ID: 1184328760

View in Genome Browser
Species Human (GRCh38)
Location 22:43812271-43812293
Sequence CGCTGTTGCCCGAGAGACGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184328752_1184328760 24 Left 1184328752 22:43812224-43812246 CCAAGCCGCGGGGTCTCAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328759_1184328760 -4 Left 1184328759 22:43812252-43812274 CCATTCGGCGTCTCTAGGACGCT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328749_1184328760 26 Left 1184328749 22:43812222-43812244 CCCCAAGCCGCGGGGTCTCAGAG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328758_1184328760 -3 Left 1184328758 22:43812251-43812273 CCCATTCGGCGTCTCTAGGACGC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328755_1184328760 19 Left 1184328755 22:43812229-43812251 CCGCGGGGTCTCAGAGGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 231
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33
1184328750_1184328760 25 Left 1184328750 22:43812223-43812245 CCCAAGCCGCGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184328760 Original CRISPR CGCTGTTGCCCGAGAGACGA CGG Exonic
902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG + Exonic
904514982 1:31047562-31047584 TGCTGTTGCCTGAGAGAAAATGG + Intronic
906251241 1:44312459-44312481 CGCTGTAGCCCGAGGGAATAAGG - Intronic
919093585 1:193002498-193002520 CGCTTGTGCCCGAGAGGCGGAGG - Intergenic
1063055725 10:2502103-2502125 CTCAGTTGCCCAAGTGACGAAGG - Intergenic
1073240414 10:102054303-102054325 CGCTGGAACCCGAGAGACGGAGG + Intronic
1078014567 11:7602007-7602029 CGCTGGAACCCGAGAGACGGAGG + Intronic
1080763119 11:35271757-35271779 CGCTTGGGCCTGAGAGACGAAGG + Intronic
1089650342 11:119908752-119908774 CTCTGTTTGCCGAGAGAGGATGG + Intergenic
1096620251 12:52860094-52860116 TGCTGGTGCCTGAGAGAGGAAGG + Intergenic
1104910611 12:132238486-132238508 TGCTGGTGCCAGAGAGACCACGG + Intronic
1110341554 13:74397690-74397712 CGCTTTTGCCCAAGAGACTGAGG - Intergenic
1112356510 13:98678408-98678430 CGCTTGAACCCGAGAGACGAAGG - Intergenic
1112368435 13:98774585-98774607 CGCTTGAGCCCGAGAGGCGAAGG + Intergenic
1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG + Intergenic
1122783360 14:104153093-104153115 CAATGTTGCCCCAGAGACTACGG - Intronic
1133843062 16:9428049-9428071 CGCTGTTGGCCTTGAGATGAAGG + Intergenic
1135435708 16:22425473-22425495 CGCTGTTCCCAGAGTGAGGATGG - Intronic
1141272856 16:82556692-82556714 TGCTGCTGCCCTAGAGACGTGGG - Intergenic
1146664080 17:34685288-34685310 CCCTGTTGCCACAGAGACCAGGG + Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147307924 17:39576433-39576455 CGCTGTTTCCCAGGAGACGCCGG - Intergenic
1154168250 18:12032029-12032051 CGCTGTTGCTGGAAAGACAAGGG - Intergenic
1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG + Exonic
1160562370 18:79766695-79766717 CCCTCTTGACCTAGAGACGAAGG - Intergenic
938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG + Exonic
1172156770 20:32831614-32831636 CGCTTTAACCCGAGAGGCGATGG - Intronic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
988512475 5:31877297-31877319 CGCTTGAGCCCGAGAGACCAAGG - Intronic
1017373219 6:153736989-153737011 CGCTATTGCAAGAGAGAAGACGG + Intergenic
1060571385 9:124643514-124643536 TGCTGGAGCCCAAGAGACGAAGG + Intronic
1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG + Intergenic
1196068182 X:111488980-111489002 AGCTGTTGCAAGAGAGACTATGG + Intergenic
1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG + Intronic