ID: 1184333631

View in Genome Browser
Species Human (GRCh38)
Location 22:43840866-43840888
Sequence TGCCGTGGGGTCTTTGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184333623_1184333631 6 Left 1184333623 22:43840837-43840859 CCTACTGCTCTGGAAGGCCAGGC 0: 1
1: 0
2: 2
3: 39
4: 731
Right 1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG 0: 1
1: 0
2: 2
3: 34
4: 240
1184333616_1184333631 18 Left 1184333616 22:43840825-43840847 CCCCCAGGCTTGCCTACTGCTCT 0: 1
1: 0
2: 1
3: 18
4: 303
Right 1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG 0: 1
1: 0
2: 2
3: 34
4: 240
1184333620_1184333631 15 Left 1184333620 22:43840828-43840850 CCAGGCTTGCCTACTGCTCTGGA 0: 1
1: 0
2: 0
3: 24
4: 203
Right 1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG 0: 1
1: 0
2: 2
3: 34
4: 240
1184333615_1184333631 25 Left 1184333615 22:43840818-43840840 CCTGCAACCCCCAGGCTTGCCTA 0: 1
1: 0
2: 1
3: 14
4: 229
Right 1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG 0: 1
1: 0
2: 2
3: 34
4: 240
1184333617_1184333631 17 Left 1184333617 22:43840826-43840848 CCCCAGGCTTGCCTACTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 254
Right 1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG 0: 1
1: 0
2: 2
3: 34
4: 240
1184333618_1184333631 16 Left 1184333618 22:43840827-43840849 CCCAGGCTTGCCTACTGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 215
Right 1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG 0: 1
1: 0
2: 2
3: 34
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184333631 Original CRISPR TGCCGTGGGGTCTTTGCTCA CGG Intronic
900405795 1:2492483-2492505 TGCTGGGGGTTCTGTGCTCAGGG + Intronic
901904265 1:12394125-12394147 TGTAGTGGGGTCCTTCCTCAAGG + Intronic
902879537 1:19362147-19362169 TGCAGTGAGGTCTCTGGTCAAGG + Intronic
903610788 1:24610646-24610668 AGCTGTGGGGAATTTGCTCATGG + Intergenic
904335717 1:29796533-29796555 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
905353871 1:37367335-37367357 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
906033308 1:42736532-42736554 TGCCTTGGTGCCTTTGCACAAGG + Intronic
907290988 1:53412753-53412775 TGCCTTGGGGTCTTTCTGCAGGG - Intergenic
907918650 1:58893486-58893508 GGCCATGGGGCCTCTGCTCAAGG - Intergenic
909172804 1:72316909-72316931 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
909549158 1:76878617-76878639 TGTAGTGGGGTCCTTCCTCAAGG + Intronic
909576709 1:77184404-77184426 TGTAGTGGGGTCCTTCCTCAAGG - Intronic
909810801 1:79930104-79930126 TGTAGTGGGGTCCTTTCTCAAGG - Intergenic
911980254 1:104558138-104558160 TGCAGTGGGGTCTGCCCTCAAGG - Intergenic
912944015 1:114069636-114069658 GGTAGTGGGGTCTTTTCTCAAGG + Intergenic
913039696 1:115010461-115010483 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
916106539 1:161436744-161436766 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
917217422 1:172692362-172692384 TGTAGTGGGGTCCTTTCTCAAGG + Intergenic
917462522 1:175244768-175244790 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
919241601 1:194923047-194923069 TGTAGTGGAGTCTTTCCTCAAGG - Intergenic
920008351 1:202849896-202849918 TGGCCTGGGGTATGTGCTCAGGG + Intergenic
