ID: 1184340722

View in Genome Browser
Species Human (GRCh38)
Location 22:43884438-43884460
Sequence CTTCATCTGCAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184340722_1184340727 15 Left 1184340722 22:43884438-43884460 CCCTCCACCTTCTGCAGATGAAG 0: 1
1: 0
2: 1
3: 35
4: 378
Right 1184340727 22:43884476-43884498 AGCCCCCACCACAGGCCAGCAGG 0: 1
1: 0
2: 5
3: 44
4: 524
1184340722_1184340726 7 Left 1184340722 22:43884438-43884460 CCCTCCACCTTCTGCAGATGAAG 0: 1
1: 0
2: 1
3: 35
4: 378
Right 1184340726 22:43884468-43884490 ACTGAGCAAGCCCCCACCACAGG 0: 1
1: 1
2: 2
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184340722 Original CRISPR CTTCATCTGCAGAAGGTGGA GGG (reversed) Intronic
900508275 1:3041613-3041635 CTCCATCTGCAAAAAGTGGTAGG + Intergenic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
901377440 1:8849334-8849356 CTGCACCTGCAGAAGGTTGGGGG + Intergenic
901870951 1:12138977-12138999 CTGCTTCTGCAGAGGGTGGGTGG - Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904464779 1:30701322-30701344 CTCCATCTTCAGGAGGAGGAAGG - Intergenic
904475646 1:30763084-30763106 CTGCATTTACAGAAGGTCGAAGG - Intergenic
904834181 1:33324346-33324368 CTCCACCTGCAGAGGGTGTAGGG + Exonic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905619056 1:39425355-39425377 GTTCATCTGCAGCTGGGGGATGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906533009 1:46534133-46534155 CTTCATCTGAATAAGGGGGTGGG - Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
908439662 1:64141303-64141325 CAGCTTCTGCAGAAGGTGAACGG + Intronic
910432083 1:87168648-87168670 ATTCAACTGCAAAGGGTGGATGG - Exonic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
912672970 1:111648575-111648597 CTCCATCTGCAGGAAGTAGAGGG + Intronic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
915456342 1:156043360-156043382 CTTCATCTCCAGGATGAGGAAGG - Intronic
915493705 1:156266375-156266397 GTTCATCTGCGGAAAGAGGAAGG + Exonic
916524569 1:165597666-165597688 CTACTTCCTCAGAAGGTGGAAGG + Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
921005751 1:211091726-211091748 CTTCATCCACAGAAGGAGGTAGG + Intronic
922417825 1:225437902-225437924 CTCCATGGCCAGAAGGTGGAAGG - Intergenic
923146787 1:231203873-231203895 CTCCAGCTGCAGTAGGGGGACGG - Exonic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1063719410 10:8564697-8564719 CATCTTCTCCACAAGGTGGAAGG + Intergenic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1064893104 10:20202383-20202405 TTTCACCTGCATCAGGTGGATGG - Intronic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1068710796 10:60131727-60131749 GTTGATGTGCAGAAGGTGGGTGG + Intronic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1069587696 10:69619505-69619527 CTGCATCTTCACATGGTGGAAGG + Intergenic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072589921 10:96819843-96819865 CTGCATCTTCACATGGTGGAAGG + Intergenic
1072756751 10:98026633-98026655 CTTCATCTTCAGCGGGAGGAGGG - Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1077253566 11:1571277-1571299 CTGCCTCTGCAGCAGGCGGAAGG + Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079237864 11:18702415-18702437 TTTCATCTGCACAAAGTTGAGGG + Exonic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1084641292 11:70427805-70427827 TTTCATCTGCAGAAGCTGAGTGG + Intronic
1084735287 11:71101539-71101561 CTCCATCTGCAGAGGGTGAGAGG - Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086485729 11:87299309-87299331 CTTCTTCTTCACAAGGTGGCAGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087377969 11:97367967-97367989 CTTCATCTGCAGGGGGTAGATGG - Intergenic
1089026300 11:115274082-115274104 CTTTACCTGCAGAAGTTGGCTGG - Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1089905611 11:122035147-122035169 GTTCAACTGAAGAAGGTTGAAGG + Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090383277 11:126341862-126341884 GCTCATCTGCAGAAGGTCTAAGG + Intronic
