ID: 1184328759 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:43812252-43812274 |
Sequence | AGCGTCCTAGAGACGCCGAA TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 19 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 17} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1184328759_1184328763 | 10 | Left | 1184328759 | 22:43812252-43812274 | CCATTCGGCGTCTCTAGGACGCT | 0: 1 1: 0 2: 0 3: 1 4: 17 |
||
Right | 1184328763 | 22:43812285-43812307 | AGACGACGGCAGTCGCTGACTGG | 0: 1 1: 0 2: 0 3: 0 4: 21 |
||||
1184328759_1184328760 | -4 | Left | 1184328759 | 22:43812252-43812274 | CCATTCGGCGTCTCTAGGACGCT | 0: 1 1: 0 2: 0 3: 1 4: 17 |
||
Right | 1184328760 | 22:43812271-43812293 | CGCTGTTGCCCGAGAGACGACGG | 0: 1 1: 0 2: 0 3: 0 4: 33 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1184328759 | Original CRISPR | AGCGTCCTAGAGACGCCGAA TGG (reversed) | Exonic | ||