ID: 1184334898

View in Genome Browser
Species Human (GRCh38)
Location 22:43847428-43847450
Sequence GAGACCAGTGGGAGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 346}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184334898_1184334908 10 Left 1184334898 22:43847428-43847450 CCAGCACTCCTCCCACTGGTCTC 0: 1
1: 0
2: 1
3: 30
4: 346
Right 1184334908 22:43847461-43847483 CCTGGTGGTGCCCTTGGGCATGG 0: 1
1: 0
2: 2
3: 21
4: 335
1184334898_1184334905 4 Left 1184334898 22:43847428-43847450 CCAGCACTCCTCCCACTGGTCTC 0: 1
1: 0
2: 1
3: 30
4: 346
Right 1184334905 22:43847455-43847477 CATGCTCCTGGTGGTGCCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 252
1184334898_1184334903 -5 Left 1184334898 22:43847428-43847450 CCAGCACTCCTCCCACTGGTCTC 0: 1
1: 0
2: 1
3: 30
4: 346
Right 1184334903 22:43847446-43847468 GTCTCTCTCCATGCTCCTGGTGG 0: 1
1: 0
2: 6
3: 58
4: 458
1184334898_1184334906 5 Left 1184334898 22:43847428-43847450 CCAGCACTCCTCCCACTGGTCTC 0: 1
1: 0
2: 1
3: 30
4: 346
Right 1184334906 22:43847456-43847478 ATGCTCCTGGTGGTGCCCTTGGG 0: 1
1: 0
2: 0
3: 16
4: 160
1184334898_1184334902 -8 Left 1184334898 22:43847428-43847450 CCAGCACTCCTCCCACTGGTCTC 0: 1
1: 0
2: 1
3: 30
4: 346
Right 1184334902 22:43847443-43847465 CTGGTCTCTCTCCATGCTCCTGG 0: 1
1: 1
2: 2
3: 32
4: 391
1184334898_1184334909 11 Left 1184334898 22:43847428-43847450 CCAGCACTCCTCCCACTGGTCTC 0: 1
1: 0
2: 1
3: 30
4: 346
Right 1184334909 22:43847462-43847484 CTGGTGGTGCCCTTGGGCATGGG 0: 1
1: 0
2: 0
3: 27
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184334898 Original CRISPR GAGACCAGTGGGAGGAGTGC TGG (reversed) Intronic
900302382 1:1984513-1984535 GTGGGCAGTGGGAGGGGTGCAGG - Intronic
901803669 1:11724332-11724354 GACTCCAGCTGGAGGAGTGCAGG - Exonic
902981861 1:20129206-20129228 GGGTCCAGTGGGAGGGGAGCAGG - Intergenic
903035270 1:20488826-20488848 AAGACAAGTGGGAGGAATGGAGG - Intergenic
903213303 1:21830264-21830286 GAGGCCACAGGGAGGACTGCAGG + Intronic
904396974 1:30228502-30228524 GTGCCCACTGGGAGGCGTGCAGG + Intergenic
904401712 1:30261037-30261059 GAAACAGGTGGGAGGGGTGCAGG - Intergenic
904468091 1:30719604-30719626 GAGCCTAGTGGGAGGGGAGCAGG - Intronic
906724824 1:48036524-48036546 AAGACCAGTGGGAGGAGCACAGG + Intergenic
906961726 1:50423071-50423093 GAGAGCAGTGGGTGGAGACCTGG - Intronic
907261057 1:53218987-53219009 AAGAACAGTGGGAGGTGGGCAGG + Intronic
907442355 1:54487004-54487026 GAAACCAGTGAGAAGAGAGCTGG - Intergenic
907819852 1:57956420-57956442 GAGCCCACTGGGAGGAATTCAGG + Intronic
908782568 1:67704618-67704640 GAGACCCTTGGGAGGACTCCAGG - Exonic
909608704 1:77531839-77531861 GAGACCAGGGGGAGGTGGGGGGG + Intronic
910724642 1:90325973-90325995 GAGATCAGTGGGAGGGGTCGGGG - Intergenic
911046035 1:93629199-93629221 GAGAACAGTGGGAGGAGCCTTGG - Intronic
911086111 1:93978703-93978725 CAGAGCAGAGGGAGGGGTGCTGG - Intergenic
911619757 1:100053260-100053282 GGGAGGAGTGGGAGGAGTACTGG - Intronic
912975344 1:114324363-114324385 ATGCCCAGTGGGAGGACTGCTGG - Intergenic
915132690 1:153706719-153706741 GAGTGCAGTGGCTGGAGTGCAGG + Intergenic
915547426 1:156608967-156608989 AACACCAGTGGGAGTAGAGCTGG + Intergenic
915570384 1:156742256-156742278 GAGACCAGTAGGAAGAGGGTGGG + Intronic
915629196 1:157138542-157138564 GCGCGCAGGGGGAGGAGTGCGGG - Intergenic
915634100 1:157174364-157174386 GAGCCCCGAGGGAGGAGGGCAGG + Intergenic
915734790 1:158077905-158077927 GAGGGCAGAGGGAGGAGTACTGG + Intronic
916007188 1:160673495-160673517 GAGCTGAGTGGGAGGAGGGCCGG - Intergenic