1090385231 11:126354656-126354678 CTGCTTCTGCTGAAGCTGGAGGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091345998 11:134854602-134854624 CTCCATGTGCAGAATGTGCAGGG + Intergenic
1091888446 12:4033105-4033127 TTTCATCTGCAGCAGGATGAGGG + Intergenic
1092293348 12:7178737-7178759 CTGCATCTTCACATGGTGGAAGG - Intergenic
1092838374 12:12514364-12514386 CTGCATCTGCAGAAGGTTTCAGG - Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098203050 12:68077476-68077498 CTTAAGCTGAAGAAGATGGAAGG + Intergenic
1099790941 12:87332651-87332673 CTTCATCTTCACATGGTGGAAGG - Intergenic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1100843989 12:98641224-98641246 CTTCATCTGATTAAGTTGGAGGG - Intronic
1101015449 12:100495863-100495885 CTTCATGTGCGTAGGGTGGAAGG + Intronic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102516556 12:113452617-113452639 CTTCATCTGAAGTATGTGGGTGG - Intergenic
1103301150 12:119927426-119927448 CTGCATCCTCAGACGGTGGAAGG - Intergenic
1103717239 12:122952022-122952044 CTCACGCTGCAGAAGGTGGAAGG - Intronic
1103870883 12:124090728-124090750 ATTCAGCTGCAGAAAGTGAATGG + Intronic
1105019687 12:132807883-132807905 CAGCATCTGCAGCAGGTGGTGGG - Exonic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1105370903 13:19801107-19801129 CTTCATATGCACAAGGCAGAAGG - Intergenic
1105597699 13:21854909-21854931 TTTCCTCTGCAAAAGGTTGAAGG - Intergenic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1106462224 13:29981169-29981191 CTGCAGCTGCAGAGGCTGGATGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108790162 13:53960549-53960571 CTGCATCAGCACATGGTGGAAGG + Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1112251470 13:97784471-97784493 CTTCATCCTCACATGGTGGAAGG - Intergenic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1113161348 13:107384982-107385004 CTCCATCTACAGAAAGTGGGTGG + Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1122037140 14:98957140-98957162 GTTCATCTGCAGATTGTGGGGGG + Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122187886 14:100015694-100015716 TTCCAGCTGAAGAAGGTGGAGGG - Intronic
1124375889 15:29128391-29128413 CTCCCTCTGAAGAAGGTGGCTGG - Intronic
1124708478 15:31985103-31985125 CTGCATCTGCAAGAGGTGCAGGG - Intergenic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128177279 15:65566958-65566980 CTTCATCTACACAAGGTGGGAGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1129339200 15:74873756-74873778 CTTCTTCTGCAGAACGTGCTCGG + Intergenic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1131401119 15:92126313-92126335 CTCCCTCTGCAGTAGGTTGAGGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1132355423 15:101168039-101168061 CTTCCTCTTCAGGAGGAGGAGGG + Intergenic
1133345073 16:5064481-5064503 CTTCAGCTGCAGCTGGTGGATGG - Intronic
1133455072 16:5934991-5935013 CTGCATCTGCAGAATATCGAAGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1136077589 16:27827663-27827685 CTTCATCAGAAGAAGGTGTCTGG + Intronic
1140266326 16:73424423-73424445 GTACATATGCAGAAGGTGCAAGG - Intergenic
1140536754 16:75716714-75716736 CCTCCTCTCCAGAAGTTGGAGGG + Intronic
1140857746 16:78992701-78992723 CTTCATATGCATTAGCTGGAAGG + Intronic
1141222836 16:82087800-82087822 GTTCCACAGCAGAAGGTGGAAGG + Intronic
1141443802 16:84045504-84045526 CTGCATCTGCAGCCGGTGGGCGG + Intergenic
1141490188 16:84367675-84367697 CTTCATCATCAGAAGGTGCTGGG - Intergenic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1143232781 17:5371508-5371530 TTTCATATCCAGAAGGTGGTGGG + Intronic
1143608518 17:8004142-8004164 CTCAATCTGCAGCAGGTAGACGG + Exonic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146672620 17:34752171-34752193 CTTCATCATCACAAGGTAGAAGG + Intergenic
1147553893 17:41464198-41464220 CTCCATCTGCAGTTGGGGGAAGG + Exonic
