ID: 1184331751

View in Genome Browser
Species Human (GRCh38)
Location 22:43832150-43832172
Sequence GATGAAGGTGTAGCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184331751_1184331758 9 Left 1184331751 22:43832150-43832172 CCTGCTTGGGCTACACCTTCATC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1184331758 22:43832182-43832204 CCGTCCTCTGGGCGTGAGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 75
1184331751_1184331753 -3 Left 1184331751 22:43832150-43832172 CCTGCTTGGGCTACACCTTCATC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1184331753 22:43832170-43832192 ATCTCTACCACACCGTCCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 74
1184331751_1184331756 8 Left 1184331751 22:43832150-43832172 CCTGCTTGGGCTACACCTTCATC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1184331756 22:43832181-43832203 ACCGTCCTCTGGGCGTGAGCAGG No data
1184331751_1184331760 22 Left 1184331751 22:43832150-43832172 CCTGCTTGGGCTACACCTTCATC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1184331760 22:43832195-43832217 GTGAGCAGGGACCCTAAATGTGG 0: 1
1: 0
2: 0
3: 19
4: 105
1184331751_1184331754 -2 Left 1184331751 22:43832150-43832172 CCTGCTTGGGCTACACCTTCATC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1184331754 22:43832171-43832193 TCTCTACCACACCGTCCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184331751 Original CRISPR GATGAAGGTGTAGCCCAAGC AGG (reversed) Intronic
900653442 1:3742731-3742753 GTTGAAGATGTAGCACAGGCTGG - Intergenic
901462667 1:9400886-9400908 GAGGAGGGTGCAGGCCAAGCCGG + Intergenic
901632345 1:10654017-10654039 GGTGAAGGTGAAGCCGCAGCCGG + Exonic
901714016 1:11138668-11138690 GAGGAAGGGGAAGCCAAAGCAGG + Intronic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
903708812 1:25306633-25306655 GCTGAAGTTGTAGCCCATGATGG - Exonic
903743690 1:25573057-25573079 GATAAAGGTGCAGTCCAAACAGG + Intergenic
904860346 1:33533147-33533169 GATGAGCGTGTAGCCCATGGAGG + Exonic
905037643 1:34928496-34928518 GGTGAAGGTAGAGACCAAGCTGG + Intronic
905813056 1:40927070-40927092 GATGAAGTGGTGGGCCAAGCTGG - Intergenic
910423618 1:87097844-87097866 GATGAATGTGTAGCAGAAGGTGG + Exonic
912795060 1:112688374-112688396 GGTGCAGGTGGAACCCAAGCAGG - Intronic
914949957 1:152104567-152104589 GATCAAGGTGTTGCCTGAGCTGG + Intergenic
915765422 1:158357056-158357078 GATGGATATGTAGCCAAAGCAGG - Intronic
1063315967 10:5006571-5006593 GATGGAGTTTAAGCCCAAGCTGG - Intronic
1063578879 10:7287502-7287524 GATGCAGGTGTAGCCCAGTGGGG - Intronic
1067123743 10:43497602-43497624 GTTGAAGGTGTTCCCCAAACAGG + Intergenic
1071092388 10:81933712-81933734 GATGAAAGTGTATGCCCAGCAGG + Intronic
1071272330 10:84019746-84019768 GATGTGGGTGCAGCCCAAGGAGG + Intergenic
1072264223 10:93712281-93712303 GATGAAGGTGTCACCCAGACTGG + Intergenic
1074121978 10:110499443-110499465 GATGAGGGTTTAGCCCCAGCAGG + Intronic
1074458256 10:113614017-113614039 GAGGAAGGTGTAGCCCAGAGGGG + Intronic
1075413942 10:122248947-122248969 GATGCAGGTGTAACCCCAGGCGG - Intronic
1076012897 10:127004719-127004741 GATGACTCTGTAGCCCAGGCTGG - Intronic
