ID: 1184341768

View in Genome Browser
Species Human (GRCh38)
Location 22:43890074-43890096
Sequence CTGTGGGTGTGCAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 973
Summary {0: 1, 1: 0, 2: 9, 3: 96, 4: 867}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184341757_1184341768 29 Left 1184341757 22:43890022-43890044 CCAAGGGAAGCAGGGATTGGAGC 0: 1
1: 0
2: 4
3: 39
4: 497
Right 1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 867
1184341761_1184341768 -9 Left 1184341761 22:43890060-43890082 CCCACCTCCTCTTTCTGTGGGTG 0: 1
1: 0
2: 0
3: 38
4: 328
Right 1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 867
1184341758_1184341768 5 Left 1184341758 22:43890046-43890068 CCTCTGTCTTGACACCCACCTCC 0: 1
1: 0
2: 0
3: 37
4: 353
Right 1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 867
1184341762_1184341768 -10 Left 1184341762 22:43890061-43890083 CCACCTCCTCTTTCTGTGGGTGT 0: 1
1: 0
2: 10
3: 45
4: 499
Right 1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184341768 Original CRISPR CTGTGGGTGTGCAGGGAAGG AGG Intronic
900176833 1:1294817-1294839 CTGCAGGTCCGCAGGGAAGGGGG + Intronic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900566582 1:3335164-3335186 CTGGGGCTGTGCAGGGCAGCTGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900934642 1:5757381-5757403 CTGTGGGTGCCCAGAGATGGTGG - Intergenic
901453057 1:9347874-9347896 CTGTGGGTGTGTGTTGAAGGGGG - Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901511418 1:9719849-9719871 CTGGGGGAGGGCAGGGAAGCTGG + Intronic
901540262 1:9910629-9910651 CCGGGGGTGAGCAGGGAAGGCGG + Intergenic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901917445 1:12510845-12510867 CTGTGGGGGTGCAAGGAGGGAGG - Exonic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903140473 1:21335909-21335931 CAGTGGGTCTCCAGGGAGGGAGG + Intronic
903274322 1:22210994-22211016 TGGTGGGTGGGCTGGGAAGGAGG + Intergenic
903279914 1:22244577-22244599 CTCAGGGTGTGCAGAGAAGCAGG - Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903985511 1:27224906-27224928 CTTTGGGTGGCCAAGGAAGGGGG - Intergenic
904163446 1:28537683-28537705 CTCTGGGAGTTCAGGGAAGTTGG - Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904279004 1:29405330-29405352 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
904354551 1:29930660-29930682 CTGGGGGTGGGCAGAGGAGGGGG - Intergenic
904570547 1:31461061-31461083 CTGTGGATGTGAAGGTAAGGAGG + Intergenic
904594520 1:31635127-31635149 CTGTGGGTGTGCAGGCAGCCTGG - Intronic
904840157 1:33367444-33367466 CTGTGGGAGTCCAGAGAATGTGG + Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905166543 1:36086471-36086493 CTGCGGGTGTGTAGGGCACGTGG + Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905747486 1:40430796-40430818 CTCTGGGAGTCCAAGGAAGGTGG + Intergenic
905775510 1:40665263-40665285 ATGTGAGTGTGCAGGGGCGGGGG - Intronic
905971618 1:42146076-42146098 GTGTGGGTGGGCTGGGAGGGAGG - Intergenic
906077738 1:43064447-43064469 CTGTGGGAGGCCAAGGAAGGAGG - Intergenic
906103029 1:43275204-43275226 ATGTGTGTGTGCATGGCAGGGGG - Intergenic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
906642952 1:47452459-47452481 CCATGGGAGTGCAGGGATGGTGG - Intergenic
907268859 1:53278698-53278720 TTGTGCATGTGCAGGGAGGGTGG + Intronic
907751725 1:57269480-57269502 CTGTGAGTGGCCAGGGAGGGGGG - Intronic
907931049 1:59000499-59000521 CTGTGGAGGTGCAGGCAAGGTGG - Intergenic
907946182 1:59138657-59138679 CTGTGGATGTGCAGAGTTGGAGG + Intergenic
908040597 1:60108359-60108381 TTGTGAGTGTGAAGTGAAGGAGG - Intergenic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908094331 1:60721372-60721394 CTGAGGTTGTGCAGGGCAGTGGG - Intergenic
908802231 1:67892127-67892149 CTGTGTGTGTGCAGGGTCAGGGG - Intergenic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909643926 1:77895618-77895640 CTTTGGGGGTGCAAGGCAGGCGG + Intronic
910652930 1:89589364-89589386 ATGTGGGTGGACATGGAAGGTGG + Intronic
910936331 1:92486316-92486338 CTGTGGGTCGGCAGGGGATGGGG + Intronic
910973860 1:92885198-92885220 CTGTGGTTGCTCAGGGAATGTGG + Intronic
911599508 1:99833188-99833210 CTTTGGGAGGCCAGGGAAGGTGG + Intergenic
912212738 1:107572385-107572407 TTGTGTGTGTGCGGGGGAGGTGG + Exonic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912473898 1:109923871-109923893 CTGTGGCTGAGCAGAGAGGGTGG - Exonic
912552595 1:110493972-110493994 CTGAGTGTGTGCTGGGAAGGGGG - Intergenic
912615694 1:111097501-111097523 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913272714 1:117109805-117109827 CAGTGGGTGAGCTGGAAAGGTGG + Intergenic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
914986681 1:152463821-152463843 GTGTGTGTGTGTAGGAAAGGGGG - Intergenic
915031930 1:152887005-152887027 CTATGGGTCTGCAGGAATGGTGG + Intergenic
915099921 1:153491744-153491766 CTTGGGGTTTGCAGGGAAAGAGG - Intergenic
915421805 1:155788845-155788867 CTTTGGGAGTCCAGGGCAGGTGG + Intronic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915625521 1:157111862-157111884 CTGGGGGAGGGCAGGGGAGGAGG + Intergenic
916065361 1:161132162-161132184 CTGAGGGTGTGAAGGGGAAGGGG - Intronic
916519844 1:165553726-165553748 CTCTGGGACTGCAGAGAAGGAGG + Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
919447510 1:197727290-197727312 CTTTGGGAGGGCAAGGAAGGTGG + Intronic
919618737 1:199840218-199840240 CTTTGGGTGGTCAGGGCAGGTGG + Intergenic
919814063 1:201426690-201426712 CAGGGGGTGGGCAGAGAAGGCGG - Intronic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920053357 1:203176272-203176294 CTGTGGGAGCCCAGGGAATGTGG - Intergenic
920378460 1:205522108-205522130 CTCTGGGTTTTCAGGGCAGGAGG + Intronic
920534842 1:206730762-206730784 CTGTGAGTGTGCTGGGGAGGGGG + Exonic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
921621458 1:217330323-217330345 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
922920285 1:229296001-229296023 CTTTGTGTGTCCAGGGACGGTGG + Intronic
923126913 1:231040721-231040743 CTGGGGGTGAGCCGGGAAGCTGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923386769 1:233472706-233472728 CTTTCACTGTGCAGGGAAGGAGG + Intergenic
924048322 1:240054908-240054930 GGGAGGGGGTGCAGGGAAGGAGG + Intronic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1062902766 10:1158308-1158330 CTGTGGCTGTGCAGGTCACGTGG - Intergenic
1062932182 10:1360640-1360662 CTGTGGGTGTGCATGGGGAGCGG + Intronic
1062992865 10:1836557-1836579 CTGTGGGTGGACGGGGGAGGAGG + Intergenic
1063021550 10:2133990-2134012 CTGTGCGTGTGGGGGGATGGAGG + Intergenic
1063061369 10:2557821-2557843 CTTTGGGTGGGCAAGGCAGGAGG + Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063544008 10:6962310-6962332 CTGTGGTTGGGCAAGGTAGGAGG - Intergenic
1063588482 10:7374017-7374039 CTTTGGGAGGGCAAGGAAGGTGG + Intronic
1063594180 10:7418619-7418641 GTGTGTGTGTGAAGCGAAGGAGG + Intergenic
1063621287 10:7651338-7651360 CTTTGGGAGGGCAGGGCAGGCGG + Intronic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064626576 10:17267304-17267326 CTTTGGGAGGGCAGGGCAGGTGG - Intergenic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1064858333 10:19796718-19796740 CTTTGGGAGGCCAGGGAAGGAGG + Intergenic
1065773482 10:29099144-29099166 GTGTGTGTGTGCAGGTAGGGAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066184639 10:32997513-32997535 TTTTGGGAGTCCAGGGAAGGAGG + Intronic