921886157 1:220308529-220308551 TGCCCAGGGGTCTTTTCTCTTGG + Intergenic
1062978826 10:1704966-1704988 TGCCTGTGGGTCTGTGCTCATGG - Intronic
1064517854 10:16169688-16169710 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1064614489 10:17138560-17138582 AGCAGTGTGGTCTTGGCTCAAGG + Intergenic
1069791039 10:71021032-71021054 TGTAGTGGGGTCCTTCCTCAGGG + Intergenic
1071284159 10:84128955-84128977 TGATGTGGGGTCTTGGGTCAAGG - Intergenic
1073957867 10:108893091-108893113 TACAGTGGGGTCCTTCCTCAAGG + Intergenic
1075263618 10:120982775-120982797 TGCACTGGGGCCTTTGCTGAGGG - Intergenic
1077669282 11:4143057-4143079 TGCAGTGGGATCCTTCCTCAAGG - Intergenic
1079412422 11:20201587-20201609 TGCCTTGCAGTCTTTGCTGATGG + Intergenic
1081641693 11:44760085-44760107 TACTGTGGGGTCTTTGCATATGG + Intronic
1081717959 11:45264473-45264495 TGCCCTCGGGTCTTTGCACATGG - Intronic
1081911785 11:46704652-46704674 GGCTCTGGGGTCTTTGCTCTGGG - Exonic
1081933605 11:46889532-46889554 TGCCCTGGGCTCTTTGAGCAGGG - Exonic
1082866869 11:57908094-57908116 TGCCTTGCGCTCTTTGCTGATGG - Intergenic
1083348716 11:62012315-62012337 TTCCCTGGGGTCTTCTCTCAAGG - Intergenic
1084574218 11:69978130-69978152 TTACGTGGGTTCTTTGCACAGGG - Intergenic
1086762815 11:90654549-90654571 TGCCTTGAAGTGTTTGCTCATGG - Intergenic
1088449149 11:109963882-109963904 TGTAGTGGGGTCCTTTCTCAAGG - Intergenic
1089943458 11:122442853-122442875 TGCCTTGGGGTTTTTCCTCAGGG - Intergenic
1091865690 12:3834218-3834240 TGGCATGGAGACTTTGCTCAGGG + Intronic
1093036099 12:14333870-14333892 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1093049126 12:14486425-14486447 TGTAGTGGGGTCTTTCCTCAAGG + Intronic
1093049865 12:14492431-14492453 TGTAGTGGGGTCTTTCCTCAAGG + Intronic
1095844593 12:46731415-46731437 TGCAGTGGGGTCCTTCCTCAAGG + Intergenic
1096337361 12:50766416-50766438 TGCCTTGCGCTCTTTGCTGATGG + Intronic
1096477821 12:51919140-51919162 TGGCGTGGGGTGGTGGCTCATGG + Intronic
1096482832 12:51953354-51953376 TGCAGCGGGGTCTTTGTTCACGG + Intronic
1099365740 12:81763986-81764008 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1099577904 12:84403983-84404005 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1100241362 12:92713161-92713183 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1101777331 12:107806494-107806516 GGCCTTGGGGTCCCTGCTCAGGG - Intergenic
1103035403 12:117652579-117652601 TGTAGTGGGGTCCTTCCTCAAGG - Intronic
1103415902 12:120741370-120741392 TGCCGCAGGGTCTTGGCTCCTGG + Intergenic
1104844924 12:131841863-131841885 TCCCGGGGGGGCTCTGCTCAGGG - Intronic
1105239837 13:18599159-18599181 GGCCCTGGGGTCTTTGCTGCTGG + Intergenic
1105621369 13:22070526-22070548 TGCAGTGGGGCCTTTGGACAGGG + Intergenic
1105779922 13:23696689-23696711 TGCCGTGGGGTCTTCAGTCCAGG - Intergenic
1106088481 13:26563936-26563958 TTCCCTGGGATCTTTTCTCAGGG + Intronic
1106419179 13:29571530-29571552 TGCCGGGGGGTCCTCACTCATGG + Intronic
1109293023 13:60498675-60498697 GTCGGTGGGGTCTTTCCTCAAGG - Intronic
1109516074 13:63443836-63443858 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1109951221 13:69503690-69503712 TGTAGTGGGGTCTTTCCTCAAGG + Intergenic
