ID: 1184328760

View in Genome Browser
Species Human (GRCh38)
Location 22:43812271-43812293
Sequence CGCTGTTGCCCGAGAGACGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328755_1184328760 19 Left 1184328755 22:43812229-43812251 CCGCGGGGTCTCAGAGGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328750_1184328760 25 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328758_1184328760 -3 Left 1184328758 22:43812251-43812273 CCCATTCGGCGTCTCTAGGACGC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328752_1184328760 24 Left 1184328752 22:43812224-43812246 CCAAGCCGCGGGGTCTCAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328759_1184328760 -4 Left 1184328759 22:43812252-43812274 CCATTCGGCGTCTCTAGGACGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328749_1184328760 26 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328760 Original CRISPR CGCTGTTGCCCGAGAGACGA CGG Exonic