1066220655 10:33334706-33334728 CTGTGGGTGGGAGGGGGAGGAGG + Exonic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1067068321 10:43115874-43115896 CTGTGGGTTCCCAGGGAATGTGG + Intronic
1067158060 10:43799461-43799483 GTGAGGGTGTGCAGTGCAGGTGG + Intergenic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1067449247 10:46371212-46371234 CTGAGGTCGGGCAGGGAAGGAGG + Intronic
1067588123 10:47489553-47489575 CTGAGGTCGGGCAGGGAAGGAGG - Intronic
1067635248 10:47997644-47997666 CTGAGGTCGGGCAGGGAAGGAGG - Intergenic
1067941123 10:50658381-50658403 CTCTGTGTGGGCAGGCAAGGAGG + Intergenic
1068087761 10:52395877-52395899 CTGTAGGTGTGCACAGAAGAGGG - Intergenic
1068590590 10:58849013-58849035 CTTTGGGAGTACAGAGAAGGAGG - Intergenic
1069605904 10:69738396-69738418 CTGTGGCTGAGCAGGAAGGGAGG + Intergenic
1069676864 10:70254938-70254960 CTGAGGGGGTCCAGGGAGGGCGG - Exonic
1069716713 10:70525891-70525913 AAGAGGGTGTGCAGTGAAGGAGG - Intronic
1069764098 10:70839469-70839491 GTGTGCCTGGGCAGGGAAGGGGG - Intronic
1069966637 10:72123515-72123537 CTGTGCGTGTGCAGGGATGGGGG + Intronic
1071334499 10:84589864-84589886 CTGTGCGGGTGTAGGGAAGGTGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071609866 10:87022387-87022409 CTGAGGTCGGGCAGGGAAGGAGG + Intronic
1071686501 10:87763413-87763435 CTTTGGGAGTCCAGGGCAGGAGG + Intronic
1072205655 10:93203180-93203202 CTGTGCATGTGCTGTGAAGGTGG + Intergenic
1072370353 10:94760151-94760173 GTGTGTGGGTGCAGGGAAAGAGG + Intronic
1072386499 10:94935883-94935905 GTGTGTGGGTGCAGGGAAAGAGG + Intergenic
1072804021 10:98412858-98412880 CTGTGGCTGAGCACGGAAGGAGG + Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073590060 10:104748607-104748629 CTTTGGGAGGCCAGGGAAGGTGG + Intronic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1073789203 10:106922602-106922624 CTGTGTGTGTACAAGGGAGGGGG - Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074978082 10:118596737-118596759 CTGTGGGTGTTCAGTCAAGGAGG - Intergenic
1075079803 10:119375739-119375761 CTGTGGGCATGCCGGGGAGGTGG + Intronic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1075714150 10:124546184-124546206 CTGCTGGTGAGCAGGGTAGGAGG + Intronic
1075902793 10:126056563-126056585 GTGAGGGTTTGCAAGGAAGGTGG + Intronic
1076370932 10:129953168-129953190 GTATGGCTGTGCAGGGTAGGGGG + Intronic
1076538184 10:131196355-131196377 CTGTGCATTTGCAGGGAAGGTGG + Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076859460 10:133133753-133133775 CTGTGGTTGTTCAGGGCAGGCGG + Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077549389 11:3193361-3193383 CTGGCGTTGTGCAGGGAAGGGGG - Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078529719 11:12127615-12127637 CTTTGGGAGCACAGGGAAGGAGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079155842 11:17947317-17947339 TTTTGGATGTGCAGGTAAGGGGG + Intronic
1079610760 11:22430072-22430094 CTGTGGCTGAGCACAGAAGGTGG + Intergenic
1079987950 11:27218052-27218074 CTGTGGCTGTGCATGGCAGCTGG - Intergenic
1080192786 11:29571260-29571282 CTGAGGCTGTGCAGGGTAGTGGG + Intergenic
1080451558 11:32382413-32382435 CTGTTGGTTTCCAGGGATGGAGG - Intergenic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1081796652 11:45825184-45825206 CTCTCGGTGTGCAGAGAGGGAGG - Intergenic
1081991782 11:47341970-47341992 CGGTGAGTGTGCAGGGCAGGTGG - Exonic
1082780474 11:57283830-57283852 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1082960532 11:58914913-58914935 CTGTGGGAGTGCAGTGGATGTGG + Intronic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083536239 11:63469019-63469041 GTGTGGGTGTGCAGAGGATGGGG - Intronic
1083551846 11:63595996-63596018 CTGTGGGAGGCCAAGGAAGGCGG + Intronic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084273365 11:68040334-68040356 CTGCAGGTGGGCAGGGCAGGGGG - Intronic
1084273617 11:68041245-68041267 CTGTGGGTGGACACGGATGGGGG - Intronic
1084518879 11:69650840-69650862 CAGGGGGTGTGCAGGGTGGGCGG + Intronic
1085047698 11:73363039-73363061 CTGTCGGTGAGCAGGGCAGCAGG + Intronic
1085204001 11:74719369-74719391 GTGTGTGTGTACAGGGGAGGGGG - Intronic
1085388128 11:76168758-76168780 CTGTTGGTGAGCAGGGATTGAGG + Intergenic
1085445138 11:76596469-76596491 CTGTTGGGGTGCAGGGAGGGTGG - Intergenic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1086320061 11:85636682-85636704 CTTTGGGAGGCCAGGGAAGGCGG + Intergenic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087327159 11:96738364-96738386 CTGTGGGTGTGCAGCCTATGAGG + Intergenic
1088190719 11:107225528-107225550 GTGTGTGTGTGTATGGAAGGAGG - Intergenic
1089053523 11:115565929-115565951 CTTTGGGAGTCCAGGGTAGGAGG - Intergenic
1089153261 11:116381208-116381230 CTGTGGGTGTACCAGGATGGTGG - Intergenic
1089916911 11:122165758-122165780 GTATGTGTGTGCAGGGAAGTGGG - Intergenic
1089943381 11:122442205-122442227 CTGTGGGTGTGGAAAGAATGGGG - Intergenic
1089958885 11:122598429-122598451 CTGCAGGTTTGCAGGGAACGGGG + Intergenic
1090217635 11:124984003-124984025 CAGTGGCCGTGCAGGGCAGGGGG + Intronic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1090359107 11:126160433-126160455 CTGTGTTTGTGCAGGGGTGGAGG + Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090998694 11:131890001-131890023 CTTTGGGTGGGCTGAGAAGGAGG - Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1091401414 12:182758-182780 CTCTGAGGGTGCAGGGAGGGAGG - Intergenic
1091722089 12:2820898-2820920 GTGTGGGGGTGCATGGAAGCAGG + Intronic
1091748130 12:3005740-3005762 CTTTGGGTGGGCAAGGCAGGCGG - Intronic
1091770382 12:3147494-3147516 CTGGAAGTGGGCAGGGAAGGTGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092046510 12:5434761-5434783 CTGTGTGTGTGAGGGAAAGGTGG + Intronic
1092081633 12:5721176-5721198 ATGTGAGTGTGCATGGTAGGAGG - Intronic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092942594 12:13424168-13424190 GTGTGTGTGTGCAGGTAAGTAGG - Intergenic
1093053501 12:14532088-14532110 CCGTGGGTGAGGAGTGAAGGTGG - Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094137182 12:27140185-27140207 CTGGAGGTGTGCAAGGAAGGCGG + Intergenic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1094360591 12:29626613-29626635 CTTTGGGTGTGCAGTGAAGTAGG - Intronic
1095052087 12:37563426-37563448 CTGTGGGAGGCCAAGGAAGGTGG + Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096526741 12:52214566-52214588 CAGTGGGTGAGCAGGTGAGGTGG - Intergenic
1096532271 12:52249449-52249471 GTGTGTGTGTGCATGGGAGGAGG + Intronic
1096653768 12:53075703-53075725 CAGTGGGTGGGCAGAGCAGGGGG - Intronic
1096722202 12:53531744-53531766 CTGTGGCTGGGCAGGGGATGGGG + Exonic
1096786310 12:54018941-54018963 CTGTGGGGGGGCGGGGATGGGGG + Intronic
1096807484 12:54149305-54149327 CTGGGGGTTGGCTGGGAAGGGGG + Intergenic
1097088233 12:56485506-56485528 CTGTGGGTGGCCAAGGCAGGGGG - Intronic
1097141109 12:56903042-56903064 CTCTGGGGGTCAAGGGAAGGAGG + Intergenic
1097193472 12:57231422-57231444 CTGTGGGAGTCCAGGGGAAGGGG + Intronic
1098559128 12:71852265-71852287 CTGAGGTTGTGCAGGGCAGCAGG + Intronic
1099040463 12:77646706-77646728 TTGGGGGTGTGCAGGATAGGAGG + Intergenic
1100218455 12:92478029-92478051 CACTGGGTCTGCAGGGATGGTGG + Intergenic
1100540300 12:95551228-95551250 ATGAAGGTGGGCAGGGAAGGAGG - Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100728349 12:97434819-97434841 GTGTGTGTGTGCAGGGGAAGGGG - Intergenic