916040105 1:160954386-160954408 GCCACCAGTGGGTGCAGTGCAGG - Exonic
916069023 1:161159434-161159456 GGGACCGGTGGGAGGAGTTCGGG + Intronic
916521422 1:165566990-165567012 GAGACCAGAGGGAGGCATGACGG + Intergenic
918178134 1:182062859-182062881 GGGGCCAGTTGGGGGAGTGCGGG - Intergenic
919767734 1:201138171-201138193 CAGAGCAGTGGAAGGAGGGCAGG - Intronic
920826390 1:209427470-209427492 CAGACCAATAGGAGGAGGGCAGG - Intergenic
920915348 1:210253972-210253994 GAGAGCAGAGGGAGGAGTTCAGG - Intergenic
922021690 1:221711436-221711458 AAGACCAGGGGGAGGGGTGTAGG + Intronic
922812711 1:228426713-228426735 GGGGCCAGTGGGAGGTGTGTGGG + Intergenic
923005641 1:230047307-230047329 GAGACCAATGGGAGGTGTTTGGG - Intergenic
1062878764 10:961835-961857 GGGCCCAGTGGGAGGTGTTCAGG - Intergenic
1063668312 10:8079718-8079740 GAGACCAGTGGGGGTAGGGAAGG - Intergenic
1064622164 10:17228179-17228201 GAGACCAGAGGGACGGGGGCGGG + Intergenic
1066164119 10:32767146-32767168 GTGCCCAGTGGGAGGTGTGTTGG - Intronic
1067440325 10:46305583-46305605 GAGCCCAGTGGGTAGAGAGCTGG + Intronic
1068995474 10:63197525-63197547 AAGAGCAGTGAGAGGAGTCCGGG - Exonic
1069746242 10:70716722-70716744 GGGACCAGAGGGAGGAGATCTGG + Intronic
1069961315 10:72080963-72080985 GAGAACAGCGGGAGGTGTGAGGG + Intronic
1070887094 10:79911012-79911034 GAGACCAGTGGGAGTCAGGCTGG + Intergenic
1071301523 10:84259397-84259419 GATACCAGTAGTAGGACTGCTGG + Exonic
1071790875 10:88952812-88952834 GAAGCAAGTGGGAGGAGAGCAGG - Intronic
1071863422 10:89699815-89699837 GAGACCATGGGGAGGAGTCAGGG - Intergenic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1073319021 10:102602759-102602781 GAAGGCAGTGGGAGGAGGGCTGG - Intronic
1073327204 10:102649900-102649922 GGGACCAGGGGGAGGAGTAGGGG + Intronic
1073457682 10:103647412-103647434 GAGACCAGGGTGTGGAGGGCAGG + Intronic
1075354697 10:121760949-121760971 GAGCCCAGTGGGAGGTGTTTGGG + Intronic
1076021593 10:127077971-127077993 GAGCCCAGGGGCAGGAGTGGAGG + Intronic
1076564198 10:131386955-131386977 AGGAGCAGAGGGAGGAGTGCTGG + Intergenic
1077191206 11:1256550-1256572 GAGATGAATGGGTGGAGTGCGGG - Intronic
1078025550 11:7691774-7691796 GAGACCACAGGGAGGGGTGGAGG + Intronic
1078089222 11:8253687-8253709 CAGACAAGTGGGAGCAGTGCTGG - Intronic
1078730456 11:13969398-13969420 AAGAGCAGAGGCAGGAGTGCTGG + Intronic
1078852780 11:15179555-15179577 GGGGCCTGTGGGAGGAGTGGGGG - Intronic
1079388871 11:20003713-20003735 CAGAACAGTGGGAGGTGTGCAGG - Intronic
1079455686 11:20634199-20634221 GAGCCCAGTGGCTGGAGTACAGG - Intronic
1079749684 11:24181669-24181691 GAGGCTTGTGGGAGTAGTGCTGG - Intergenic
1080049606 11:27846078-27846100 GAGAACAGGGAGAGCAGTGCAGG - Intergenic
1080349869 11:31370947-31370969 GATACCAGTGGCAGGAATCCAGG + Intronic
1080466489 11:32502362-32502384 CAGACCAGGGGGTGGAGTGGGGG - Intergenic
1081805967 11:45890709-45890731 GAGACCAGAGGGCGGTGGGCAGG + Intronic
1082883190 11:58058384-58058406 GGAAGCTGTGGGAGGAGTGCAGG - Intronic
1084533239 11:69741779-69741801 GAGCCCTGTTGCAGGAGTGCTGG + Intergenic
1084556488 11:69879156-69879178 GAGACCCGTGGGAGGGGGCCTGG + Intergenic
1085308167 11:75500167-75500189 GAGGCCAGAGGGAGGAGGGAGGG - Intronic
1085351861 11:75802811-75802833 CAGAGCAGTGGGAGGAGTGCTGG + Intergenic
1085590036 11:77751723-77751745 GAGAGGAGTGGGAGGAATGGGGG - Intronic
1086942535 11:92813351-92813373 GTTACCAGTGGGAGAAGGGCTGG - Intronic
1090113657 11:123943161-123943183 GAGAACAGTGGCAAGAATGCAGG + Exonic
1090611293 11:128473378-128473400 GAGAGCACTTGGAGCAGTGCTGG - Intronic
