ID: 1184328756

View in Genome Browser
Species Human (GRCh38)
Location 22:43812237-43812259
Sequence TCTCAGAGGGGCTGCCCATT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328752_1184328756 -10 Left 1184328752 22:43812224-43812246 CCAAGCCGCGGGGTCTCAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328750_1184328756 -9 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328745_1184328756 5 Left 1184328745 22:43812209-43812231 CCGCGTGCGCGGACCCCAAGCCG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328740_1184328756 25 Left 1184328740 22:43812189-43812211 CCGCCTAGCTGGGCCGGCACCCG 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328749_1184328756 -8 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328741_1184328756 22 Left 1184328741 22:43812192-43812214 CCTAGCTGGGCCGGCACCCGCGT 0: 1
1: 0
2: 0
3: 4
4: 126
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328743_1184328756 12 Left 1184328743 22:43812202-43812224 CCGGCACCCGCGTGCGCGGACCC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136
1184328744_1184328756 6 Left 1184328744 22:43812208-43812230 CCCGCGTGCGCGGACCCCAAGCC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1184328756 22:43812237-43812259 TCTCAGAGGGGCTGCCCATTCGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328756 Original CRISPR TCTCAGAGGGGCTGCCCATT CGG Exonic