ID: 1184328755

View in Genome Browser
Species Human (GRCh38)
Location 22:43812229-43812251
Sequence GCAGCCCCTCTGAGACCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328755_1184328757 -5 Left 1184328755 22:43812229-43812251 CCGCGGGGTCTCAGAGGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328755_1184328760 19 Left 1184328755 22:43812229-43812251 CCGCGGGGTCTCAGAGGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328755 Original CRISPR GCAGCCCCTCTGAGACCCCG CGG (reversed) Exonic