1091626381 12:2124067-2124089 GAGACCAGAGGGAGGACAGCAGG - Intronic
1091628974 12:2144297-2144319 TGGACCAATGGTAGGAGTGCTGG + Intronic
1091890459 12:4049839-4049861 GAGACCTGGGGGTGGGGTGCTGG - Intergenic
1091898246 12:4121880-4121902 AAGAGCAGAGGGAGGAGTGTGGG + Intergenic
1093181589 12:15972782-15972804 GGGATCAGTGGGAGTGGTGCGGG + Intronic
1095444018 12:42267190-42267212 GTGGCCAGTGGGAGGAGAGGGGG + Intronic
1095711445 12:45292972-45292994 GTGAGCAGTGGGCAGAGTGCCGG + Intronic
1096695697 12:53346767-53346789 GAGATCAGGAGGAGCAGTGCTGG - Intergenic
1096876326 12:54633078-54633100 GAAGCCAGTGGGAGGAGATCTGG - Intronic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1098263657 12:68697023-68697045 GGGAACAGTGGCAGGAGTGGAGG + Intronic
1100247894 12:92782755-92782777 GGGACCAGTGGAAGAAGGGCAGG - Intronic
1100595212 12:96065714-96065736 GAGACCAGTGAGAGGAGTCATGG + Intergenic
1100626952 12:96344979-96345001 GAGGCCTGTCGGAGGAGGGCAGG - Intronic
1101049952 12:100851789-100851811 GAGACCTGTGGGGGGAGGGGAGG + Intronic
1101466048 12:104950369-104950391 GAGAGAAGTGTGAGGAGTGAAGG - Intronic
1102180483 12:110909040-110909062 GACAACAGTGGGAGGAGCTCAGG - Intergenic
1102931149 12:116863319-116863341 CTGACCAGTGGGAGGGGAGCTGG - Intronic
1104648896 12:130516948-130516970 GAGAGGAGGGGGAGGAGAGCTGG + Intronic
1104915728 12:132263499-132263521 GAGCCCAGGGGGAGGGGGGCAGG + Intronic
1104985476 12:132594175-132594197 GAGACCAATGGGAACAGAGCAGG + Intergenic
1106247334 13:27961137-27961159 GAAGCCAGAGGGAGGAGTGCGGG - Intergenic
1106256931 13:28030628-28030650 GAGACAAGCGGGAGAATTGCTGG + Intronic
1107021282 13:35755067-35755089 AAGATCAGTTGGAGGAGTGGGGG - Intergenic
1107353083 13:39536606-39536628 GAGACCTGTGGAAGGAGAGAAGG - Intronic
1108117706 13:47147666-47147688 CAGGCCTGTGGGATGAGTGCAGG + Intergenic
1109199109 13:59411142-59411164 GAGACATGTGGGAGTGGTGCAGG + Intergenic
1111814576 13:93134712-93134734 GAGACAAGTGAGAGAATTGCTGG + Intergenic
1113448963 13:110392453-110392475 GAGGGCAGTGGGAGGAGAGACGG + Intronic
1113515265 13:110890389-110890411 GAAACGAGTGGTGGGAGTGCAGG + Intronic
1115700995 14:35952859-35952881 GAGACCACAGGGAGGAGGGAAGG + Intergenic
1116660119 14:47699453-47699475 GAGCCCAGTGGGAGGTGTGTGGG + Intergenic
1117097109 14:52310184-52310206 GAGACCTGGTGGAGGAGTCCTGG - Intergenic
1117376496 14:55122861-55122883 GAGAGCAGAGGGAGGAGGCCAGG - Intergenic
1117571728 14:57055609-57055631 GACACCAGAGGGAGGTGTGAAGG + Intergenic
1118481829 14:66175078-66175100 CAGATCAGTGGATGGAGTGCAGG - Intergenic
1118485162 14:66207575-66207597 GAGAGAAGTGCGAGGAGTGAAGG - Intergenic
1118734499 14:68691762-68691784 GAGACCAGGAGGAGCAGTGTGGG - Intronic
1119072844 14:71605745-71605767 GAGTCCAGTGGTAGCAGTGTTGG + Intronic
1122736852 14:103848043-103848065 GAGGCCAGTGGGAGGGGCGCGGG + Intergenic
1122810315 14:104284503-104284525 GACACCTGAGGGAGGGGTGCAGG + Intergenic
1123983455 15:25623807-25623829 GAGGCCAGGGGGATGAGTCCTGG - Intergenic
1124023707 15:25945667-25945689 GTGAGCAGTGGGCGGAGGGCAGG + Intergenic
1125935668 15:43633431-43633453 GTGAGCAGGGGGAAGAGTGCTGG - Intronic
1125948439 15:43729895-43729917 GTGAGCAGGGGGAAGAGTGCTGG - Intergenic
1126405469 15:48318298-48318320 GAGACCAGAGGGAGAAGGGCGGG - Intergenic
1126517953 15:49556823-49556845 GAGGCCAGAGGGATTAGTGCGGG - Intronic
1127836517 15:62795088-62795110 GAGAGCAGGGGGAGGTGTCCGGG + Intronic
1128234163 15:66056151-66056173 CATTCCAGTGGGAGAAGTGCTGG + Intronic