1111013665 13:82347691-82347713 TGCCATGTGGTCTCTGCTCATGG - Intergenic
1112250132 13:97771707-97771729 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1113319915 13:109223143-109223165 CGTAGTGGGGTCTTTCCTCAAGG + Intergenic
1113938041 13:114005557-114005579 TCCCGAGGGCTCTTTGCTCAGGG - Intronic
1115508961 14:34120961-34120983 TGCCATGGGGACTTGGCTAAAGG - Intronic
1116192634 14:41680006-41680028 AGCAGTGGGGTCTCTCCTCATGG - Intronic
1117001380 14:51374821-51374843 TGTAGTGGGGTCTTTCCTCAAGG - Intergenic
1117167399 14:53050681-53050703 TGCCATGGTCTCTTGGCTCAAGG + Intronic
1117216621 14:53558628-53558650 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1118950766 14:70434549-70434571 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1119615011 14:76093142-76093164 TGCCCTGGGGTCTTGGCTGAGGG - Intergenic
1119615163 14:76094226-76094248 TGGCCTGGGGTCTTGGCTGAGGG - Intergenic
1120738461 14:88081170-88081192 TGCCCTGTGGTTTCTGCTCATGG + Intergenic
1122316552 14:100828700-100828722 TGCCATAGGGTCTCTCCTCAGGG + Intergenic
1123112721 14:105880706-105880728 AGCGGTGGGGTCTTTGATCCAGG + Intergenic
1123988747 15:25667939-25667961 TGCCGTCAGGCCTGTGCTCATGG - Intergenic
1125120136 15:36146571-36146593 TGCCATCGGGTCTTTTTTCAGGG - Intergenic
1126273310 15:46847594-46847616 TGCAGTTGGGTCTTTGCTGTTGG + Intergenic
1127812843 15:62579564-62579586 TGCTGTGGTGTGTTGGCTCACGG + Intronic
1128133337 15:65245256-65245278 TGACCTGGGCTCTCTGCTCATGG + Intronic
1129961544 15:79691212-79691234 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1130120821 15:81046124-81046146 TGCCAAAGGGTCCTTGCTCAGGG - Intronic
1130574792 15:85082134-85082156 TCCCATGGGGTCTTGGCTGATGG + Intronic
1132661504 16:1063426-1063448 TGGGGTGGGGTCTCTGCTCCTGG - Intergenic
1132693752 16:1193070-1193092 TGCCGTGGGGGCTCAGGTCAGGG + Intronic
1132753045 16:1467641-1467663 GGACGTGGGGTCCTTCCTCATGG - Intronic
1138868187 16:60849315-60849337 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1142110301 16:88327553-88327575 TGGGGGGGGGTCTGTGCTCACGG + Intergenic
1142229490 16:88893171-88893193 TGTTGTGGGGACATTGCTCAGGG - Intronic
1142989949 17:3723844-3723866 TGCCGCGGGGTCCTAGCTCCCGG - Intronic
1146850728 17:36219559-36219581 TGTAGTGGGGTCCTTCCTCAAGG - Intronic
1152251864 17:79216589-79216611 AGCCGTGGGGCCTGTGCTCTGGG - Intronic
1152920152 17:83062456-83062478 TGCCCCGGGGTCGTTTCTCAGGG + Intergenic
1154172951 18:12063885-12063907 GGCCATGGGGTCCCTGCTCAGGG - Intergenic
1154448994 18:14459615-14459637 GGCCCTGGGGTCTTTGCTGCTGG - Intergenic
1156303661 18:35857255-35857277 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1156990486 18:43402169-43402191 TGCAGTGGGGTCCTTCCTCAAGG + Intergenic
1156998395 18:43496245-43496267 TGTAGTGGGGTCCTTTCTCAAGG - Intergenic
1159957095 18:74526360-74526382 TGCCCTGGGGTCATCCCTCAGGG + Intergenic
1162770887 19:12948792-12948814 AGCCGTGGAGTATCTGCTCACGG + Exonic
1163629526 19:18410689-18410711 ACCCTTGGGGTCTTAGCTCAGGG + Intergenic
1163685811 19:18711090-18711112 TTCCTTGGGGTTTTGGCTCAGGG + Intronic
1164097319 19:22023145-22023167 TGTAGTGGGGTTTTTCCTCAAGG + Intergenic