1101119182 12:101561638-101561660 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1101900705 12:108789306-108789328 ATGAGGGTGGGCAGGGAAAGGGG + Intronic
1102011031 12:109618500-109618522 CTGAGGCTGGGCAGGGGAGGTGG - Intergenic
1102146009 12:110655589-110655611 TTCTGGGAGGGCAGGGAAGGTGG - Intronic
1102254447 12:111407443-111407465 CTGTGGGTCTCCAGGGATGCAGG + Intronic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103037511 12:117668290-117668312 CCGTGGGTGGGCTGGGAAGGAGG - Intronic
1103350596 12:120280845-120280867 CTTTGGGAGGTCAGGGAAGGTGG + Intergenic
1103483133 12:121264157-121264179 CTGGGGATGTGACGGGAAGGAGG - Intronic
1103564385 12:121808185-121808207 CTGTAGATGGGCAGGAAAGGGGG - Intronic
1104509674 12:129365939-129365961 GTGTGGGTGTGCGGGGCGGGTGG - Intronic
1104581111 12:130011453-130011475 CTGAGTGTGTGCACGGAGGGTGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104875321 12:132029759-132029781 CTGTGGCTGTACAGGGGTGGCGG - Exonic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1104995565 12:132652565-132652587 CTTTGGGAGTCCAAGGAAGGAGG - Intronic
1105309085 13:19190271-19190293 GGCTGGGTGTGCAGGGATGGAGG + Intergenic
1105420747 13:20249578-20249600 CTTTGGGAGGGCAAGGAAGGAGG - Intergenic
1105528520 13:21197877-21197899 GGCTGGGTGTGCAGGGATGGAGG - Intergenic
1105607315 13:21936898-21936920 GTGTGTGTGTGTAGAGAAGGTGG + Intergenic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1105885081 13:24635073-24635095 CTTTGGGTGACCAGGGCAGGAGG + Intergenic
1105966292 13:25387818-25387840 CTTTGGGAGGGCAGGGTAGGTGG + Intronic
1106087834 13:26558421-26558443 CTCTTGGAGTGCAGGGGAGGAGG + Intronic
1106393313 13:29356556-29356578 ATGTGGGTGGACAGGAAAGGGGG + Intronic
1106641787 13:31592259-31592281 CTGTGGGAGTCCAAGGCAGGCGG + Intergenic
1106913372 13:34486721-34486743 CTGTGTGTGTGCAGGATATGTGG - Intergenic
1107172990 13:37365376-37365398 GTGTGTGTGGGCAGGGCAGGGGG + Intergenic
1109173967 13:59132432-59132454 CTGTAAGTGTACAGGGAAAGAGG - Intergenic
1110411189 13:75205168-75205190 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
1110840137 13:80132834-80132856 ATGTGGGTGTGAGGGGGAGGTGG - Intergenic
1111642096 13:90981486-90981508 GTGTGGGTGTGCTGGAGAGGGGG - Intergenic
1113416058 13:110129602-110129624 GGGTGGGTGTGCAGGGAGTGGGG + Intergenic
1113484432 13:110643907-110643929 CCCTGGCTGTGCAGTGAAGGTGG - Intronic
1113531937 13:111033502-111033524 CAGTGTGTGTACAGGGCAGGGGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114534925 14:23416843-23416865 GTGTGTGTGTGCAGGGCACGGGG - Intronic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118167863 14:63355859-63355881 GTGTGTGTGTGCAGGGAACAGGG - Intergenic
1118177126 14:63451806-63451828 CTGTGCTTGTGCAGGGACAGGGG + Intronic
1118303664 14:64636655-64636677 CTGGTGATGCGCAGGGAAGGAGG + Intergenic
1118693684 14:68363759-68363781 GTGTGTGGGTGCAGTGAAGGTGG + Intronic
1118698417 14:68409000-68409022 CTGGAGGTGGGCAGGGAATGAGG + Intronic
1118866103 14:69704845-69704867 CTGTGTGTGTCCAGGGAGTGGGG + Intronic
1118994329 14:70822678-70822700 AAGTGGGGGTGAAGGGAAGGAGG - Intergenic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119202184 14:72764323-72764345 ATGTGGGGGTGCTGGGAGGGTGG + Intronic
1119288627 14:73476425-73476447 CTGTAGGAGTTCAGGGAAGGGGG - Intergenic
1119527449 14:75333833-75333855 CTGTGGGTGACCTGGGGAGGAGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119642528 14:76325919-76325941 CTGTGGGTGTGCAGCACAGGCGG - Intronic
1119949236 14:78727497-78727519 CTGTGGGAGGCCAGGGCAGGTGG + Intronic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1120104941 14:80483134-80483156 ATGTGGGTTTTTAGGGAAGGTGG - Intronic
1120361919 14:83514903-83514925 CTGTGATTTTGCAGGGAGGGAGG + Intergenic
1120613108 14:86666948-86666970 GTGCAGGTGTGCAGGGATGGTGG - Intergenic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121384802 14:93510168-93510190 CTGAGGTTGTGCAGGGCAGTGGG + Intronic
1121556317 14:94840418-94840440 CTTGGGGTGTGCAGGGAGGTGGG + Intergenic
1121917857 14:97852535-97852557 CTGTGTGTGTGCACAGAAAGGGG - Intergenic
1122324971 14:100876350-100876372 CTGGGGGTGGACAGAGAAGGTGG + Intergenic
1122356285 14:101124806-101124828 GTCTGTGTGTGCTGGGAAGGGGG - Intergenic
1122443975 14:101755760-101755782 CCATCGGTGTGCAGGGAGGGGGG - Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122891728 14:104735142-104735164 CTGTGTGTGAGCAGGAAAGGGGG + Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122917148 14:104864621-104864643 CTGTGGGCGTCCAGGTAAGACGG + Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1202908880 14_GL000194v1_random:98743-98765 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1123824356 15:24066730-24066752 CTGTGTGTGTCCTGTGAAGGGGG + Intergenic
1124409904 15:29428456-29428478 CTTTGGGAGTGCAAGGAGGGTGG - Intronic
1124575402 15:30903693-30903715 CTGCGGGTGGGAAAGGAAGGAGG + Intergenic
1125184841 15:36918640-36918662 CCATGGGTGTGCAGAAAAGGTGG + Intronic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125345166 15:38711934-38711956 AGGGGGGTGGGCAGGGAAGGAGG + Intergenic
1125389191 15:39173151-39173173 ATGTGTGCCTGCAGGGAAGGAGG + Intergenic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1126023784 15:44427101-44427123 CTGTGGGCGCGCTGGGTAGGTGG - Intergenic
1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG + Intergenic
1126815023 15:52446213-52446235 CTGAGGCTGTGCAGGGTAGTGGG - Intronic
1127090390 15:55461006-55461028 CTTTGGGAGGCCAGGGAAGGTGG - Intronic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1127568381 15:60215528-60215550 CACAGGGTGTGCAGAGAAGGTGG + Intergenic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128271148 15:66311118-66311140 CTGTGGGTGGCCAGGGCAGGAGG + Intronic
1128673608 15:69593226-69593248 CTGTGGGTGGTCAGAAAAGGAGG + Intergenic
1129283720 15:74506586-74506608 CTGTGGGAGGCCAGGGCAGGAGG + Intergenic
1129659769 15:77546691-77546713 CTTTGGGAGGGCAAGGAAGGTGG + Intergenic
1129764546 15:78153773-78153795 CTTTGGGTGTCCAAGGCAGGTGG + Intronic
1129998005 15:80023406-80023428 ATGTGGGAGTGCTGGGAGGGAGG - Intergenic
1130006997 15:80109171-80109193 GTGGTGGTGTGCAGGTAAGGTGG + Intronic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130355478 15:83126082-83126104 GTGTGGGGGTGCATGCAAGGTGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1131055478 15:89372052-89372074 AGATGGGTGTGAAGGGAAGGTGG + Intergenic
1131294896 15:91139183-91139205 ATGGTGGTGTGAAGGGAAGGAGG + Intronic
1132255685 15:100373879-100373901 GTGGGGGCGAGCAGGGAAGGAGG + Intergenic
1132320433 15:100920852-100920874 CTGGGGGTGTGAGGAGAAGGAGG - Intronic
1132565230 16:619383-619405 CAGTGTGTGTGCAGGTATGGTGG + Intronic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133306737 16:4814448-4814470 CACTTGGTGTGCAGGGGAGGAGG + Intronic
1133812993 16:9175742-9175764 CTGTGGGAGGCCAGGGTAGGTGG - Intergenic
1133972680 16:10578926-10578948 CTGCTGGTTTGCAGGGAATGAGG - Intronic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134082191 16:11332665-11332687 CTTTGGGAGAGTAGGGAAGGAGG + Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135424323 16:22324789-22324811 ATCTGGGTGTGAAGGGCAGGTGG + Intronic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1135841877 16:25884371-25884393 CTGTGGGTGGACAGCCAAGGTGG - Intronic
