCCCATGTGATACCCTGTGG - Intronic
1047856402 8:128916805-128916827 GCAGCCACTCTCAGAGCCCCTGG + Intergenic
1049437143 8:142591943-142591965 GCAGCCCCCCAGAGTCCCCAGGG + Intergenic
1049850258 8:144826938-144826960 GCAGAGCCTCCGGGACCCCGAGG - Intergenic
1050416047 9:5418757-5418779 GCAGCTCCTCGACGACCCCGAGG - Intronic
1051583889 9:18706672-18706694 GCAGCCCCTCACAGCCCCCATGG + Intronic
1052404328 9:28039918-28039940 TCAGCCCATCTAAGACCCCATGG - Intronic
1053072035 9:35107475-35107497 CCAGCCCCTCGGAGGCGCCGGGG - Exonic
1057172782 9:92973800-92973822 GGAGCCCCTCTGAGATCTCTGGG + Intronic
1060113842 9:120925935-120925957 GCTGTCTCTCTGAGAACCCGAGG - Exonic
1061038071 9:128124465-128124487 GGAGCCCCTCGGAGACCAGGTGG - Intronic
1061806812 9:133141438-133141460 GCAGCCCCTATGGGAGCCCAAGG + Intronic
1062345228 9:136111335-136111357 GCCGCCACCCTGAGTCCCCGGGG + Intergenic
1203772243 EBV:55441-55463 GCAGGGCCTCTGAGACCATGGGG + Intergenic
1186813912 X:13216930-13216952 GCTGCTCCCCTGAGAACCCGCGG + Intergenic
1192033884 X:67544022-67544044 GCGCCCCCTCCGAGATCCCGGGG + Intronic
1194500629 X:94676855-94676877 GCAGCCCCTCTAAGGCCCAAAGG - Intergenic
1195908649 X:109868537-109868559 GCAGCCACTCTCAGAGCCCCTGG - Intergenic
1200180064 X:154144608-154144630 CCAGCCCCTTTGAGAATCCGAGG + Intronic
1200185892 X:154183002-154183024 CCAGCCCCTTTGAGAATCCGAGG + Intergenic
1200191544 X:154220140-154220162 CCAGCCCCTTTGAGAATCCGAGG + Intronic
1200197299 X:154257944-154257966 CCAGCCCCTTTGAGAATCCGAGG + Intronic