1165130836 19:33630865-33630887 CTCTGTGGGGTCTTTGCACAAGG + Intronic
1166402734 19:42495655-42495677 TGCCTTGCGCTCTTTGCTGAAGG - Intergenic
1166608418 19:44166164-44166186 CACTGTGGGGACTTTGCTCAAGG + Intronic
1168539558 19:57198843-57198865 TGTAGTGGGGTCCTTCCTCAAGG + Intronic
925100011 2:1236328-1236350 TCCCGTGGGGCCTTTGGTCCTGG - Intronic
926293028 2:11545473-11545495 TGCCTTGGGTTCTTTTGTCATGG - Intronic
926810592 2:16752147-16752169 TGTAGTGGGGTCTTTCCTCAAGG + Intergenic
926825603 2:16902468-16902490 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
926825788 2:16903825-16903847 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
927687057 2:25178417-25178439 TGCAGAGGGCTCTTTGATCAGGG - Intergenic
930909956 2:56619390-56619412 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
931691377 2:64837395-64837417 TGCAGTGTGCTCATTGCTCAGGG - Intergenic
931822139 2:65962838-65962860 TGCCTTGGGGACTTGGCACAAGG - Intergenic
933265922 2:80180192-80180214 TATAGTGGGGTCTTTCCTCAAGG + Intronic
936040409 2:109145411-109145433 TGCTGTTGGCTCTTTGCTTATGG + Intronic
937637339 2:124170851-124170873 TGCCATGGGGTCTGTGAACACGG - Intronic
937785397 2:125889187-125889209 TGTAGTGGGGTCCTTTCTCAAGG + Intergenic
938482469 2:131673241-131673263 GGCCCTGGGGTCTTTGCTGCTGG + Intergenic
938590754 2:132733988-132734010 TGCCATGGGATGTTTGGTCATGG + Intronic
941330873 2:164176047-164176069 GGCAGTGGGGTCCTTCCTCAAGG + Intergenic
941667807 2:168259711-168259733 TGCAGTGGGGTCCTTCCTCAAGG - Intergenic
943384225 2:187182343-187182365 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
943517801 2:188908709-188908731 TGTAGTGGGGTCCTTTCTCAAGG + Intergenic
948350886 2:237339990-237340012 TACCACTGGGTCTTTGCTCATGG - Intronic
948764525 2:240212581-240212603 AGCCGTGGGGTCTCTGCCCTTGG + Intergenic
1172321081 20:33995277-33995299 TTCCCTGGGGTTTTGGCTCAAGG + Intronic
1172955062 20:38750684-38750706 TGCAGTGGGATCTTGGCTCAGGG + Intronic
1173370461 20:42430139-42430161 GACCGTGGGGACCTTGCTCATGG - Intronic
1173709335 20:45140716-45140738 GGTAGTGGGGTCTTTCCTCAAGG + Intergenic
1173789485 20:45818511-45818533 TGCCATGTGGTCCTTGGTCACGG + Intergenic
1175886231 20:62292408-62292430 TGCCGTGGCGTCTGTGCACATGG + Intronic
1175930052 20:62489649-62489671 TGCAGTGGGGACGTTGCTAAAGG - Intergenic
1176997955 21:15578752-15578774 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1177150436 21:17450232-17450254 TTCCGTGGTGTCTCTGCTGAGGG - Intergenic
1178012432 21:28303451-28303473 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1179415364 21:41193996-41194018 TGTAGTGGGGTCCTTCCTCAAGG + Intronic
1182755180 22:32673414-32673436 GGCCGTTCGGTCATTGCTCATGG + Intronic
1184333631 22:43840866-43840888 TGCCGTGGGGTCTTTGCTCACGG + Intronic
1185147693 22:49148181-49148203 TGGCCTGGGGTCCTTCCTCATGG - Intergenic
953153270 3:40344465-40344487 TGCCTTGGACTCTTTGCTGATGG + Intergenic
953870235 3:46619826-46619848 TGCCTCGGGGTGTTTGCACATGG - Intronic
956319059 3:67975042-67975064 CTCCCTGGGGTCTTTGCTCTGGG - Intergenic
956403073 3:68900415-68900437 TGCCACAGGGTCTTTGCACATGG + Intronic