1136100943 16:27995583-27995605 TTGTGGTTTTGCAGGGAAAGGGG - Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1138184261 16:54964131-54964153 CAGTGGGTGTGCTGGGGAGTGGG + Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138490382 16:57372923-57372945 GTGTGGGTGTGCCAGGAGGGCGG + Intronic
1139460595 16:67119017-67119039 CTTTGGGAGGGCAGGGCAGGAGG - Intronic
1139643601 16:68311106-68311128 CGCTGGGTATGCTGGGAAGGTGG + Intronic
1139670630 16:68490715-68490737 CTTTGGGAGTGCAAGGCAGGGGG - Intergenic
1140116950 16:72050394-72050416 CTGTGGGTCCTCAGGGAAGTGGG - Intronic
1140258576 16:73357855-73357877 CAGTGGGTGGGCATGGAAAGTGG - Intergenic
1140685297 16:77427777-77427799 CTGTGAGTTGGCAGGGGAGGTGG + Intronic
1141112631 16:81282645-81282667 TGGTGGGTGAGCAGGGATGGGGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141389087 16:83649541-83649563 AAGTTGATGTGCAGGGAAGGAGG + Intronic
1141540168 16:84713946-84713968 CTGGGGGTTGGCTGGGAAGGTGG + Intronic
1141637268 16:85320891-85320913 CTCTGGGTGTTCCGGGCAGGAGG - Intergenic
1141731209 16:85824503-85824525 CTGTGGGTGTGCTGGGCTGGAGG + Intergenic
1141844887 16:86601547-86601569 CTGGGGCTGAGCAGGGCAGGAGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142110333 16:88327693-88327715 CAGTGAGTGTGCACGGAAGGTGG - Intergenic
1142363654 16:89638796-89638818 GTGTGTGTGTGCAGGGGTGGGGG - Intergenic
1142419704 16:89962858-89962880 CTGTGGCTGTGCAGGGCTGGTGG + Intronic
1142741334 17:1933434-1933456 CTCTGGGGGTCCAGGGAAAGTGG + Intergenic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1143137427 17:4719696-4719718 ATGTGGGTGAGCAGGAAAGGAGG + Intronic
1143476395 17:7205881-7205903 AGGTGGGTGTGCTGGGAAGGAGG - Intronic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1143584071 17:7842750-7842772 CTGTGTGTGTTCAGGGAGGCGGG + Intronic
1144131872 17:12254136-12254158 CAGTGGGTGTGCACGTAAGGTGG - Intergenic
1144249435 17:13400717-13400739 ATGGGGGTGAGCAGGAAAGGAGG + Intergenic
1145251923 17:21301463-21301485 GTGTGGGTGAGCAGGGAGGCCGG + Intronic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145310766 17:21700069-21700091 CTGAGGCTGTGCTGGGAAAGGGG - Intronic
1145737072 17:27240449-27240471 CTGTGGGAGTCCAGGGATTGGGG + Intergenic
1145775353 17:27524146-27524168 TTGTGGGAGTCCTGGGAAGGAGG + Intronic
1146453231 17:32991091-32991113 TGGTGGGTGTGCAGGGATGTTGG - Intronic
1146455938 17:33009690-33009712 CTCTTGGTGAGCTGGGAAGGAGG - Intergenic
1146485970 17:33242836-33242858 GGGTTGTTGTGCAGGGAAGGTGG + Intronic
1146723914 17:35142237-35142259 CGGTGGGTGTGCGTGGATGGGGG - Exonic
1147646496 17:42037675-42037697 TTGTGGGTGGGCACAGAAGGTGG - Intronic
1148074265 17:44926549-44926571 CTATGGGTGTGCATTGAAGTGGG + Intronic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1148645816 17:49219297-49219319 CTGTGGCTGTGCAGAGGAAGTGG + Intronic
1148672836 17:49424964-49424986 CTGTGGGAGGCCAAGGAAGGGGG - Intronic
1148721014 17:49753241-49753263 CTGGAGGTGTGCTGGGCAGGTGG + Intronic
1148835124 17:50461884-50461906 GCGTGAGTGTGCAGGGACGGGGG + Intronic
1148848214 17:50541328-50541350 CTGTGGGTGAGCAGGGCAAGGGG + Exonic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1149493942 17:57105309-57105331 CTCTTGGAGGGCAGGGAAGGCGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150161054 17:62898458-62898480 TTGTGGGAGTGCAGGAGAGGTGG + Intergenic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1151915597 17:77115562-77115584 CTGTGGCTGTGAAGGGGTGGAGG + Intronic
1151948384 17:77331772-77331794 CCGTGCCTGTGCGGGGAAGGAGG - Intronic
1151999441 17:77636358-77636380 CGATGCCTGTGCAGGGAAGGAGG + Intergenic
1152059979 17:78065103-78065125 CTTTGGGAGTCCAGGGCAGGAGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152270350 17:79320910-79320932 CTCTGAATGTGCAGGGAAGGTGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152286949 17:79418293-79418315 GGGTGGGTGTGCAAGGAGGGAGG - Intronic
1152355627 17:79805769-79805791 CTGTGGGTGAGATGGGTAGGGGG + Intergenic
1152469281 17:80481949-80481971 CAGTGAGTGGGCAGGGCAGGTGG + Intergenic
1152573424 17:81130240-81130262 CTGGGGGTGGGCAGTGATGGGGG + Intronic
1152599964 17:81257337-81257359 CTGTGGGAGGCCAGGGCAGGAGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152684501 17:81687422-81687444 CACTGGGTGGGCAGGGCAGGTGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153002969 18:473183-473205 CTGTGGGCTTGCGGGGGAGGTGG - Intronic
1153594656 18:6712673-6712695 CTGTGGGAGTCCAAGGCAGGAGG - Intergenic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1155117451 18:22783705-22783727 CTGTGGGTGGGCAGGGGGAGGGG + Intergenic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1157516201 18:48313458-48313480 CTGTTGGGGAGCAGGGGAGGGGG - Intronic
1157570518 18:48709414-48709436 CTGCCTGTGTGCAGGTAAGGAGG + Intronic
1157839271 18:50940707-50940729 CTGTGGGAGTCCAAGGCAGGAGG - Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158395924 18:57078316-57078338 GTGTGTGTGTACAGGGAGGGAGG - Intergenic
1159007329 18:63024534-63024556 CTTGGGGTGTGCTGGGGAGGCGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160491330 18:79338454-79338476 CTTGGGGAGTTCAGGGAAGGTGG - Intronic
1160504252 18:79418124-79418146 CTGTGGGTCTGCAGGGCTCGGGG + Intronic
1160658878 19:289115-289137 CTGAGGGTGGCCAGGGAAGCAGG + Intronic
1160790386 19:920267-920289 CTGGGGGGGTGCCGTGAAGGTGG - Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161075275 19:2282281-2282303 CTGCGGGCGGGCAGGGGAGGCGG - Intronic
1161268927 19:3378737-3378759 GGGTGGGTCTGCAGGGAACGGGG + Intronic
1161428289 19:4216457-4216479 GTCAGGGTGGGCAGGGAAGGTGG + Intronic
1161979728 19:7624179-7624201 CTGGGGGCCAGCAGGGAAGGAGG - Intronic
1161983198 19:7641119-7641141 CTGTGGGAGGCCAGGGCAGGAGG + Intronic
1162058730 19:8081529-8081551 CTGGGGGTGTTCAGGGACTGAGG + Intronic
1162113559 19:8414510-8414532 CTTTGGGAGTTCAAGGAAGGTGG - Intronic
1162589835 19:11584221-11584243 CTTGGGGGCTGCAGGGAAGGGGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162918181 19:13885360-13885382 CTGTGGGAGGGCACGGGAGGAGG + Intronic
1162931829 19:13961347-13961369 CTGGGGGCGGGCAGGGCAGGGGG - Exonic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163326296 19:16605551-16605573 CTGTGTGTGTGCAGTGAGTGGGG - Intronic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1165112577 19:33510961-33510983 CTGGGGGTGGGTAGGGGAGGTGG - Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165659950 19:37569194-37569216 CTGTGGGAGTCCGGGGCAGGTGG - Intronic
1165719663 19:38070079-38070101 CCGTGGATGAGCAGGGAAGCTGG - Intronic
1166427870 19:42696052-42696074 CTGTGGGAGTTCAGTCAAGGTGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166803492 19:45471728-45471750 CTGTGGGTGGCTAGGGCAGGAGG - Intronic
1166997084 19:46724768-46724790 CAGTGGATGTGAGGGGAAGGCGG + Intronic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
1167032915 19:46975355-46975377 CTGAGGGTGCGCAGGAGAGGAGG + Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167172611 19:47843273-47843295 CTGTGGGTGGACAGAGAAGGGGG - Exonic
1167423051 19:49415026-49415048 CTGTGGGTGTGGAGTGGATGGGG - Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1202633540 1_KI270706v1_random:21971-21993 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1202652341 1_KI270707v1_random:18096-18118 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
