ID: 1184328758

View in Genome Browser
Species Human (GRCh38)
Location 22:43812251-43812273
Sequence GCGTCCTAGAGACGCCGAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328758_1184328763 11 Left 1184328758 22:43812251-43812273 CCCATTCGGCGTCTCTAGGACGC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1184328763 22:43812285-43812307 AGACGACGGCAGTCGCTGACTGG 0: 1
1: 0
2: 0
3: 0
4: 21
1184328758_1184328760 -3 Left 1184328758 22:43812251-43812273 CCCATTCGGCGTCTCTAGGACGC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328758 Original CRISPR GCGTCCTAGAGACGCCGAAT GGG (reversed) Exonic