ID: 1184334479

View in Genome Browser
Species Human (GRCh38)
Location 22:43845206-43845228
Sequence CCGGGCTGTCACCACGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184334479_1184334485 5 Left 1184334479 22:43845206-43845228 CCCTGAACGTGGTGACAGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1184334485 22:43845234-43845256 AGCCCTGGTCCCCTGCCCCCAGG 0: 1
1: 0
2: 5
3: 70
4: 579
1184334479_1184334482 -10 Left 1184334479 22:43845206-43845228 CCCTGAACGTGGTGACAGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1184334482 22:43845219-43845241 GACAGCCCGGAGTGCAGCCCTGG 0: 1
1: 0
2: 0
3: 24
4: 210
1184334479_1184334491 16 Left 1184334479 22:43845206-43845228 CCCTGAACGTGGTGACAGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1184334491 22:43845245-43845267 CCTGCCCCCAGGCCAAACCCAGG 0: 1
1: 0
2: 3
3: 51
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184334479 Original CRISPR CCGGGCTGTCACCACGTTCA GGG (reversed) Intronic
900502196 1:3011780-3011802 CCGGGCCGGCAGCACGTGCACGG + Intergenic
902718864 1:18291163-18291185 CCGGGCTGTCCCGCTGTTCATGG - Intronic
906939881 1:50246475-50246497 CCTAGCTGACACCACCTTCACGG - Intergenic
915367119 1:155322868-155322890 TCGGGAAGTCACCACCTTCAAGG + Exonic
1064172594 10:13047318-13047340 CCGGTCTGTCACCAGCTCCATGG - Intronic
1067792373 10:49298091-49298113 CCTGGCTGTCAGCCGGTTCAAGG + Intergenic
1073530932 10:104231811-104231833 CCGGGCTGTCGCCAGGTGGAGGG + Intronic
1074357234 10:112797324-112797346 CCGGGATGTTGCCACGGTCACGG - Intronic
1078058149 11:8024314-8024336 GCAGGATGTCACCACTTTCATGG + Intronic
1081547429 11:44081310-44081332 CCAGGCAGTCACCACGGTCCCGG - Exonic
1087430547 11:98047877-98047899 CTGGGCTGCCACCATGTTCCAGG + Intergenic
1091927891 12:4370511-4370533 CCGGGGCTTCAGCACGTTCAGGG + Exonic
1122306179 14:100768230-100768252 CTGGGCTCTCACCACTTCCATGG + Intergenic
1122968623 14:105143515-105143537 CCTGGCTGTCACCGAGGTCAAGG - Exonic
1202854812 14_GL000225v1_random:43639-43661 CCAGGCTGTCCCAACGTGCAAGG - Intergenic
1124440875 15:29685532-29685554 CCATGCTGTCACCACGTGCAGGG - Intergenic
1132757259 16:1491724-1491746 CCTGGCTGTCAACACATTCAGGG + Intergenic
1132952813 16:2573983-2574005 ACGGGGTTTCACCACGTTTATGG + Intronic
1132961538 16:2626185-2626207 ACGGGGTTTCACCACGTTTATGG - Intergenic
1133236353 16:4389078-4389100 CAGGGCTGTCACCATGTGGAAGG + Intronic
1137410383 16:48223164-48223186 CCCTGCTGTCACCAGCTTCATGG - Intronic
1141957584 16:87383225-87383247 CCGCGGTGACACCACGTTGAGGG - Intronic
1160588781 18:79928078-79928100 CTGGGCTGTCACCGCGGCCAAGG + Intronic
1161539205 19:4839503-4839525 CCGGGCGCTCACCATGTTCCGGG - Exonic
1162959447 19:14117471-14117493 CCGGGCTGTGACCCCGATCTTGG - Intronic
1163099291 19:15084029-15084051 CTGTGCTGTCAACACGTGCAAGG - Intergenic
1165152665 19:33770211-33770233 CCTGGCTGTCTCCACGTCCTGGG - Intronic
1168690229 19:58372246-58372268 CCGGGGTTTCACCATGTTCACGG + Intronic
933774594 2:85764546-85764568 CTGGGCTGTCACCCTGCTCAGGG - Intronic
948836956 2:240630524-240630546 CAGGGCAGTCACCACCTTCAGGG - Exonic
1175227216 20:57451569-57451591 CCGGGATGTCACCATGCTGAGGG + Intergenic
1179816336 21:43908637-43908659 CAGGGCTGTGTCCAGGTTCAGGG + Intronic
1180092044 21:45538211-45538233 CCAGGCTGTCACCACCTCCAGGG + Intronic
1180206972 21:46266788-46266810 CCTGGCTGTCAGCACATTGAGGG - Intronic
1184334479 22:43845206-43845228 CCGGGCTGTCACCACGTTCAGGG - Intronic
955023964 3:55149145-55149167 CTGGGGTGGCACCACGTACAAGG - Intergenic
961473936 3:127135498-127135520 CCGCGCTGTCACCAGGGCCACGG + Intergenic
966660207 3:182406120-182406142 CTGGGCAGTTACCACCTTCAAGG - Intergenic
968604913 4:1530597-1530619 CCTGGCTGGCACCAGGGTCAGGG - Intergenic
975579174 4:75891540-75891562 CCTGGCTGTCACCAGATTCACGG + Intronic
984639484 4:182145197-182145219 CCGGGATGTCACCGCTTTCCGGG + Intronic
990240639 5:53813121-53813143 CCAGGCTGTGAGCAGGTTCAGGG - Intergenic
997359531 5:133285884-133285906 CTGGGCTGTCAGCACTCTCAGGG + Intronic
1003644972 6:7907424-7907446 CCTCACTGTCACCAGGTTCAGGG + Intronic
1023958337 7:44905820-44905842 CCTGGCTGTCCCCACCATCAGGG + Intergenic
1034393839 7:150804990-150805012 CAGGGCTGTGGCCACGGTCATGG - Exonic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1039185349 8:34909983-34910005 CCGGGCTGGCCCCAGGTTCCAGG + Intergenic
1039437972 8:37573677-37573699 CGGAGCTGTCACCAAGTGCATGG + Intergenic
1048425107 8:134316164-134316186 CTGGGCTGTCAACACCTTGAGGG + Intergenic
1049024456 8:139979239-139979261 CCAGGCTCTCACCACCTACACGG - Intronic
1056218399 9:84427365-84427387 TCAGGCTGTGACCACCTTCAGGG - Intergenic
1057468379 9:95337040-95337062 CCTGGCTGTCACCAGCTCCACGG - Intergenic
1061385120 9:130285154-130285176 CCGGGCAGTCACCACCTCCCTGG - Intronic
1062085795 9:134647534-134647556 CCTGGCTGACTCCACGTGCAGGG + Intronic
1062534875 9:137016974-137016996 CCTGGCTGTCACCATGCTGATGG - Exonic
1203793738 EBV:165099-165121 CCAGGCTGTCACCGCTTTCTTGG + Intergenic
1200067601 X:153511540-153511562 CCAATCTGTCACCAAGTTCAGGG - Intergenic