1076646887 10:131959924-131959946 GCAGAAGGTGCAGCCCAGGCGGG + Intergenic
1076726055 10:132413848-132413870 GGAGAAGGTGTGGCCCAGGCAGG + Intronic
1076915908 10:133423144-133423166 GAGGAAGGGGGAGCCCAGGCCGG + Exonic
1076936050 10:133568011-133568033 GAGGAAGGGGGAGCCCAGGCCGG + Intronic
1079339732 11:19602047-19602069 GATGAACACTTAGCCCAAGCTGG - Intronic
1084335588 11:68455742-68455764 TCTGAAGGTGTGGCCCAACCAGG - Intergenic
1085083901 11:73654259-73654281 GATGGGGGTGGAGGCCAAGCTGG - Intronic
1085378514 11:76090336-76090358 CATGAAGGGGAAGCACAAGCAGG - Intronic
1085545946 11:77318575-77318597 GATGATGGTATAGCCCATCCAGG - Intergenic
1098983362 12:76984340-76984362 GATGGAGCTGAAGCCCAAGCAGG - Intergenic
1101153858 12:101908963-101908985 GATAAAAGTGTAGATCAAGCTGG + Intronic
1108131186 13:47302149-47302171 GATGGAGTTGTTGCCCAGGCTGG - Intergenic
1113092768 13:106632454-106632476 GATCAAGGTGTCGGCAAAGCTGG - Intergenic
1113946681 13:114048448-114048470 GAGGAAGGTGGAGGCCTAGCGGG + Intronic
1125725424 15:41866022-41866044 GGAGAAGGTGTAGCCCCAGCTGG - Exonic
1127185355 15:56473793-56473815 GATGGAGTTGTTGCCCAGGCTGG + Intergenic
1127432771 15:58927297-58927319 GATGATCTTGTTGCCCAAGCTGG + Intronic
1128951890 15:71893505-71893527 TATGAAGGTGTACTCCAGGCAGG - Intronic
1133101491 16:3482743-3482765 GATGAAGGTCTGGCCCAAGACGG - Intronic
1136632529 16:31497238-31497260 GGGGAGGGTATAGCCCAAGCAGG - Intronic
1137771826 16:51022240-51022262 GATGAAACAGCAGCCCAAGCTGG - Intergenic
1138168387 16:54824875-54824897 GATGAATCTGTGACCCAAGCTGG + Intergenic
1138468830 16:57215106-57215128 GATGAAGGTGGACCCTCAGCTGG + Intronic
1138651116 16:58462475-58462497 GACAAAGCTGTAACCCAAGCGGG + Intergenic
1139199345 16:64956851-64956873 GATGATGATGTAGCCCAATGAGG + Intronic
1143975361 17:10825406-10825428 CTTCAAGGTGTAGGCCAAGCAGG + Exonic
1144951099 17:18993903-18993925 CATGCAGGTGAAGCCCTAGCAGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148459005 17:47827039-47827061 GATGAAGGTCTTCCCCAACCAGG - Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150988008 17:70221135-70221157 GATGAAGATATAGTCCATGCAGG - Intergenic
1156204380 18:34870359-34870381 CAGGAAGGTGAGGCCCAAGCAGG - Intronic
1156232603 18:35169097-35169119 GATGGAGTTGTTGCCCAGGCTGG + Intergenic
1157219859 18:45820643-45820665 GATGAAGATGAACCCCCAGCTGG - Intergenic
1160331098 18:77992296-77992318 GATGGAGGTGTAGGCACAGCGGG + Intergenic
1161504511 19:4636572-4636594 GATTGAGGTTTAGCCCAAGGCGG - Intergenic
1161655349 19:5511003-5511025 GGTGGAGGTGGAGCCCAGGCTGG + Intergenic
1165391596 19:35542263-35542285 TATGAAGGTGGGGCTCAAGCAGG + Intronic
1167790581 19:51676601-51676623 GATGAGGGTGGAGCCAAAGAAGG + Intergenic
925900561 2:8506321-8506343 GAGGAAGGTGAAGCGGAAGCAGG - Intergenic
926614896 2:14986439-14986461 GTTGAAGGTGTACCGTAAGCTGG - Intergenic
926707100 2:15844626-15844648 GATGAGGGAGTGGCCGAAGCTGG - Intergenic
926817181 2:16810595-16810617 GATGATTTTGTAGCCCAAGATGG + Intergenic
927476181 2:23416072-23416094 CATGAAGGTGTAACTCCAGCAGG - Intronic
928457530 2:31436453-31436475 GATGAATGTATACCTCAAGCAGG - Intergenic