1128256754 15:66202554-66202576 GAGGCCAGAGGCAGGTGTGCTGG - Intronic
1128329296 15:66745299-66745321 GGGACCTGGGGTAGGAGTGCGGG - Intronic
1128356481 15:66931024-66931046 AAGAACAGTGGGAGGAGGCCTGG + Intergenic
1128657680 15:69474431-69474453 GAGACCCGTGGAGGCAGTGCAGG + Intergenic
1129852437 15:78801320-78801342 GAGGCCAGTGGGTGGAGTGGAGG - Intronic
1130250546 15:82297756-82297778 GAGGCCAGTGGGCGGAGTGGAGG + Intergenic
1131455218 15:92578385-92578407 GAGGCCAGTGAGAGGAGGACTGG - Intergenic
1132531746 16:454339-454361 GAGGTCAGTTGGAGGATTGCTGG + Intronic
1133305107 16:4803685-4803707 AAGACGAGTGGGGGGAGGGCAGG - Exonic
1135912324 16:26572463-26572485 GAGCCCACTGGGAGGTGTCCCGG + Intergenic
1136068383 16:27773825-27773847 GATAACAATGGGAGGAGTGGGGG - Intronic
1136504141 16:30692048-30692070 GACAGCAGTGGCTGGAGTGCAGG + Intergenic
1137540836 16:49360508-49360530 CAGACCAGGGGGACCAGTGCAGG - Intergenic
1137744431 16:50810353-50810375 ATGACGAGTGGGAGGAGGGCAGG + Intergenic
1140254352 16:73322129-73322151 GAGAGCAGAGGGAGGAAGGCTGG + Intergenic
1140510516 16:75504190-75504212 GGGACCACTGGCTGGAGTGCTGG + Intergenic
1140516279 16:75544506-75544528 GGGACAAGTGGCTGGAGTGCGGG + Intronic
1142025102 16:87808380-87808402 GAGAACAGTGGGAGGTGAGATGG - Intergenic
1142114174 16:88347855-88347877 GAGTCCTGTGAGAGGTGTGCAGG + Intergenic
1142743108 17:1942045-1942067 GAGGCTGGTGGGAGGGGTGCAGG - Intronic
1142759325 17:2034181-2034203 GTGATCAGTGGGAGGTCTGCCGG + Intronic
1143382728 17:6506709-6506731 GAGACTTGAGGGATGAGTGCAGG + Intronic
1143780292 17:9225646-9225668 GTGACCAGTAGGGGGAGGGCAGG + Intronic
1143989172 17:10942181-10942203 GAGACCAGGGGGAAGAGAGAGGG + Intergenic
1144875095 17:18393402-18393424 GAGCCCAGCGGGAGCAGTTCAGG + Intergenic
1145157129 17:20551019-20551041 GAGCCCAGCGGGAGCAGTTCAGG - Intergenic
1147574827 17:41593174-41593196 GAGAGGAGAGGGAGGGGTGCAGG - Intergenic
1147862322 17:43530819-43530841 GAGTGCAGTGGGGGGAGGGCGGG - Intronic
1148074189 17:44926255-44926277 GAGACAGGTGGGAGGTGGGCTGG - Intronic
1148204580 17:45771826-45771848 GGGCCCAGTGTGAGGTGTGCAGG + Intergenic
1148792754 17:50182952-50182974 GAGACCTTAGGGAGGAGTGCGGG + Intergenic
1150017443 17:61572685-61572707 GATTGCAGTGGGAGGATTGCTGG - Intergenic
1150290652 17:63979628-63979650 GAGGCAAGTGGAAGGAGAGCGGG - Intergenic
1151416982 17:73972993-73973015 GAGACGTGCGGGAGGAATGCAGG - Intergenic
1152570266 17:81118599-81118621 GAGTCCAGTGACAGGAGTGGGGG - Intronic
1152722586 17:81930154-81930176 GAGACCAGGGAGAGCAGGGCTGG - Intergenic
1152871079 17:82753225-82753247 GGGCCTTGTGGGAGGAGTGCGGG + Intronic
1152930985 17:83109760-83109782 GTGGCCAGTGGGAGGCCTGCTGG - Intergenic
1153972310 18:10237817-10237839 CAGACCAGGAGGCGGAGTGCAGG + Intergenic
1154287242 18:13070789-13070811 GAGACATTTGGGAGGAGTGGAGG - Intronic
1157822169 18:50780287-50780309 GAGTGCAGTGGCAGGAGTCCAGG + Intergenic
1157824737 18:50802546-50802568 TAAACCAGAGGGAGGAGGGCTGG + Intronic
1158122198 18:54060849-54060871 TAGATGAGTGGGAGGAGTGTCGG - Intergenic
1158490669 18:57906961-57906983 GATACCTGTGGGAGGAGTGAGGG + Intergenic
1158810155 18:61022788-61022810 GAAATCAGTGTGGGGAGTGCAGG + Intergenic
1158995504 18:62914535-62914557 GGGTACAGTGGGAGGACTGCTGG - Intronic
1159154211 18:64561550-64561572 GCTGCCAGTGGGAGGAGTGGAGG - Intergenic
1160560736 18:79754350-79754372 GATGCCAGTGGGAGGACGGCAGG - Exonic
1160810868 19:1012399-1012421 GAGACCCGAGGGAGGAGGGGAGG + Intronic
1161105497 19:2441775-2441797 GAGACCTGAAGGAGCAGTGCTGG + Intronic