956509446 3:69978883-69978905 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
956560432 3:70568824-70568846 TGCCTTGGCGTCTTTGATAATGG - Intergenic
957247734 3:77734802-77734824 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
958934104 3:100239157-100239179 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
960208355 3:114930553-114930575 TGCCTTGGCGTCTTTGCTCAGGG - Intronic
960841566 3:121963865-121963887 TTCCCTGGGGGCTTTGTTCAGGG - Intergenic
961381989 3:126501145-126501167 AGCATTGAGGTCTTTGCTCAGGG + Intronic
964977401 3:162637254-162637276 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
965226959 3:166002242-166002264 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
967831568 3:193924514-193924536 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
968446317 4:654088-654110 TGACGTGTGGTCTGTGCTGATGG + Exonic
969251999 4:5974063-5974085 TTCCATGGGGTCTAGGCTCAAGG + Intronic
969253654 4:5988344-5988366 TACCATGGGGCCATTGCTCAGGG + Exonic
970089386 4:12387821-12387843 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
971168888 4:24213034-24213056 TGCCATTGGGTCTTTGCTCTAGG - Intergenic
972201494 4:36718624-36718646 TGTAATGGGGTCTTTCCTCAAGG + Intergenic
973118239 4:46487570-46487592 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
974289391 4:59911283-59911305 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
974458972 4:62163765-62163787 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
975982822 4:80178749-80178771 TACAGTGGGGTCCTTCCTCAAGG + Intergenic
976508840 4:85883465-85883487 TGCCATTGGGTCTTTCCTCCTGG - Intronic
977430559 4:96926747-96926769 GGTAGTGGGGTCTTTCCTCAAGG - Intergenic
978341856 4:107727736-107727758 TGTAGTGGGGTCCTTGCTCAAGG + Intergenic
979017910 4:115458385-115458407 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
979075516 4:116264932-116264954 TGTAGTGGGGTCTTTTCTCAAGG - Intergenic
979320317 4:119315718-119315740 TGCCTTGGTGTCTTTGCTCCAGG + Intergenic
979766808 4:124473113-124473135 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
979898599 4:126190511-126190533 TGTAGTGGGGTCTTTCCTCAAGG + Intergenic
980388115 4:132112583-132112605 TGTGGTGGAGTCTTTCCTCAAGG + Intergenic
981231177 4:142357311-142357333 ACCTGTGGGGTCTTTGCTAACGG + Intronic
981374334 4:143996349-143996371 TGAAGTGGAGTCTTAGCTCATGG - Intronic
982835327 4:160115168-160115190 TGTGGTGGGGTCCTTCCTCAAGG - Intergenic
983184861 4:164690095-164690117 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
984061266 4:174991277-174991299 TGTAGTGGGATCTTTCCTCAAGG + Intergenic
985589028 5:755340-755362 TGGCGGGGGGTCTATGCTCAGGG - Intronic
985603708 5:847856-847878 TGGCGGGGGGTCTATGCTCAGGG - Intronic
986742212 5:10713986-10714008 GGCCGTGGGTTCTTTCCACATGG + Intronic
987152973 5:15060191-15060213 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
987304203 5:16622527-16622549 TGCAGTCGGGTGTTTGCTTATGG + Intergenic
987504200 5:18748387-18748409 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
988161017 5:27518352-27518374 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