1149123009 17:53192595-53192617 CTTCATTTGCAGTAGTTGAATGG - Intergenic
1149142363 17:53447773-53447795 GGTCATCGGCAGAAGGTGAAGGG + Intergenic
1149357387 17:55855517-55855539 CTACATCCACATAAGGTGGAAGG + Intergenic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1149573587 17:57695456-57695478 CCTCATCTTCAGAAAATGGAGGG - Intergenic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152798979 17:82322365-82322387 CTTCTTCTGCAGGGGGAGGAAGG + Exonic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153517672 18:5919425-5919447 TTTCATCTGCAGAATATTGAAGG - Intergenic
1153851235 18:9097050-9097072 CTTCAGCTGCAGAAGCTGCTAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1155014150 18:21815642-21815664 CTTCATCTCCAAAAGCTGCATGG - Exonic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1162788971 19:13053424-13053446 CTGCAACTGCAGAGGGGGGAAGG + Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1165359593 19:35327913-35327935 CTTCATCTGTAGGATGTGCATGG + Intronic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1166890249 19:45987389-45987411 CTGCATCTGCTGAACGTGGCCGG + Intergenic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
926096424 2:10083755-10083777 CTTCATCTGCAGTAGATGCCTGG - Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
928653112 2:33422584-33422606 CTGCATCTTCACATGGTGGAAGG - Intergenic
928685973 2:33749068-33749090 ATACATGTGCAGAAGGTGCAGGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931736999 2:65204986-65205008 CTGCAGCTGCAGCAGCTGGAGGG - Intergenic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
933314651 2:80701686-80701708 CAACATCTGCAGAAGGTACAAGG - Intergenic
936329534 2:111535852-111535874 CTGCATCTGCTTACGGTGGAAGG + Intergenic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
937941255 2:127287857-127287879 CTTGATCTTCAAATGGTGGATGG - Intronic
940004620 2:148999282-148999304 CTTCATCTACAGAAAGCGGGAGG - Intronic
940129575 2:150365614-150365636 CTTCTTCAGGAGAAGGTGTAAGG - Intergenic
941302815 2:163825427-163825449 CTTCCTCTAGTGAAGGTGGAAGG + Intergenic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941821018 2:169843316-169843338 CTGCATCTTCACATGGTGGAAGG + Intronic
943713831 2:191128015-191128037 GATCATCAACAGAAGGTGGATGG - Intronic
943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG + Intergenic
945753649 2:213819427-213819449 CTTCCTTTTCAGAAGGTAGATGG + Intronic
946559399 2:220896067-220896089 CTTCATATAGAGAAGGTGGTAGG + Intergenic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
947922946 2:233894080-233894102 CTTCATCTTCTGCAGGAGGAAGG + Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1173495718 20:43515754-43515776 CTCTAGCTGCAGAAGCTGGAAGG + Intronic
1173677837 20:44853151-44853173 CTGCATCTTCACATGGTGGAAGG + Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175127160 20:56760910-56760932 CATCAGCTGCCGAAGGAGGAAGG - Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175378887 20:58549023-58549045 CTCCATATGCAGAAGGTCAAGGG - Intergenic
1176064650 20:63188258-63188280 CTCCATCTGCAGCAGGTGCTGGG + Intergenic
1176702619 21:10074281-10074303 CTTCATTTGCAAAAGGTTGTTGG - Intergenic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1178394432 21:32229304-32229326 CTGCATCTGCAGCAGGTGCCAGG + Intergenic
1178441564 21:32602667-32602689 CTGGATCTACATAAGGTGGAGGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179269504 21:39839824-39839846 CTTCATCTACACAAGATGGTGGG + Intergenic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183377909 22:37475740-37475762 CTGCACCTGCAGGAGTTGGAGGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184668473 22:46000823-46000845 CATCATCTGCCCAGGGTGGAAGG - Intergenic
1185034849 22:48468397-48468419 CTGCCTCTGCAGAGGGTGAATGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