1161479222 19:4502370-4502392 AAGGCCAGTGGCAGGAGAGCTGG + Exonic
1161805545 19:6441234-6441256 GAATCCAGTGGGTGGAGTGAGGG + Exonic
1161846986 19:6717359-6717381 GAGACCCCAGGGAGCAGTGCAGG - Intronic
1161993410 19:7698286-7698308 GAGAGGAGCGGGATGAGTGCTGG + Intronic
1162273904 19:9638113-9638135 GAGTACAGTTGGAGGAGTGTGGG + Intronic
1163715546 19:18870356-18870378 GGGACCAGTGGGCTGAGGGCGGG + Exonic
1163778046 19:19229390-19229412 GAGACCAGAGGGAGGAGGCATGG + Intronic
1164486852 19:28665499-28665521 GAGACCAGTAGTGGGATTGCTGG - Intergenic
1165096687 19:33413523-33413545 GTGACCAGTGGGAGGAGGTAGGG - Intronic
1165459861 19:35937849-35937871 GAGCCCAGAGAGAGGAGTGGTGG - Intronic
1165481513 19:36067254-36067276 CAGTCCAGTGGAATGAGTGCTGG + Intronic
1166342456 19:42146926-42146948 GACTGCAGTGGGAGGAGTGGAGG - Intronic
1166394791 19:42431274-42431296 CAGACCAGTGAGAGGAGGGCAGG - Intronic
1166746185 19:45142924-45142946 GAGTGCAGTGGGAGGAGCTCTGG + Intronic
1167740540 19:51322530-51322552 GAGACCAGGGTGAGGAGAGGTGG - Intronic
1168708007 19:58480554-58480576 GTTACCCGTGTGAGGAGTGCGGG + Exonic
925856499 2:8134442-8134464 GACACCAGTGGGTGGGGTGGTGG - Intergenic
926215104 2:10901448-10901470 AAGAGCAGGGGGAGGAGAGCGGG - Intergenic
926231336 2:11006309-11006331 GAGCCCAGTGAGATGTGTGCTGG + Intergenic
926695188 2:15766024-15766046 GAGAGCAGTGGGAGGAGGAGAGG + Intergenic
927037328 2:19192129-19192151 GGGACCAGAGGAAGGAGCGCAGG - Intergenic
927907926 2:26875339-26875361 GAGCACAGTGGTGGGAGTGCAGG + Intronic
928337717 2:30412379-30412401 GAGACGTGAGGGAGGATTGCAGG - Intergenic
929243461 2:39676504-39676526 GAGACCGGTGGGAAGTCTGCAGG - Intronic
929466835 2:42152766-42152788 GAGAGAAGTGTGAGGAGTGAAGG + Intergenic
929745435 2:44652714-44652736 GGGTCTAGTGGGAGGAGTGTGGG + Intronic
931011360 2:57918290-57918312 GAGACCAGAAGGAGGAGAGGGGG + Intronic
931417267 2:62092868-62092890 AAGACCAGTGGGAGGGGTTTTGG + Intronic
931430942 2:62208615-62208637 GGGACCAGAGGGAGGGATGCTGG + Intronic
931880322 2:66562256-66562278 GAGACCAGGGAAAGGAGTGGAGG + Intronic
932082388 2:68726796-68726818 GAGCCCAGTGGATGGGGTGCAGG - Intronic
935673686 2:105576292-105576314 GTGAGCAGGGGGAGGAGGGCTGG + Intergenic
935856647 2:107281963-107281985 GACAGCAGTGTGAGGAATGCAGG - Intergenic
935946168 2:108288645-108288667 GAGGCCAGTGGGAGGAGGGAGGG + Exonic
935973622 2:108555815-108555837 GAGCCCACTGGCTGGAGTGCTGG + Intronic
937876278 2:126827743-126827765 CAGCCCAGTGGGAGCTGTGCTGG + Intergenic
937917210 2:127105230-127105252 GACACCAGTGGGAAGGGGGCAGG + Intronic
938313435 2:130310017-130310039 GAAGCCAGTGAGAGGAGTGTGGG - Intergenic
939150664 2:138468788-138468810 GAGACCAGAGCTAGGAGTACTGG - Intergenic
940763230 2:157761455-157761477 GAGACTAGTGAGAGCAGTGGTGG - Intronic
940903222 2:159145906-159145928 AATACCAGTGGGATGAGGGCTGG - Intronic
941287421 2:163631510-163631532 GAGAGAAGTGGGAGGGGAGCTGG - Intronic
941471483 2:165893841-165893863 GAGAACAGTGTGGGGAGTGTTGG + Intronic
945039873 2:205734661-205734683 GAGAAAAGTGGCAGGAATGCAGG - Intronic
945507518 2:210659506-210659528 GAGACTAGTGGGAGGTGTTTGGG - Intronic
946431131 2:219627882-219627904 GAGCCCTGGGGGAGGAGGGCGGG - Intronic
947651506 2:231790288-231790310 TAGGCCAGTGGGAGAAGTGTTGG + Intronic
948107706 2:235428379-235428401 GGGACCAGTGGGAGTGCTGCTGG - Intergenic
948698782 2:239747767-239747789 GAGACAAGGGGGAAGAGTCCGGG + Intergenic
948864162 2:240767069-240767091 GAGGCCAGTGGGTGGCGTCCTGG - Intronic
1169557834 20:6768512-6768534 GCGAGCAGGGGGAGGAGTGCGGG - Exonic
