ID: 1184328759

View in Genome Browser
Species Human (GRCh38)
Location 22:43812252-43812274
Sequence AGCGTCCTAGAGACGCCGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328759_1184328760 -4 Left 1184328759 22:43812252-43812274 CCATTCGGCGTCTCTAGGACGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328759_1184328763 10 Left 1184328759 22:43812252-43812274 CCATTCGGCGTCTCTAGGACGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1184328763 22:43812285-43812307 AGACGACGGCAGTCGCTGACTGG 0: 1
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328759 Original CRISPR AGCGTCCTAGAGACGCCGAA TGG (reversed) Exonic
906836010 1:49084097-49084119 AACTTCCTAGAGACTCTGAATGG - Intronic
915629240 1:157138676-157138698 AGGGTCCTCCAGACGCCGAGGGG + Intergenic
1077832567 11:5890499-5890521 ATGGACCTAGAGAGGCCGAAAGG + Intronic
1083201190 11:61122009-61122031 AGAGTCCCAGAGACCCAGAAAGG + Intronic
1086089358 11:82989861-82989883 AATGTCCTATAGATGCCGAAAGG - Intronic
1111222204 13:85219930-85219952 AACTTCCTAGAGACGTTGAATGG + Intergenic
1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG + Intergenic
1140196440 16:72859395-72859417 ATCGTCCCAGAGAGGCCGCAAGG + Intronic
1144714042 17:17422021-17422043 AGGGTCCTGGAGAGGCCCAATGG - Intergenic
1148890397 17:50802942-50802964 AGCCTCCTAGAGAAGGAGAAAGG - Intergenic
1149984081 17:61334039-61334061 AGAGCCCTAGAGACTCAGAAAGG + Intronic
1152915577 17:83033029-83033051 AGCGGCCTGGAGACGCTGAGCGG + Intronic
1167121701 19:47521154-47521176 AACGCCCTGGAGAGGCCGAAGGG + Exonic
1173742669 20:45412425-45412447 AGCTTCCTAGAGACAGGGAATGG - Intergenic
1184328759 22:43812252-43812274 AGCGTCCTAGAGACGCCGAATGG - Exonic
982643483 4:157992313-157992335 AGCGTTCTAGAGATACCAAAGGG + Intergenic
986652638 5:9979638-9979660 GGCTTCCTAGAGAAGCCTAATGG + Intergenic
1185835945 X:3346158-3346180 AGCTTCCTAGAAACGCGGGATGG + Intronic
1201240722 Y:11954653-11954675 AGCTTCCTAGAAACGCCGGATGG - Intergenic