ID: 1184339305

View in Genome Browser
Species Human (GRCh38)
Location 22:43877278-43877300
Sequence GCTCACAGGAGGCCCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184339301_1184339305 -6 Left 1184339301 22:43877261-43877283 CCGGGGGCTGATGTGAGGCTCAC No data
Right 1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG No data
1184339295_1184339305 11 Left 1184339295 22:43877244-43877266 CCTGGACTACTCTCCACCCGGGG No data
Right 1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG No data
1184339299_1184339305 -2 Left 1184339299 22:43877257-43877279 CCACCCGGGGGCTGATGTGAGGC No data
Right 1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG No data
1184339300_1184339305 -5 Left 1184339300 22:43877260-43877282 CCCGGGGGCTGATGTGAGGCTCA No data
Right 1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184339305 Original CRISPR GCTCACAGGAGGCCCCCAGT GGG Intergenic
No off target data available for this crispr