925291199 2:2749763-2749785 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291219 2:2749836-2749858 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291233 2:2749888-2749910 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291253 2:2749961-2749983 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291267 2:2750013-2750035 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925577072 2:5370930-5370952 CTTTGGGAGTCCGGGGAAGGAGG + Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
926104426 2:10141551-10141573 CTGTGGTTGTGCTGGAATGGAGG + Exonic
926176621 2:10598453-10598475 CTGTGGGAATACAGGGAATGTGG + Intronic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927661950 2:25000879-25000901 CGGAGGCTGTGCAGGGGAGGTGG + Intergenic
927846050 2:26473477-26473499 CATCGAGTGTGCAGGGAAGGGGG - Exonic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928659543 2:33487446-33487468 ATTTGGGTGTGCAGGAAAGGAGG + Intronic
928925223 2:36571760-36571782 CTTTGGGAGTCCAGGGCAGGTGG + Intronic
930060404 2:47283740-47283762 CTGTTGGGGTGCAGGGGTGGGGG + Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931239705 2:60441240-60441262 CAGTGAGTGTGCTGGGAAGACGG - Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
932008680 2:67953847-67953869 GTGTGTGTGTGCTGGGTAGGGGG - Intergenic
932143111 2:69296966-69296988 CTGTGGGTGCTCAGAGGAGGGGG - Intergenic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
934555332 2:95284134-95284156 CTTGGGGTGTCCAGGGCAGGGGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935194179 2:100802179-100802201 CTGTTGCTGGGCAGGGAAGCCGG + Intergenic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
936820994 2:116520970-116520992 CCGTTGGTGGGCAGGGGAGGTGG - Intergenic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
938090359 2:128427327-128427349 GTGTGTGTGTGAAGGGTAGGAGG + Intergenic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
938561791 2:132479040-132479062 CTTTTTGTGTGCTGGGAAGGGGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939178655 2:138780395-138780417 GGGTGGGCGGGCAGGGAAGGGGG + Intergenic
939921730 2:148124033-148124055 CTTTGGGTGGCCAAGGAAGGTGG + Intronic
940663977 2:156584110-156584132 CTGTGTGTGTGTCGGGATGGGGG - Exonic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
942457953 2:176150885-176150907 CTGGGGGTGGGCTGGGATGGTGG - Intergenic
942726851 2:179019023-179019045 CTGTGGGTGTCCAAAGAAGAGGG - Intronic
943016558 2:182517573-182517595 CTGTGGTTGAATAGGGAAGGTGG + Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943876144 2:193070810-193070832 CTGAGGCTGTGCAGGGCAGTGGG - Intergenic
945060328 2:205903426-205903448 CTTTGGGAGGGCAAGGAAGGTGG - Intergenic
946226661 2:218267485-218267507 CTTTGAGTGTGCAGGTGAGGGGG - Exonic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946570497 2:221018990-221019012 ATGATGGTGTGCAGGGAGGGAGG + Intergenic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
946906771 2:224425008-224425030 CTGTGGGAGTCCAAGGCAGGTGG + Intergenic
947305168 2:228737898-228737920 CTGTGGATGTGAAAGGAAGGTGG + Intergenic
947330813 2:229027567-229027589 CTGTGAGTGTTCAGTGGAGGAGG + Intronic
947343100 2:229160519-229160541 ATATAGGTGTTCAGGGAAGGTGG - Intronic
947698920 2:232216463-232216485 ATGTGGCTTTGCAGGGAAAGGGG - Intronic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
948043425 2:234923390-234923412 CAGTGGGTGTGCTGGAAAGGTGG + Intergenic
948131888 2:235607189-235607211 CTGGGTCTGGGCAGGGAAGGGGG - Intronic
948209852 2:236184932-236184954 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
948290267 2:236819293-236819315 ATGTGAGCGTGCAGGGCAGGTGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948713962 2:239847017-239847039 ATGTGGGTTTTCAGGGAAGTGGG - Intergenic
948754349 2:240150426-240150448 CAGTGGGTGGGCAGGTGAGGTGG + Intergenic
948883322 2:240871205-240871227 CTGATGGTGTGCATGGGAGGAGG - Intronic
1168763430 20:365456-365478 CTGTGGGGGTGCGGAGATGGGGG + Intronic
1168951590 20:1805526-1805548 CTGGGGATGAGAAGGGAAGGTGG + Intergenic
1169046334 20:2537040-2537062 CTGTCTCTGTGCAGGGCAGGGGG + Intronic
1169219017 20:3810489-3810511 CTGTGGGTGGGAAGGTAACGTGG - Intergenic
1169270516 20:4195698-4195720 CTGTGGCTGGGCAGGGTAGGGGG + Intergenic
1170372675 20:15666763-15666785 CTGTGGTTGTGCAGGGGTGCTGG - Intronic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171546625 20:26006935-26006957 CTTTGGGAGGGCAAGGAAGGTGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172227870 20:33317229-33317251 GTGGGGGTGGTCAGGGAAGGAGG - Intergenic
1172340246 20:34151988-34152010 CTGTGGGAGGCCAAGGAAGGAGG - Intergenic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173454230 20:43190237-43190259 CTGTGGGGGCGCAGGTACGGGGG + Intergenic
1173474037 20:43345973-43345995 CTGTGGGGTTGCCCGGAAGGGGG + Intergenic
1173654860 20:44692992-44693014 CTGTGAGTAGGCAGTGAAGGTGG - Intergenic
1173759929 20:45550417-45550439 GTGTGTGTGTGCAGAGAAAGGGG + Intergenic
1173851262 20:46219908-46219930 CAGGGGCTGTACAGGGAAGGTGG + Intronic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1175175765 20:57110986-57111008 GTGTGGGGGAGCAGGGAAGTGGG - Intergenic
1175267503 20:57711384-57711406 CTGTGCCTGTGCAGGGAGAGCGG - Intronic
1175293334 20:57892821-57892843 CGGAGGGTGTGCAGGGATGGAGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175533420 20:59690234-59690256 CTGTGTTTGTGCATGGTAGGCGG - Intronic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175581889 20:60106219-60106241 CTGTGGGAGAGCAAGGCAGGAGG - Intergenic
1175603015 20:60290067-60290089 CTGAGGCTGTGCAGGGTAGCGGG + Intergenic
1176103677 20:63375888-63375910 CTGCTGGGGTGCAGGGATGGTGG - Intronic
1176285019 21:5014791-5014813 TTGTGGGTGTGCAAGGGAGGTGG - Intergenic
1176599806 21:8781557-8781579 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1178341706 21:31791092-31791114 CTGTGGGTGTCCAGTAAATGTGG - Intergenic
1178491946 21:33057991-33058013 CTGGGGGAGGCCAGGGAAGGAGG + Intergenic
1178676697 21:34637242-34637264 GTGTGTGTGTGCAGAGAAAGAGG + Intergenic
1178988416 21:37330233-37330255 CTCTGGGAGGCCAGGGAAGGTGG + Intergenic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179156980 21:38859292-38859314 AGGTGGGGTTGCAGGGAAGGGGG + Intergenic
1179872162 21:44248684-44248706 TTGTGGGTGTGCAAGGGAGGTGG + Intronic
1179875026 21:44262871-44262893 ATGGGGGTGTTCAGGGGAGGTGG + Intergenic
1179884271 21:44306771-44306793 CTGTGTGTGTGCAGGGAGTGGGG + Intronic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180367173 22:11951319-11951341 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1180378907 22:12120018-12120040 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181054407 22:20253353-20253375 TGGTGGGTGAGCAGGGGAGGGGG - Intronic
1181262536 22:21608823-21608845 CTGTGGGAGGCCAGGGAGGGAGG - Intronic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1181472454 22:23149182-23149204 CTGTGGCTGTGCAGGGGTGGGGG + Intronic
1181572096 22:23773150-23773172 CTGGGGGTGTGAAGGGGAGCCGG + Intronic
1181635027 22:24170553-24170575 CTGTGGGAGTGCGGGGCAGGAGG - Intronic
1181725460 22:24807789-24807811 CTGCCACTGTGCAGGGAAGGAGG - Intronic
1181745536 22:24952957-24952979 CTCCGGGTCTGCAGGGAGGGAGG + Intronic