950670559 3:14522900-14522922 CTTCATCTGGGGAAGGGGCATGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
953208087 3:40849657-40849679 TTTCATCTCCAGAAGGAGGGAGG + Intergenic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
954428690 3:50457727-50457749 CTTCATATATAAAAGGTGGAGGG - Intronic
954491488 3:50910754-50910776 CTCCATGTGCTGATGGTGGATGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954808309 3:53232789-53232811 CTTCAGCTGGAGCAGGTGGCCGG + Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
955203702 3:56876179-56876201 CTGCATGTGTAAAAGGTGGAAGG + Intronic
956419905 3:69076528-69076550 CTCCATCTGCGGCAGATGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
959619234 3:108382097-108382119 ATTCAGCTGCAGGAGGTTGAAGG - Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961704187 3:128771599-128771621 CTAAATCTGTAAAAGGTGGATGG - Intronic
961766871 3:129218298-129218320 CTTTTTCTGCAGAAGGATGAGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962250939 3:133835790-133835812 CTGCATCCTCACAAGGTGGAAGG - Intronic
962892373 3:139683527-139683549 CTTCAACTGCAGAAGTTGAAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
963101424 3:141609502-141609524 CTTAAGCTGCAGAAGATGGAAGG + Exonic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
966297790 3:178444166-178444188 CTGCATCCCCACAAGGTGGAAGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970559063 4:17265182-17265204 CTGCATCCTCACAAGGTGGAAGG + Intergenic
970859393 4:20684257-20684279 CTGCTCCTGCAGAAGGTGAAGGG + Intergenic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
972110323 4:35550060-35550082 CTTCACCCTCACAAGGTGGAAGG + Intergenic
972284465 4:37635013-37635035 CATCATCTGCATACGGTGGGCGG - Exonic
973208490 4:47587674-47587696 CTGCACCTTCAGATGGTGGAAGG + Intronic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
977726507 4:100302673-100302695 CTCCATCTGCAGTGGGTGGGGGG - Intergenic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
979746376 4:124218596-124218618 TTTACTCTGCAGAAGGTAGAGGG + Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
983836240 4:172389611-172389633 CTGCATCTGAAGAAGGTAGGAGG + Intronic
984863609 4:184261469-184261491 CTTCCTCTGCAGAAGAGGAAAGG - Intergenic
985238699 4:187905709-187905731 CTCCATCTCCACATGGTGGAAGG + Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
988125930 5:27037071-27037093 CTTCTTCTGCAGAATGTAGGAGG + Intronic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988563856 5:32304820-32304842 CTCCATCTGCAGAAGTTGTGTGG + Intronic
989100898 5:37822136-37822158 CTCCTTATCCAGAAGGTGGAAGG + Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
997478172 5:134161076-134161098 CATCATCTTCAGGAGGAGGAGGG + Exonic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997755622 5:136396390-136396412 CATCATCTGCTGTTGGTGGATGG - Intronic
998354704 5:141525282-141525304 CTTCATTTGCAGAAGGTTTGTGG + Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003940614 6:11021791-11021813 TTTCATCTGCACACGGTGGCTGG + Intronic
1004025642 6:11815685-11815707 CTACATCTGTTGAAGGTGGGTGG - Intergenic
1008014817 6:46506538-46506560 CTCCATTTGCAGGAGGTGAATGG + Intergenic
1008367594 6:50700553-50700575 CTGCATCATCATAAGGTGGAGGG - Intergenic
1010575460 6:77524446-77524468 ATACATGTGCAGAAGGTGCAGGG - Intergenic
1010595782 6:77762184-77762206 CTACATCTGCAGAGGGTCCATGG - Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011410710 6:87063098-87063120 CATCATCTTCACAAGGTGGCAGG + Intergenic
1011890721 6:92156206-92156228 CGTCTTCTTCAGAAGGTGGCAGG + Intergenic
1011979381 6:93353535-93353557 CTTTATCTGCAGAAGCATGAGGG - Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1016527693 6:145021167-145021189 GAGCATCTGCAGAAAGTGGAGGG - Intergenic