1172173706 20:32959996-32960018 GGGAGCACAGGGAGGAGTGCAGG + Intronic
1172759831 20:37314249-37314271 TCCACCAGTGGGAGGAGGGCCGG + Intronic
1173456935 20:43210245-43210267 GAGAAGAGTGGGATGAGTACGGG + Intergenic
1173993967 20:47323753-47323775 GAGTGCAGTTGGAGGAGTCCTGG - Intronic
1174375417 20:50123645-50123667 GAGACCTGGGGGAGGAGAGGAGG - Intronic
1176159959 20:63642803-63642825 GTGACCCCTGGGAGGAGAGCGGG + Intronic
1177060182 21:16363180-16363202 GAGACCACAGGGAACAGTGCTGG - Intergenic
1177273614 21:18878179-18878201 GAGAACCGTAGGAGAAGTGCGGG + Intergenic
1178068781 21:28937192-28937214 GCCACCAGTGGGAGCACTGCAGG + Intronic
1178495187 21:33080422-33080444 GAAACTAGGGGGAGGAGAGCAGG - Intergenic
1179200007 21:39208402-39208424 GAGACCAGAGGCAGTAATGCAGG + Intronic
1179413408 21:41179257-41179279 GAGTCCAGGGTGAGGAGTGAGGG + Intronic
1179731156 21:43368011-43368033 GGGATGACTGGGAGGAGTGCTGG + Intergenic
1180163260 21:46007314-46007336 CAGTCCAGTGGGAGGTGTGGGGG - Intergenic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181436377 22:22913669-22913691 GAGACCAGGTTGAGGGGTGCAGG + Intergenic
1182066041 22:27432377-27432399 GTGCCCAGTGGGAAGAGTGATGG - Intergenic
1184334898 22:43847428-43847450 GAGACCAGTGGGAGGAGTGCTGG - Intronic
1184835210 22:47016905-47016927 GAGAGCAGTGGGAGGCTCGCCGG - Intronic
1185294172 22:50045280-50045302 GGGACCAGAGGGAGGAGGCCGGG - Exonic
1185318608 22:50190019-50190041 CAGACTAGAGGGAGGAGGGCTGG + Intronic
950367803 3:12500534-12500556 GAGAGCAGAGGCAGCAGTGCAGG - Intronic
950714518 3:14838191-14838213 GAAAACAGGGGAAGGAGTGCAGG - Intronic
954036974 3:47856093-47856115 GAGACCAAGGGGAAGGGTGCGGG + Intronic
954536170 3:51360993-51361015 GAGCCAAGTGGCTGGAGTGCCGG + Intronic
954628035 3:52033378-52033400 GAGAGCAGGGAGAGGGGTGCAGG - Intergenic
954637474 3:52079039-52079061 GGGAGCTGTGGGAGGAGGGCAGG + Intronic
955305767 3:57829835-57829857 GAGAGCTGTGGGAGGGGTGAAGG + Intronic
960437729 3:117647671-117647693 GAGGCCTGAGGGAGCAGTGCTGG - Intergenic
960682412 3:120263119-120263141 AAGAGCAGGGGGAGGAGTGGTGG + Intronic
961506893 3:127375953-127375975 GAGAGCAAAGGGAGGAGTCCAGG + Intergenic
962403396 3:135080328-135080350 GAGAGAAGGGGGAGGGGTGCAGG + Intronic
962957356 3:140278485-140278507 GAGGCCAGAAGGAGGAGGGCTGG - Intronic
963700218 3:148616950-148616972 GGGACCTGTTGGAGGAGGGCGGG - Intergenic
964627291 3:158771875-158771897 GAGACCAGAGTAAGGTGTGCTGG - Intronic
965321010 3:167251114-167251136 CAGAGCAGTTGGAGGAGAGCTGG + Intronic
967866878 3:194197581-194197603 GAGACTAGTGGTAGGAATGCTGG - Intergenic
968948321 4:3677135-3677157 GAGAGCAGCGGGAGGAGCCCGGG + Intergenic
969311589 4:6356087-6356109 GAGACCAGAGGAAGCAGTGTAGG - Intronic
969513503 4:7633143-7633165 GTCACCAGTGGCAGGAGTGGGGG + Intronic
969859074 4:10021507-10021529 GAGTCCACTGGAAGGAGGGCGGG + Intronic
969917191 4:10502304-10502326 GAGAGCAGAGTGAGGAGTGAAGG + Intronic
970855320 4:20644492-20644514 GAATGCAATGGGAGGAGTGCGGG + Intergenic
971192241 4:24438442-24438464 GACACAAGTGGGAGGATTGATGG - Intergenic
973547985 4:52001363-52001385 GAAAACAGAGGCAGGAGTGCAGG + Intronic
974996403 4:69165025-69165047 GCGACCACTGTGAGAAGTGCAGG - Intronic
978318187 4:107463608-107463630 GAGAGAAGTGCGAGGAGTGAAGG + Intergenic
980876581 4:138667780-138667802 GGGCCCAGTGGGAGGTGTTCGGG + Intergenic
982255169 4:153444411-153444433 GAGGCCAGTGTGACTAGTGCAGG - Intergenic
983632155 4:169860154-169860176 GAGGCCGGTGGGAGGGGTGTGGG + Intergenic