930596111 2:53390137-53390159 AATGAAAGTGAAGGCCAAGCAGG + Intergenic
931147020 2:59530140-59530162 GAGGAAGCTGGGGCCCAAGCTGG - Intergenic
932793577 2:74675875-74675897 GATGAGTGTGTGGCCCATGCCGG + Exonic
933399314 2:81772397-81772419 GTTAAATGTGTAGCTCAAGCTGG + Intergenic
934568487 2:95353532-95353554 GAGGAAGGTGAAGCTCAAGGAGG - Intronic
934767196 2:96886253-96886275 GGTGAACGTGTATCCCAGGCTGG + Intronic
938084041 2:128386487-128386509 GATGAAGGTGTAGGTGAGGCTGG + Intergenic
941035582 2:160565305-160565327 GTTCAAGTTGTAGCCCGAGCAGG + Intergenic
942773471 2:179551427-179551449 AACGAAGGTGTGGGCCAAGCTGG + Intronic
947501512 2:230674570-230674592 GATGAGGCTGCATCCCAAGCAGG - Intergenic
947722853 2:232380059-232380081 GTAGAAGGTGCAGCCCAGGCTGG + Intronic
948684448 2:239661391-239661413 GATGAAGGAGTGGCTCACGCTGG - Intergenic
1169230166 20:3882911-3882933 GATGAAGGATGAGCCAAAGCTGG + Intergenic
1169781170 20:9312220-9312242 GAAGAAGGGGTAGCCCGAGCTGG - Intronic
1170053800 20:12176529-12176551 GATGCAGGTGGGGCCCAAGGTGG + Intergenic
1172316072 20:33955367-33955389 AATGAAGGTGCAGACCCAGCTGG + Intergenic
1173596305 20:44260762-44260784 GGTGCAAGTGTAGCCCAAGGTGG + Intronic
1174454488 20:50639671-50639693 GCTCATGGTGTTGCCCAAGCTGG - Intronic
1175437200 20:58961827-58961849 GATGGATGTGCAGCCCAATCGGG - Intergenic
1177241808 21:18467710-18467732 GAGGAAGGTGGGGCCCAATCAGG + Intronic
1178836012 21:36098167-36098189 GCTGAAGGTGAAGCAGAAGCAGG + Intergenic
1180002872 21:45002973-45002995 GATGAGGGGGCAGCCCAAGCAGG - Intergenic
1182632599 22:31698454-31698476 GATGTAGTTGTTGCCCAGGCTGG - Intronic
1184331751 22:43832150-43832172 GATGAAGGTGTAGCCCAAGCAGG - Intronic
950516658 3:13470864-13470886 AATGAAGATGAAGCCCATGCAGG + Intergenic
951509169 3:23482426-23482448 GGTGGAGGTGTAGCCCCAGCTGG - Intronic
954328415 3:49876247-49876269 GCTGGAGTCGTAGCCCAAGCTGG + Intergenic
954715863 3:52526454-52526476 GATTAAGGTTTAGCCCTGGCTGG - Intronic
955238452 3:57160213-57160235 GTTGATGGGGTAGCCCCAGCAGG + Intronic
955754516 3:62214315-62214337 GGTGATGGTGTTGCCGAAGCTGG + Intronic
962989262 3:140563796-140563818 GATGAAAGTGAAGCCCAGACAGG + Intronic
964436075 3:156655390-156655412 CATGCATGTGTAGCCAAAGCTGG + Intergenic
967248278 3:187510972-187510994 GATGAATATGTAGCTCAAGTGGG + Intergenic
969029864 4:4203290-4203312 GCTGCAGCTGTAGCCCAAGCTGG - Intronic
970007794 4:11427802-11427824 GAAGAAGCTGGAGCCAAAGCCGG - Intronic
971304284 4:25466413-25466435 GATGAATGTGTAGCCAAGGTTGG + Intergenic
971382042 4:26107933-26107955 GATGAAGCAGGAGCCCAAGGAGG - Intergenic
971493464 4:27238966-27238988 GATGGAGGTGTAGTCCTTGCAGG + Intergenic
977058906 4:92232100-92232122 GATGATGATGAAGCCCAAACAGG + Intergenic
980133545 4:128838891-128838913 GATGTAGGTGCATTCCAAGCAGG + Intronic
980541377 4:134201172-134201194 GATGAGGGTGTTGCCTGAGCTGG - Exonic
981483924 4:145265022-145265044 GATGAAGCTGGAGACCATGCAGG + Intergenic
984269062 4:177528695-177528717 CATGCAGTTGTAGGCCAAGCTGG + Intergenic
984737939 4:183128560-183128582 GATGAAGGTGAAGAACAAGGAGG - Intronic
985807186 5:2054511-2054533 GATGGAGCTGTCGCCCAGGCTGG - Intergenic