1016859832 6:148706381-148706403 CTTCATCTGCAGACTGTGCTGGG + Intergenic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020511693 7:9064727-9064749 CTGCATCCTCACAAGGTGGAAGG - Intergenic
1022469653 7:30674474-30674496 GTTCATCTGCACCAGGTGGGTGG - Intronic
1022581300 7:31557613-31557635 CTTCATCAGTAGAACTTGGAGGG + Intronic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1030185514 7:106758080-106758102 CTTCATCTGTAGTAACTGGAGGG - Intergenic
1030362134 7:108606358-108606380 CTTCATCTGCTGAAAGTGGGGGG - Intergenic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1031108073 7:117570153-117570175 CTTCACCTTCATAAGGTGGATGG - Intronic
1031837698 7:126698234-126698256 CTTCTTCTACAGTAAGTGGAAGG + Intronic
1031882400 7:127211709-127211731 CTGCATCTTCACAGGGTGGAAGG - Intronic
1033660906 7:143401372-143401394 CTCCATGTACAGAAGGTTGAAGG + Exonic
1037085957 8:14850848-14850870 CATCTTCTTCAGAAGGTGGCAGG - Intronic
1037387613 8:18360268-18360290 CTTCCTCTGCAGACTTTGGAAGG + Intergenic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1038150594 8:24939935-24939957 TTTAATCTGCTGAAGGTGGGGGG - Intergenic
1038500547 8:28040035-28040057 CCTCTTCTGGAGAAGGTAGATGG - Intronic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1039536179 8:38315496-38315518 CTGCATCTGCAGTAGCTGAAGGG + Exonic
1039571209 8:38587860-38587882 CTGCACCTGCAGAAGATGAAGGG - Intergenic
1039630371 8:39106159-39106181 CTCCATCTGGGGCAGGTGGAGGG - Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1044654253 8:94530984-94531006 CTTCATCATCATCAGGTGGAGGG + Exonic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045022289 8:98054151-98054173 CTTCATCTTCACAAGGCAGAAGG - Intergenic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049414178 8:142487894-142487916 CTCCCTCTGTAGAAGGGGGATGG - Intronic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1049855072 8:144856629-144856651 CTTCACCTGCAGACAGTGGGTGG - Intergenic
1050199228 9:3125392-3125414 ATTCATCTCCACAACGTGGAGGG - Intergenic
1050649567 9:7760736-7760758 CTACATCTGTAGTATGTGGAAGG + Intergenic
1050667257 9:7953649-7953671 CTACATCTTCACAAGGTGGAAGG - Intergenic
1051502134 9:17789392-17789414 CATCATCTAAAGAAGTTGGAGGG + Exonic
1052965876 9:34340342-34340364 ATTCATCTGCAGATTGTGGCAGG + Intronic
1053390924 9:37735535-37735557 CTGTAACTGCAGAGGGTGGAAGG - Exonic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053639815 9:40061064-40061086 CTTCATTTGCAAAAGGTTGTTGG - Intergenic
1053766318 9:41404420-41404442 CTTCATTTGCAAAAGGTTGTTGG + Intergenic
1054320566 9:63657381-63657403 CTTCATTTGCAAAAGGTTGTTGG - Intergenic
1054544934 9:66315576-66315598 CTTCATTTGCAAAAGGTTGTTGG + Intergenic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1061799599 9:133106662-133106684 CGTCTTCTTCAGACGGTGGATGG + Exonic
1061876570 9:133547030-133547052 CTTCGTCTGCAAGAGCTGGAAGG - Exonic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1185717557 X:2354765-2354787 CTTCAGCTGCTTAAGATGGACGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1187683441 X:21792280-21792302 CTTCATCAGCAAATGGTGAATGG + Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1190197043 X:48328707-48328729 CGTCATCTGGGGAATGTGGAGGG + Intergenic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1191074920 X:56442460-56442482 ATGCATATGCAGAAGGTGCAGGG - Intergenic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194098350 X:89671916-89671938 ATACATGTGCAGAACGTGGAGGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1196463260 X:115950274-115950296 TTTCCTCTGCAAAGGGTGGAGGG - Intergenic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198079641 X:133227274-133227296 GTACAGCTACAGAAGGTGGATGG + Intergenic
1198881902 X:141291109-141291131 CTGCATCTTCACATGGTGGAAGG + Intergenic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1200451373 Y:3333294-3333316 ATACATGTGCAGAACGTGGAGGG + Intergenic