1181812734 22:25413840-25413862 CTGAGGCTGTGCAGGGCAGTAGG + Intergenic
1182067710 22:27442366-27442388 AAGTGGGTGTGCTGGGAATGGGG - Intergenic
1182148161 22:28010295-28010317 CTGTAGGGGTGCTAGGAAGGGGG - Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182567998 22:31213659-31213681 CTTTGGGAGGGCAGGGCAGGAGG + Intronic
1182692867 22:32176017-32176039 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1182711789 22:32327833-32327855 CAGAGGGTGTGCAGGGAGGCCGG - Intergenic
1182758363 22:32699520-32699542 TGGTGTGTGTGCAGGGATGGGGG + Intronic
1183630051 22:39027331-39027353 CTCTGAGTGTGAAGGCAAGGGGG + Intronic
1183665768 22:39244926-39244948 CTGCGGGTGCGCAGGGAGGCAGG + Intergenic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184773726 22:46612920-46612942 CTGTGGGTGAGCAGGGGCTGTGG - Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185080673 22:48707865-48707887 TCGTGGGTGTGCTGGGGAGGGGG + Intronic
1185246866 22:49777293-49777315 CTGTGGGTGCGCAGGTCTGGAGG + Intronic
949365156 3:3272599-3272621 CTGGGGGAGTGCAGAGGAGGGGG + Intergenic
949488839 3:4567845-4567867 CTGTGGAAGTCCAGGGCAGGTGG - Intronic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950116984 3:10457305-10457327 GTGTGGGTGTGCAGGGTCAGTGG + Intronic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
951420072 3:22473604-22473626 CTTTGGGCGGGCAGGGCAGGAGG + Intergenic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953020847 3:39112154-39112176 CTGTAGGGGTACAGGGAGGGAGG + Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954257600 3:49417438-49417460 CTGGGGGTGGGCAGTTAAGGTGG - Exonic
954277895 3:49554430-49554452 GGGGGCGTGTGCAGGGAAGGGGG + Intergenic
954304197 3:49716948-49716970 CTGCAGGGGGGCAGGGAAGGGGG - Exonic
954533265 3:51338838-51338860 CCGTGGGTGTGCTGGGCAGGAGG - Intronic
954627178 3:52028915-52028937 GTGGGGGTGTGCAGGGGATGGGG + Intergenic
954776774 3:53026591-53026613 CTGTGGGGGCACAGGGAGGGAGG - Intronic
955213632 3:56965007-56965029 CTTTGGGTGGCCAAGGAAGGAGG + Intronic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955319646 3:57965063-57965085 CTGTGGGTCTACAGGTAAGTGGG + Intergenic
955407845 3:58636533-58636555 CTGGGGGTGTCCAGAGAACGTGG + Intronic
956003124 3:64750209-64750231 CTTTGGGAGTCCAGGGCAGGAGG - Intergenic
956717330 3:72089743-72089765 CTTTGGGAGGCCAGGGAAGGAGG + Intergenic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
958513929 3:95088135-95088157 CTGAGGGTGAGAAAGGAAGGAGG - Intergenic
960052662 3:113252828-113252850 CTGTGAGTGCTCAGGGAGGGAGG + Intronic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960969609 3:123130268-123130290 CTGGGGCTTTGCGGGGAAGGTGG + Intronic
961132943 3:124485634-124485656 CTTTGGGTGTCCAAGGCAGGTGG + Intronic
961314962 3:126028288-126028310 CTGAGGCTGTGCAGGGCAGCAGG - Intronic
961450665 3:127000955-127000977 CTGTGTGTGTGAAGGGGTGGAGG + Intronic
961514006 3:127421674-127421696 CTGTGAGTGCCCAGGGCAGGGGG + Intergenic
961713665 3:128845115-128845137 CTTTGGTTTTGCTGGGAAGGTGG + Intergenic
962560661 3:136603000-136603022 ATTTGTGTGGGCAGGGAAGGAGG - Intronic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
964465745 3:156989810-156989832 CTGTGTGTGTGCAGAGAGAGAGG - Intronic
964986136 3:162741903-162741925 CTGTAGGTGTGCACCGAAGTTGG + Intergenic
965290481 3:166872778-166872800 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
965456374 3:168905990-168906012 CTTTGGGAGGCCAGGGAAGGTGG - Intergenic
965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG + Intronic
965857271 3:173103611-173103633 CTGAGGCTGTGCAGGGCAGTGGG + Intronic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967109930 3:186284241-186284263 CTGTTGATGTGCAAGGAAGGAGG - Intronic
967283570 3:187846338-187846360 CTCTGGGAGGCCAGGGAAGGAGG - Intergenic
967857705 3:194130868-194130890 AGGTGGGGGTGCTGGGAAGGGGG - Intergenic
967882659 3:194312963-194312985 CTGCTGGTGGGAAGGGAAGGAGG - Intergenic
967889053 3:194351962-194351984 CTGGGGGTGTGCATGTAAGTGGG + Intergenic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968512616 4:1002246-1002268 CTGCGGGTGTCCAGGGCAGCTGG - Intronic
969350109 4:6593480-6593502 CCAGGGGTCTGCAGGGAAGGAGG - Intronic
969797197 4:9535502-9535524 GTGGGGGGGTGCAGGGTAGGGGG + Intergenic
970602328 4:17650243-17650265 CTGTGAGAGGGCAGGGAGGGTGG - Intronic
970869366 4:20797752-20797774 CTGTGGGTCGGCAGGGAATTAGG + Intronic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971830003 4:31679680-31679702 CTTTGGGAGTCCAGGGCAGGCGG - Intergenic
972397809 4:38672583-38672605 CTGGGGGTGGGCAGGGCAGCCGG + Intronic
973363164 4:49183979-49184001 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
973397929 4:49612881-49612903 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
973561723 4:52143859-52143881 GTGTGGGTGAGAAGGGGAGGTGG - Intergenic
973595340 4:52482772-52482794 CTGTAGGGGTGAGGGGAAGGAGG - Intergenic
973773195 4:54225149-54225171 CTGTGGCTGGGAGGGGAAGGAGG - Intronic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975172950 4:71253807-71253829 CTGCGTGTGTGTTGGGAAGGAGG + Intronic
975299110 4:72768448-72768470 CTGTCGGTGAGCATGGAAGAGGG - Intergenic
975878593 4:78873934-78873956 CTTTGGGTGACCAGGGCAGGCGG + Intronic
976141949 4:82002201-82002223 CTGAGGTTGTGCAGGGCAGTGGG - Intronic
976226201 4:82797518-82797540 GAGTGGGGGTGCACGGAAGGAGG + Intronic
976908948 4:90276587-90276609 CTTTGGGTGGGCAAGGCAGGTGG - Intronic
978103236 4:104869273-104869295 CTGTGTGTGTGCTGGGAACTGGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978340740 4:107719710-107719732 CTGAAGATGTGCAGAGAAGGCGG - Intronic
979559114 4:122082189-122082211 CCCTGGGTGGGAAGGGAAGGAGG - Intergenic
979703080 4:123689534-123689556 CTGAGGCTGTGCAGGGCAGTGGG + Intergenic
980248795 4:130285229-130285251 CTATGGGTGGGCAGGGTGGGTGG + Intergenic
980443667 4:132880434-132880456 ATGAGGGTGTGAAGGGAAAGTGG + Intergenic
981080433 4:140634478-140634500 ATGTGAGTGTGTAGGTAAGGGGG - Intronic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
982734835 4:158995159-158995181 CTTTGGGTGTCCAGAGTAGGAGG - Intronic
984725022 4:183012626-183012648 CTGTGAGTGGGCAAGGATGGGGG - Intergenic
984864545 4:184270469-184270491 AGGTGTGTGTTCAGGGAAGGAGG - Intergenic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
1202760525 4_GL000008v2_random:105497-105519 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
985484482 5:140796-140818 GTGGGGGTTTGTAGGGAAGGGGG - Intronic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985614993 5:914890-914912 CTTTGGGGGTCCAGGGAGGGTGG + Intronic
985640157 5:1059806-1059828 GAGTGAGTGTGCAGGGAGGGAGG - Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986017611 5:3771317-3771339 CTGTGGCTGTGCAGGAATGTCGG - Intergenic
986709871 5:10480871-10480893 CTGTGGGTGGGCAGGGAGCTAGG - Intergenic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
988435369 5:31168144-31168166 CTGTGTGTGTGAAGGGGTGGGGG - Intergenic
989099974 5:37814125-37814147 CAGTGGGTGGGCAGGGATGGAGG + Intronic
989104149 5:37845271-37845293 GTGTGTGTGTGTATGGAAGGGGG + Intergenic
989516675 5:42352063-42352085 CTATGGGAGTTCAGGGAAAGGGG + Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
994073775 5:95629056-95629078 CTTAGGCTGTGCAGGGCAGGGGG + Intergenic
994970474 5:106730763-106730785 CTGTGTGTGTACAGGTAAAGCGG - Intergenic