985815550 5:2125436-2125458 GATGAAGCTGTAGCAGCAGCTGG + Intergenic
985872552 5:2568865-2568887 GCTGATGGTGTGGCCCATGCAGG + Intergenic
990623411 5:57584773-57584795 GTTGAAGGTAGAGCACAAGCAGG - Intergenic
992509513 5:77419110-77419132 GATGAAGCTGAAGCCAAAGCTGG - Intronic
995130304 5:108623057-108623079 AACCAAGGTGTAGGCCAAGCTGG - Intergenic
997647354 5:135490179-135490201 GATTGAGGTGCAGCCGAAGCTGG + Intergenic
999107652 5:149087721-149087743 GAAGAAGGTGAAGCACAAGCAGG - Intergenic
999999030 5:157120121-157120143 AATGAAGATGGAGCCCTAGCTGG - Intronic
1000264073 5:159617971-159617993 CATGAAAGTGAGGCCCAAGCAGG - Intergenic
1001023077 5:168200054-168200076 GATGAAGGTGTAGGCCAGGTTGG - Exonic
1001937355 5:175714822-175714844 AATGGAGGTGCGGCCCAAGCTGG - Intergenic
1003149706 6:3538259-3538281 GAAGAAGGTGAAGTCCTAGCAGG + Intergenic
1003674870 6:8193591-8193613 GATGGAGCTGTTGCCCAGGCTGG - Intergenic
1005914685 6:30342052-30342074 CATCAAGGTGAAACCCAAGCGGG + Exonic
1006311800 6:33266326-33266348 GATGAGGTTGTTGCCCAGGCTGG + Intronic
1011229139 6:85140290-85140312 GAGGAAGGAGTAGCCCAAAAGGG + Intergenic
1011280467 6:85672088-85672110 GCTCACTGTGTAGCCCAAGCTGG - Intergenic
1018569507 6:165194401-165194423 GTTGAGGGTGTTGCCAAAGCAGG + Intergenic
1018632574 6:165833826-165833848 GATGAAGGTGGTCCCAAAGCAGG + Intronic
1018651433 6:165994722-165994744 GAGGCAGGAGTAGACCAAGCAGG - Intergenic
1023906061 7:44522147-44522169 GGAGAAGTTGTAGCCCAAGGTGG + Exonic
1025033541 7:55576083-55576105 AACGAAGGTGTGGACCAAGCTGG - Intergenic
1026503620 7:70963756-70963778 GAAGCAGGTATACCCCAAGCTGG + Intergenic
1026530187 7:71190430-71190452 GATGAAGGTGAAGCAGGAGCAGG - Intronic
1028415035 7:90570549-90570571 GAGGAAGGTGAAGCTCAAGGAGG + Intronic
1031644715 7:124210375-124210397 GATCAAGGTGTCAGCCAAGCCGG - Intergenic
1032221757 7:129999762-129999784 GATGGAGTTGTCGCCCAGGCTGG - Intergenic
1036914533 8:12792715-12792737 GATGAAGGTGAAGAAGAAGCAGG + Intergenic
1040122466 8:43698539-43698561 CAGGAAGTTGTAGCCAAAGCTGG - Intergenic
1047202558 8:122779767-122779789 GAGAAAGATGTGGCCCAAGCTGG + Intergenic
1047927513 8:129695933-129695955 GATGAAGATGAATCCCATGCTGG + Intergenic
1051683263 9:19629975-19629997 GATTTAGGTGTGGCCCAAACTGG + Intronic
1052824109 9:33163040-33163062 GATGAAGCTCCACCCCAAGCCGG + Intronic
1053198725 9:36138507-36138529 GATTAAGGTGTAGCCTAGGCTGG - Intronic
1055972616 9:81926873-81926895 GATGAATGTGTAGCTCAAGGAGG - Intergenic
1055974369 9:81941945-81941967 GATGAATGTGTAGCTCAAGGAGG - Intergenic
1062273945 9:135721928-135721950 GAGGAAGGTGCAGCCCACCCGGG - Intronic
1185735031 X:2489832-2489854 ATTGAAGGTGTGGCCCAGGCAGG + Exonic
1185824587 X:3237654-3237676 GATCAAGGTGTAGGCAGAGCTGG - Intergenic
1187051758 X:15702975-15702997 GATGCGGGTGTAGTCCCAGCTGG - Intronic
1193686364 X:84581120-84581142 GGTGAAGGAGTAGCAAAAGCAGG - Intergenic
1198940330 X:141947491-141947513 GATGAAGTTTTTGCCCAGGCTGG - Intergenic
1200964779 Y:9026052-9026074 GAAAATGGTGTAGGCCAAGCTGG + Intergenic
1201254734 Y:12096156-12096178 GATCAAGGTGTAGGCAGAGCTGG + Intergenic