ID: 1184328757

View in Genome Browser
Species Human (GRCh38)
Location 22:43812247-43812269
Sequence GCTGCCCATTCGGCGTCTCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328755_1184328757 -5 Left 1184328755 22:43812229-43812251 CCGCGGGGTCTCAGAGGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328752_1184328757 0 Left 1184328752 22:43812224-43812246 CCAAGCCGCGGGGTCTCAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328743_1184328757 22 Left 1184328743 22:43812202-43812224 CCGGCACCCGCGTGCGCGGACCC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328750_1184328757 1 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328745_1184328757 15 Left 1184328745 22:43812209-43812231 CCGCGTGCGCGGACCCCAAGCCG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328744_1184328757 16 Left 1184328744 22:43812208-43812230 CCCGCGTGCGCGGACCCCAAGCC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59
1184328749_1184328757 2 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328757 22:43812247-43812269 GCTGCCCATTCGGCGTCTCTAGG 0: 1
1: 0
2: 1
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328757 Original CRISPR GCTGCCCATTCGGCGTCTCT AGG Exonic