988267694 5:28972833-28972855 TGTAGTGGAGTCCTTGCTCAAGG + Intergenic
988561926 5:32289406-32289428 TGTGGTGGGGTCCTTCCTCAAGG - Intronic
988924332 5:35974092-35974114 TGTAGTGGGGTCTTTTCCCAAGG - Intronic
989457850 5:41663245-41663267 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
991014020 5:61912382-61912404 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
991330938 5:65491169-65491191 TGTAGTGGGGTCCTTCCTCAGGG + Intergenic
992242668 5:74787962-74787984 TGTAGTGGGGTCCTTCCTCAAGG - Intronic
993203237 5:84846417-84846439 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
993319632 5:86457118-86457140 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
995269762 5:110206937-110206959 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
995776490 5:115729150-115729172 TGTAGTGGGGTCCTTTCTCAAGG + Intergenic
996488806 5:124068036-124068058 TGTGGTGGGGTCCTTCCTCAAGG + Intergenic
996825358 5:127676353-127676375 TGCAGTGGGGTCCTTCCTCAAGG - Intergenic
998714402 5:144866279-144866301 TGCCGTAGGGAGTTTGCTCTGGG + Intergenic
999351188 5:150873378-150873400 TGTAGTGGGGTCATTCCTCAAGG - Intronic
1001270705 5:170309603-170309625 AGCCTTGGGGTCTTTGCTCACGG - Intergenic
1003696107 6:8407619-8407641 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1004824497 6:19404704-19404726 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1005116724 6:22346523-22346545 TGCCGTGGTGTCCCTGCTCTGGG - Intergenic
1005998721 6:30948704-30948726 TGCAGTGGCGTTTTTGCTCATGG - Exonic
1006001306 6:30967289-30967311 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1008464710 6:51817541-51817563 TGCCTTGGGGTGTTTGCTCTGGG - Intronic
1010323371 6:74539016-74539038 TGTAGTGGGGTCCTTCCTCATGG - Intergenic
1010719309 6:79264174-79264196 TGCCTTGCGCTCTTTGCTGATGG - Intergenic
1012344388 6:98168860-98168882 TGTAATGGGGTCTTTCCTCAAGG - Intergenic
1016182771 6:141168057-141168079 TGCTGTGGGGGCCTTTCTCAGGG + Intergenic
1016288909 6:142506526-142506548 GGACGTGGGGTCTGTGCTCTAGG + Intergenic
1017228022 6:152042558-152042580 TGTAGTGGGGTCCTTCCTCAAGG + Intronic
1017348711 6:153414973-153414995 TGCCTTGAACTCTTTGCTCAGGG - Intergenic
1017906101 6:158758473-158758495 TGCCGTGGGCCCTTGGCTGAGGG - Intronic
1018039489 6:159909455-159909477 GGCAGTGGGGTCCTTGCTCGAGG - Exonic
1018742192 6:166738415-166738437 TGCTGTAGGGTCTCTGCTCTTGG - Intronic
1019299943 7:297829-297851 TGCGGAGGGGTCTGAGCTCAGGG + Intergenic
1019307757 7:343988-344010 TTCCGAGGAGTCTGTGCTCATGG + Intergenic
1019880837 7:3859297-3859319 TCCTGGGGGGCCTTTGCTCATGG + Intronic
1022747182 7:33184366-33184388 TGCCTTGCGCTCTTTGCTGATGG - Intronic
1024159325 7:46658195-46658217 TGCGCTGGGGTCTTTCCTCAAGG + Intergenic
1030277257 7:107734631-107734653 TGTAGTGGGGTCTTTCATCAAGG - Intergenic
1032153311 7:129448418-129448440 TGTAGTGGGGTCCTTCCTCAAGG + Intronic
1032923620 7:136577274-136577296 TGTAGTGGGGTCTTTCTTCAAGG + Intergenic
1033076008 7:138251259-138251281 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1033515679 7:142103414-142103436 TGTCGTGGGGTCATTGTTGAAGG - Exonic
1035769579 8:2136268-2136290 GGCTGTGGGGTCCTGGCTCAGGG + Intronic