995846376 5:116498554-116498576 CTGTGAGTGTGCATGGGGGGAGG + Intronic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996826225 5:127684104-127684126 CTGTGTGTGTGCAGAGAAAGAGG + Intergenic
997005786 5:129814817-129814839 CTGTGGGAGGGCATGGAGGGAGG - Intergenic
998380951 5:141724945-141724967 CTGAGGCTGTGCAGGGGAGTGGG + Intergenic
998538341 5:142955126-142955148 GTGTGTGTGTGCAGAGATGGGGG - Intronic
998862389 5:146457438-146457460 CCCTGGGTGAGCAGGGAATGGGG + Intronic
999089261 5:148921052-148921074 CTGGGGATGTGAAGGTAAGGAGG + Intergenic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000317951 5:160111074-160111096 CTGTGGGAGGGCAAGGAGGGAGG + Intronic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000832005 5:166114021-166114043 TTGTGTGTGTGCATGGCAGGTGG + Intergenic
1001108106 5:168872881-168872903 CTTTGGGAGTGCAAGGCAGGTGG - Intronic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1002417422 5:179127780-179127802 CGGTGGGTGGGCAGGAAGGGGGG - Intronic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002563904 5:180099624-180099646 CTCTGGGGCAGCAGGGAAGGAGG - Intergenic
1002887503 6:1310382-1310404 CTGGGGTTGGGCAGGGCAGGAGG - Intergenic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1002992476 6:2250690-2250712 CTGTGGGTGGCCAAGGAGGGAGG - Intergenic
1003021200 6:2511046-2511068 CTGTGTGTTTGCGGGGACGGGGG - Intergenic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004159101 6:13197780-13197802 CTCTGGGAGGGCTGGGAAGGAGG - Intronic
1004331802 6:14728693-14728715 CTGTATGTGGGCAGAGAAGGAGG + Intergenic
1004394966 6:15239632-15239654 CTGTGAGTAGGCAGGGAAAGGGG - Intergenic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1004744506 6:18496650-18496672 CTGTTGTGGTGCTGGGAAGGTGG + Intergenic
1004764530 6:18710720-18710742 CTGTGGGTGTACAGGGCATCTGG - Intergenic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005042917 6:21615484-21615506 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1005908214 6:30284168-30284190 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
1006093495 6:31641982-31642004 TTGTGGGTGGGCAGGCCAGGTGG - Intronic
1006134059 6:31885017-31885039 CTGTGGGTGGGAAGGGAGTGAGG + Intronic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1006444295 6:34070177-34070199 CAGTGGCTGTGCATGTAAGGAGG - Intronic
1006984188 6:38166647-38166669 CTATGGGAGTGCGGGGGAGGTGG - Intergenic
1007361510 6:41360101-41360123 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007521648 6:42454652-42454674 GTGTGTGTGTGCTGGGAGGGAGG - Intergenic
1008073068 6:47117100-47117122 CTGAGGATGTGCAGGGTTGGTGG + Intergenic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1014120398 6:117718915-117718937 GTGTGTGTGTGAAGGGATGGGGG + Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015274342 6:131368685-131368707 CTGTCAGTGTGCACAGAAGGGGG + Intergenic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1017571263 6:155747640-155747662 GTGTGCATGTGCAGGGGAGGGGG + Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1017873089 6:158502754-158502776 CTGCAGGTGTACAGGGCAGGTGG - Exonic
1018638297 6:165884073-165884095 GGGAGGGTGTGCAGAGAAGGAGG + Intronic
1018813800 6:167316524-167316546 GTGGGGGGGGGCAGGGAAGGCGG - Intergenic
1018910191 6:168097314-168097336 ATGGTGTTGTGCAGGGAAGGTGG - Intergenic
1018980598 6:168598981-168599003 TTGTGGATGTGCCGGGAATGGGG - Exonic
1019594811 7:1853629-1853651 GTGTGGGTGTGCAGGGCGGCGGG - Intronic
1019613768 7:1949614-1949636 CTGTGGGGTTTCAGGGGAGGTGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020309875 7:6859515-6859537 CTGGGGGGGGGCAGGGCAGGTGG - Intergenic
1021002672 7:15352519-15352541 GTTTGGGTGTTCAGGGGAGGGGG + Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021932373 7:25594568-25594590 CTGAGGGTGTGCAGGGCCAGGGG - Intergenic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1023202122 7:37709952-37709974 CTGCGGGCGTGCAGGGAACCCGG - Intronic
1023538456 7:41238931-41238953 ATGTGGCTGTGCAGGGAAACAGG - Intergenic
1023859117 7:44206617-44206639 CTCTTGGGTTGCAGGGAAGGGGG - Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024261425 7:47576708-47576730 ATCTGGCTGTGCAGGGCAGGCGG - Intronic
1024712262 7:52029430-52029452 GTGTGGGTGTGGATGGATGGTGG - Intergenic
1024729190 7:52235710-52235732 CTGAGGTTGTGCAGGGTAGCAGG - Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026479341 7:70764831-70764853 CTGTGGTTGGGCAGGGAGAGGGG - Exonic
1026494618 7:70891730-70891752 CTGTGGGAGGCCAAGGAAGGTGG + Intergenic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1026850029 7:73718618-73718640 CTCTGGGTGTGTCGGGGAGGGGG - Intronic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027135699 7:75622455-75622477 CTTTGGGAGTCCAAGGAAGGAGG + Intronic
1028207203 7:88031788-88031810 CTGAGGTTGTGCAGGGCAGTGGG - Intronic
1028815666 7:95140961-95140983 CTTTGGGAGGGCAGGGCAGGCGG - Intronic
1029327539 7:99823103-99823125 CTGCAGCTGTGCAGGGTAGGGGG - Intergenic
1030231493 7:107212674-107212696 CTGTGGGTGGGCAATGAAGCCGG - Intronic
1030379433 7:108795395-108795417 CTGTGGAGGTGCATGGAAAGGGG + Intergenic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031679511 7:124653591-124653613 CTTTGGGAGTCCAGGGCAGGTGG - Intergenic
1032115182 7:129110871-129110893 CTGTGAGTGGGCAGTGGAGGAGG + Intergenic
1032123270 7:129172037-129172059 CTGGGGGTGTGTAGGGGTGGGGG + Intergenic
1032242193 7:130171784-130171806 CTTTGGGTGGGCAAGGCAGGCGG + Intronic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032451873 7:132038439-132038461 CTGTGGCTGGGCAGGAAAAGTGG - Intergenic
1032512620 7:132483976-132483998 CCAGGGATGTGCAGGGAAGGTGG + Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032739145 7:134721579-134721601 CTGTGTGTGTTTAGGGGAGGTGG + Intergenic
1033291984 7:140093352-140093374 TTGTGGGGGAGAAGGGAAGGAGG - Intronic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1033987408 7:147243237-147243259 CTTTGGGAGTCCAGGGCAGGTGG - Intronic
1034411069 7:150942445-150942467 CTGTGGCTGGGCAGTGCAGGCGG + Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034460783 7:151196852-151196874 GTGTGGGTGTGTAGGCAAAGGGG - Intronic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034828629 7:154289703-154289725 CTGAAGTTGTGCAGAGAAGGTGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035215725 7:157365195-157365217 CTTTGCGTGGGCAAGGAAGGTGG - Intronic
1035389818 7:158496917-158496939 GGGAGGGGGTGCAGGGAAGGGGG - Intronic
1035415334 7:158679097-158679119 CTGTGGGAGGGCAAGGTAGGAGG - Intronic
1035602169 8:903001-903023 GTGTGGGTGGGCAGGGGTGGGGG + Intergenic
1035765489 8:2101585-2101607 ATGTTGGTGTGAATGGAAGGAGG - Intronic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036968679 8:13329509-13329531 CTGTAGTTGTGATGGGAAGGAGG - Intronic
1037118425 8:15253941-15253963 GTGTGTGTGTGAAGGGATGGGGG - Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1038240525 8:25803674-25803696 CAGTGGGTGAGCAGGTAGGGAGG + Intergenic
1038419709 8:27425517-27425539 CTGTGCATGTGTGGGGAAGGGGG - Intronic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039522069 8:38179520-38179542 CTTTGGGAGTCCAAGGAAGGCGG + Intronic
1041141181 8:54820845-54820867 CTGAGTGTGTTCTGGGAAGGAGG - Intergenic
1041456874 8:58070354-58070376 CTGTGGGAGGTCAGTGAAGGAGG + Intronic