984759349 4:183350446-183350468 GAGAGAAGGGGGAGGATTGCTGG - Intergenic
985555756 5:557189-557211 AAGGCCAGTGGGAGGAGCGGCGG + Intergenic
985789247 5:1916388-1916410 GAGCCCAGGGGGAGCAGTGATGG + Intergenic
988205943 5:28134729-28134751 GAGACCAGAGGAAGGAGTGAAGG - Intergenic
988787590 5:34578995-34579017 GAGAGCAGTGAGGGAAGTGCTGG - Intergenic
988993484 5:36693173-36693195 GAGGCCAGTGGGAGGGGGTCTGG - Intergenic
989268076 5:39500497-39500519 GACACCAGTGGAAGGAGAGAGGG - Intergenic
992792943 5:80230039-80230061 CTGAGCAGTGGGAGGAGAGCTGG - Intronic
992962765 5:81972230-81972252 GGGGCCAGGGGGAGGAGAGCTGG - Exonic
993502766 5:88680759-88680781 GAGACCCCTGGGAGGACTGTAGG + Intergenic
994572912 5:101536598-101536620 GAGAGCTGTGGGAGGAGCACAGG + Intergenic
995360465 5:111290741-111290763 GTGAGAAGTGGGAGAAGTGCTGG + Intronic
995686456 5:114777608-114777630 GAGCCGAGTGGGAGGTGTACGGG - Intergenic
997382296 5:133446541-133446563 GAGAACACTTGGAGGAGTGGGGG - Intronic
997707704 5:135973995-135974017 GAGACAAGTGGAGGAAGTGCTGG + Intergenic
998077196 5:139246468-139246490 GTCACTAGAGGGAGGAGTGCTGG - Intronic
1000412749 5:160950604-160950626 GAGACCTGTGGGAAGAGAGGAGG + Intergenic
1000493518 5:161947143-161947165 GAGCCCAGTGGGAGGTTTTCAGG - Intergenic
1001656241 5:173352608-173352630 GAGGCCTGAGGGAGGTGTGCAGG + Intergenic
1001777334 5:174338453-174338475 GAGAACAGGGAGAGGAGTGTGGG - Intergenic
1001921306 5:175602083-175602105 GAGACATGTGGGAGTGGTGCAGG + Intergenic
1002210618 5:177596809-177596831 GAGGCCAGAGGGAGGGGGGCAGG - Intergenic
1004015247 6:11726338-11726360 GAGCCTAGTGGGAGGTGTTCGGG + Intronic
1004438477 6:15621876-15621898 GAGCCCTGTGGGAGGAGGGCGGG - Intronic
1005283782 6:24302777-24302799 AAGAACTGTGGGAGGAGTGGAGG - Intronic
1005466865 6:26124282-26124304 GAGACCAGCGCGAGAAGAGCGGG - Exonic
1006174559 6:32114163-32114185 GAGGGCAGTGGGAGGGGTGTGGG + Intronic
1007736556 6:43985691-43985713 GAGACCTCAGGGAGGAGTGTGGG - Intergenic
1008032606 6:46713930-46713952 CAGGCCAATGGAAGGAGTGCTGG - Intronic
1010958552 6:82119277-82119299 GAGACCCTTGGGAGGAGTACAGG - Intergenic
1011245985 6:85321911-85321933 CAGACCACTGGCAGGAGAGCTGG - Intergenic
1014310958 6:119800954-119800976 GAGATGAGAGGGTGGAGTGCGGG + Intergenic
1014787511 6:125635211-125635233 GAGAGCTGTGGGAGAGGTGCTGG + Intergenic
1014926288 6:127274883-127274905 GAGTCCAGTGGTATGACTGCAGG - Intronic
1015388468 6:132652966-132652988 CAGAGTAGTGGGTGGAGTGCGGG + Intergenic
1015821604 6:137267041-137267063 GGGTGCAGTGGGAGGAGTTCAGG - Intergenic
1016460783 6:144278622-144278644 GTGCCCAGAGGGAGGAGTCCCGG + Intergenic
1017516109 6:155156964-155156986 GAGAACTGTGGGAGGAGAGTGGG - Intronic
1017533041 6:155315689-155315711 GGGACCATTGTGAGGAGTACGGG - Intergenic
1019629081 7:2036958-2036980 GGGAGCTGTGGGAGGAGTGCTGG - Intronic
1019698523 7:2461054-2461076 GTGGCCAGGGGGAGGAGAGCTGG + Intergenic
1019712424 7:2523748-2523770 CTGAGCAGTGGGAGGGGTGCTGG + Intronic
1020418485 7:7971181-7971203 TTGACCTGGGGGAGGAGTGCAGG - Intronic
1020796289 7:12681980-12682002 GAGGCAAGTGGGAGTAGTGCTGG - Intergenic
1022644178 7:32215547-32215569 GAGACCAATGGGAGGGAGGCAGG + Intronic
1023931286 7:44708114-44708136 GAGAGCAGAGGGAGGGGTGGTGG - Exonic
1023937705 7:44751039-44751061 GAGACCAGAGGCATGAGTTCGGG + Intronic
1024255695 7:47538394-47538416 AAGGCCAGTGGTAGGAGTACAGG - Intronic
1025196820 7:56940481-56940503 GAGGCCAGTGAGGGGAGTGGTGG + Intergenic
1025675128 7:63636456-63636478 GAGGCCAGTGAGGGGAGTGGTGG - Intergenic