1039921853 8:41898532-41898554 GGCCCTGGGGCCTGTGCTCAAGG - Intergenic
1040916339 8:52569310-52569332 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1042001256 8:64125460-64125482 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1044150596 8:88771591-88771613 TGTAGTGGGGTCCTTACTCAAGG - Intergenic
1044242546 8:89903001-89903023 TGTGGTGGGGTCCTTGCTCCGGG + Intronic
1044286166 8:90413928-90413950 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1044487358 8:92768604-92768626 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1044773142 8:95658883-95658905 TGCCTTGGCGCCTTTGTTCATGG + Intergenic
1045221565 8:100205207-100205229 TGTAGTGGGGTCCTTCCTCAAGG - Intronic
1045428185 8:102087672-102087694 TGCCTTGCAGTCTTTGCTGACGG + Intronic
1046128869 8:109943078-109943100 TGTAGTGGGGTCTTTCCTCAAGG + Intergenic
1046341855 8:112869466-112869488 TGCAGTGTGGTGTTTCCTCAAGG + Intronic
1050482469 9:6101142-6101164 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052368440 9:27639354-27639376 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1057316722 9:93973950-93973972 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1058019684 9:100074597-100074619 TGTAGTGGGGTCCTTCCTCAAGG - Intronic
1186469976 X:9813559-9813581 TGTAGTGGGGTCCTTCCTCAAGG + Intronic
1187686545 X:21821129-21821151 GGCCGTGGGGTCTTTGCATGTGG + Intergenic
1188419019 X:29973576-29973598 ATCCCTGGGGTCTTTGCTTATGG - Intergenic
1191226544 X:58050207-58050229 TGTAGTGGGGTCTTTCCCCAAGG - Intergenic
1191659012 X:63631460-63631482 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1191719441 X:64217133-64217155 TGTAGTTGGGTCTTTCCTCAAGG + Intergenic
1191742725 X:64452783-64452805 TGTAGTGGGGTCCTTTCTCAAGG + Intergenic
1191769699 X:64741575-64741597 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1193957088 X:87876747-87876769 TGTAGTGGGGTCTTTCATCAAGG - Intergenic
1194520910 X:94917959-94917981 TGTAGTGGGGTCCTTTCTCAAGG - Intergenic
1194833746 X:98657317-98657339 TGTAGTGGGGTCCTTTCTCAAGG - Intergenic
1196528855 X:116759620-116759642 GCCCCTGGGGTCTTTGTTCAGGG - Intergenic
1197002086 X:121451475-121451497 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1197084394 X:122454978-122455000 TGAAGTGGGGTCCTTCCTCAAGG + Intergenic
1197207961 X:123805961-123805983 TGGCGTGAGATCTTGGCTCACGG - Intergenic
1197245308 X:124160787-124160809 TGTAGTGGGGTCTTTCCTCAAGG + Intronic
1197372232 X:125639332-125639354 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1197380196 X:125729413-125729435 TGTAGTGGGGTCCTTCCTCAAGG + Intergenic
1197591666 X:128417865-128417887 TGTAGTGGGGTCCTTCCTCAAGG - Intergenic
1200276988 X:154742691-154742713 TGCTGTGGGGTCAATGCTAAGGG + Intronic
1200973253 Y:9179038-9179060 TGTAGTGGGGTCGTTCCTCAAGG + Intergenic
1201798264 Y:17925224-17925246 TGGAGTGGGGTCTTTCCTCAAGG - Intergenic
1201803289 Y:17980733-17980755 TGGAGTGGGGTCTTTCCTCAAGG + Intergenic
1202137821 Y:21685475-21685497 TGCAGTGGGGTCATTCCTCAAGG - Intergenic
1202359586 Y:24093915-24093937 TGGAGTGGGGTCTTTCCTCAAGG - Intergenic
1202511192 Y:25576199-25576221 TGGAGTGGGGTCTTTCCTCAAGG + Intergenic