1041467470 8:58171327-58171349 CAGTGGGTGTCCAGGGATGAAGG - Intronic
1042836926 8:73087439-73087461 CCCTGGGTGAGCAGTGAAGGAGG - Intronic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045242079 8:100411385-100411407 CTGTGGGTGTACAGGGCTGGAGG - Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046915160 8:119671991-119672013 CTGTGTGTGTGCGTGGGAGGGGG + Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047449533 8:124952526-124952548 CTAAGGGAGTGAAGGGAAGGAGG - Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047634400 8:126744480-126744502 CTGTGGGTGTCAGGGGATGGAGG + Intergenic
1047832273 8:128647764-128647786 ATGTAGGTGGGCAGGGAGGGAGG - Intergenic
1048463539 8:134642720-134642742 CTGTGCGAGTGCTGGGAAGCTGG - Intronic
1048552331 8:135445050-135445072 CCGTGGGGGTGAAGGGGAGGGGG + Intergenic
1048783564 8:138026867-138026889 TTGGAGGGGTGCAGGGAAGGGGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049172778 8:141172241-141172263 CTGTGGGTGTGCACGGTGGTGGG + Intronic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049196037 8:141316174-141316196 CTGTGGAAATGCGGGGAAGGGGG + Intergenic
1049198522 8:141328525-141328547 CTGGGGGTGGACAGGGGAGGTGG + Intergenic
1049299635 8:141862740-141862762 CTGTGTGGGTGCAGCGAAGCAGG + Intergenic
1049353503 8:142176689-142176711 TTATGGGTGTGCAGGGAGTGGGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1049514097 8:143044427-143044449 TTGTGGGTCTGCAGGGACAGGGG - Intronic
1049589315 8:143449059-143449081 CTGGGGCTGTGCAGGGCAGTGGG + Intronic
1050058825 9:1684031-1684053 CTGGGGCTGGGCAAGGAAGGAGG - Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051693573 9:19743866-19743888 TGGTGGGGGTGCAGGTAAGGAGG + Intronic
1051726550 9:20092721-20092743 ATTTGTGTGTGCAGGGCAGGGGG + Intergenic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1052360902 9:27555804-27555826 CTTTGGGAGTGCAAGGCAGGCGG - Intronic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1053010473 9:34630004-34630026 CTGTGGGTGGCCAGGGTGGGTGG - Intergenic
1053097565 9:35341756-35341778 GCGTGAGTGTGCTGGGAAGGGGG + Intronic
1053136016 9:35650638-35650660 CTGTGGATGTGAAAGGAAGGGGG + Intronic
1053271605 9:36753498-36753520 CTGTGCGTGTGCAGGCATGTGGG + Intergenic
1054851271 9:69848951-69848973 CTGTGGATGGGCAGTGATGGAGG + Intronic
1055252384 9:74323385-74323407 CTGTGAGAGTGCATTGAAGGGGG + Intergenic
1055712041 9:79073916-79073938 CTGTGGATGTGAAGGGACAGGGG + Intergenic
1055958225 9:81794283-81794305 AGGTGGGTGGGCAGAGAAGGGGG - Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056884170 9:90424111-90424133 GTGTGAGTGTGCAGTGAAGGGGG - Intergenic
1057035957 9:91811727-91811749 CTGAGGGAGTGCAGGGAAACAGG - Intronic
1057054080 9:91948717-91948739 CTGCAGGAGTGCAGGGATGGGGG + Intronic
1057171702 9:92966753-92966775 CTGGGGGTGTCCAGGGGAGGCGG - Intronic
1057227592 9:93300715-93300737 CGGTGGGTGTGCAGGGTACTGGG - Intronic
1057351226 9:94300423-94300445 CCGTATGTGTGCAGGGAATGTGG + Exonic
1057615735 9:96588125-96588147 CTCTGGGGGTCCAGGGGAGGGGG + Intronic
1057823140 9:98349595-98349617 CTTTGGGAGGCCAGGGAAGGCGG - Intronic
1057869888 9:98709280-98709302 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1058869359 9:109189123-109189145 ACGTGGGTGAGAAGGGAAGGAGG - Intronic
1059036876 9:110763690-110763712 GTGTGCCTGTGCAGGGAGGGAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059408671 9:114118359-114118381 AAGTGTGTGTGCAGGGGAGGGGG - Intergenic
1059605570 9:115831245-115831267 TTGTGTGTGTGCGGGGAGGGGGG - Intergenic
1059907417 9:119003615-119003637 GTGTGTGTGGGCAGGGGAGGTGG - Intergenic
1060104650 9:120866097-120866119 CTGTGGGTGGGTAGAGACGGGGG + Intronic
1060176374 9:121499949-121499971 GTGTGTGTGTGCCGGGGAGGCGG + Intergenic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061330318 9:129888430-129888452 CTGTTGGTTTGCAGGGACAGAGG + Exonic
1061518448 9:131103171-131103193 CTGTAGGTGACCAGGAAAGGCGG + Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061710031 9:132481095-132481117 TTGTGGGTGTGCAAAGCAGGTGG - Intronic
1061748179 9:132755308-132755330 CTCTTGGTGTGCAGGGTAGGGGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062086946 9:134653895-134653917 CTGAGGGTGTGTAGGGCTGGGGG + Intronic
1062087002 9:134654132-134654154 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087032 9:134654259-134654281 CTGTAGGTGTGTAGGGCTGGAGG + Intronic
1062087115 9:134654607-134654629 CTGAGGGTGTGTAGGGCTGGGGG + Intronic
1062087119 9:134654623-134654645 CTGGGGGTGTGTAGGGCTGGAGG + Intronic
1062087173 9:134654874-134654896 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062087188 9:134654921-134654943 CTGGGGGTGTGTAGGGCTGGGGG + Intronic
1062141348 9:134960831-134960853 CTGAGGCTGGGCCGGGAAGGAGG + Intergenic
1062254546 9:135614817-135614839 TGGTGGGAGTGCAGGGATGGAGG + Intergenic
1062444184 9:136586830-136586852 CTCTGTGTGTGCAGGGCAAGAGG + Intergenic
1062572792 9:137193324-137193346 CTGCGGCTGTGCAGAGTAGGGGG + Intronic
1203792595 EBV:159793-159815 CTGGGGGTGCGCCGTGAAGGCGG + Intergenic
1203709770 Un_KI270742v1:87160-87182 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1203541297 Un_KI270743v1:90383-90405 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1185545164 X:937745-937767 GTGTGTGTGTGCAGAGATGGGGG - Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186207162 X:7213047-7213069 CTTTGGGAGGTCAGGGAAGGAGG - Intergenic
1186207271 X:7213836-7213858 CTTTGGGAGGTCAGGGAAGGAGG + Intergenic
1186795669 X:13044505-13044527 CGGTGGGGATGCGGGGAAGGCGG - Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189260884 X:39678130-39678152 CTGGGGCTGTGCAGGGGATGGGG + Intergenic
1189268185 X:39732074-39732096 ATGAGGGTGTCCAGGGGAGGGGG - Intergenic
1189899427 X:45690586-45690608 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1190470239 X:50771193-50771215 CTTTGTGTGTGAAGGGAGGGTGG - Intronic
1190884625 X:54520713-54520735 CTGTGGGGGTGCAGGGGAACTGG + Intergenic
1193963027 X:87948589-87948611 CTGTGTTTGTTCAGGAAAGGGGG - Intergenic
1194010358 X:88553954-88553976 CACTGGGGGTGCAGGTAAGGAGG + Intergenic
1194301703 X:92195253-92195275 CTATGTGTGTTTAGGGAAGGGGG - Intronic
1194589746 X:95785197-95785219 TAGTGGGAGTGCAGGGAAAGTGG + Intergenic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1195255970 X:103091561-103091583 CTGTGGGTGGGCAGGGTAGGGGG + Intronic
1195289999 X:103423465-103423487 CTGTGGGTCTGCAGTGGTGGTGG - Intergenic
1196704710 X:118707025-118707047 CTGTGGGAGTCCAAGGCAGGTGG + Intergenic
1197772019 X:130095151-130095173 AGGGTGGTGTGCAGGGAAGGTGG + Intronic
1198685109 X:139220575-139220597 ATTTGGGTGTGCAGAGAAGTGGG + Intronic
1198792673 X:140362601-140362623 CTGTTGGTGTGCAGAGAATAGGG - Intergenic
1198948671 X:142043743-142043765 TTGTAGGTGTGCAGTGAAGCAGG + Intergenic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200765335 Y:7076170-7076192 CTGTGGGTGGCCAAGGCAGGTGG - Intronic
1200795268 Y:7335256-7335278 CTGGGGAGGTGCAGGGAAGGGGG + Intergenic
1200819146 Y:7564232-7564254 GTGTGTGTGTGCAGGGTTGGTGG + Intergenic
1201438598 Y:13985491-13985513 TGGTGGGTGGGCAGGGAGGGAGG - Intergenic
1201445975 Y:14057217-14057239 TGGTGGGTGGGCAGGGAGGGAGG + Intergenic
1201914306 Y:19166253-19166275 CTGTGGGAGTCCAAGGCAGGAGG + Intergenic
1201947830 Y:19531106-19531128 CTAAGGCTGTGCAGGGAAGTAGG - Intergenic