1026078023 7:67191193-67191215 GAGCCCAGTGGGAGGTGTTTGGG - Intronic
1028744272 7:94309608-94309630 AAAACAAGTTGGAGGAGTGCCGG - Intergenic
1029364351 7:100107480-100107502 AGGACCAGAGGGAGCAGTGCTGG + Exonic
1029945546 7:104529069-104529091 AGGACCAGTGGGAGAAGAGCAGG + Intronic
1034423722 7:151002130-151002152 GAGGCCAGAGTGAGGAGGGCAGG + Intronic
1035026834 7:155831721-155831743 GAGTGCAGTGGGAGGAGCGCGGG + Intergenic
1035061557 7:156073255-156073277 GAGACCAGTGGGAGAATTGGAGG + Intergenic
1035315944 7:157997687-157997709 GAGCCTGGGGGGAGGAGTGCAGG + Intronic
1035648510 8:1247058-1247080 GAGATCAGTGTGTGGAGTGATGG + Intergenic
1037711425 8:21358395-21358417 GAGTCCAGTGGAAGGAGGTCTGG - Intergenic
1037735913 8:21566017-21566039 GTGAACAGAGGGTGGAGTGCGGG + Intergenic
1038982647 8:32776553-32776575 GAGAGCAGAGTGAGGAGTGAAGG - Intergenic
1039145806 8:34445477-34445499 TAGACCCGTGAGTGGAGTGCAGG + Intergenic
1039607965 8:38898619-38898641 GACACCAGTGGGAGGAGGCCAGG - Intergenic
1042556683 8:70039284-70039306 GAGAACAGTGACAAGAGTGCAGG + Intergenic
1042751164 8:72159325-72159347 GGGCACAGTGTGAGGAGTGCAGG - Intergenic
1043443415 8:80297137-80297159 GAGGCCAGGGTGCGGAGTGCGGG - Intergenic
1044445051 8:92265592-92265614 GAGACAGGTGAGAGGAGGGCAGG + Intergenic
1048444623 8:134484125-134484147 GAGCCCTGTGGGAGCAATGCAGG - Intronic
1048860300 8:138719891-138719913 GAGCCCTGTGGGTGGAGGGCGGG + Intronic
1049071408 8:140358604-140358626 GAAAGCAGTGGGTGGAGGGCTGG + Intronic
1049151369 8:141037482-141037504 GAGGCCAGGAAGAGGAGTGCAGG - Intergenic
1049534306 8:143171078-143171100 GAGCCCAGTGTGGGGAGAGCCGG - Intergenic
1049604151 8:143521336-143521358 GGTACCAGTGGGTGGAGTGTGGG - Intronic
1051057938 9:13009699-13009721 GAGGCCAGTGGGAGAAATGTAGG + Intergenic
1052989254 9:34509169-34509191 GGGACCAGGGGGTGGAGGGCTGG + Intronic
1053513107 9:38706325-38706347 GGGAGCGGTGGGAAGAGTGCAGG - Intergenic
1054914077 9:70479916-70479938 GAGACCAGCAGGAGGTGAGCAGG - Intergenic
1055694935 9:78873523-78873545 GAGCCCAGTGGGAGGGGTTCAGG + Intergenic
1056371632 9:85960990-85961012 GAGCCAAGTAGGAGGAGTGTGGG + Intronic
1056441537 9:86626965-86626987 GAGACCTGTGGGAGGGGCTCTGG + Intergenic
1056949517 9:91030874-91030896 GAGCCCAGTGGGAGGTGTTTGGG + Intergenic
1057530189 9:95838207-95838229 GAGACTAGTGGGAGTATTGCAGG - Intergenic
1057967275 9:99516507-99516529 GAGACCTGTCAGAGGAGTGGGGG - Intergenic
1058607940 9:106743612-106743634 GAGAACATTGGCAGAAGTGCTGG + Intergenic
1061177499 9:129006548-129006570 GACACCAGTGGCAGGGGAGCTGG - Exonic
1061613068 9:131761406-131761428 GAGGCTGGTGGGAGGATTGCTGG - Intergenic
1061926955 9:133810609-133810631 GAGACCAGCGGGACCAGCGCTGG + Intronic
1062480127 9:136747278-136747300 GAGCCCAGTGGGAAAAGTGACGG + Intronic
1062599512 9:137313599-137313621 GGGCCCAGAGGGAGGAGTGCAGG - Intronic
1189285474 X:39849361-39849383 GAGACCAGAGCGAGGAGCCCAGG + Intergenic
1189515126 X:41705887-41705909 CAGACCACGGGGAGGGGTGCCGG - Intronic
1190517750 X:51242651-51242673 GGGCCCAGTGGGAGGAGTTTGGG - Intergenic
1191652865 X:63560691-63560713 GACGCCAGGGGTAGGAGTGCGGG - Intergenic
1192154443 X:68733316-68733338 GGGACCAGTGGGAGGAGGAAAGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1198004849 X:132482530-132482552 GAGACCAGTATGAGCAGTGAAGG - Intronic
1198234552 X:134724899-134724921 GAGACAGGTGGGAGGATCGCTGG + Intronic
1198426783 X:136528755-136528777 GGAACCAGTGGGAGAAGAGCTGG - Intergenic
1199000660 X:142632628-142632650 CAGCACAGTTGGAGGAGTGCAGG + Intergenic