ID: 1184345476

View in Genome Browser
Species Human (GRCh38)
Location 22:43910159-43910181
Sequence CAGGTTTTCTAGAAGTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184345476_1184345486 20 Left 1184345476 22:43910159-43910181 CCCTTTGACTTCTAGAAAACCTG No data
Right 1184345486 22:43910202-43910224 CCCCTTCCTGGCAAGACTGAGGG No data
1184345476_1184345488 21 Left 1184345476 22:43910159-43910181 CCCTTTGACTTCTAGAAAACCTG No data
Right 1184345488 22:43910203-43910225 CCCTTCCTGGCAAGACTGAGGGG No data
1184345476_1184345484 19 Left 1184345476 22:43910159-43910181 CCCTTTGACTTCTAGAAAACCTG No data
Right 1184345484 22:43910201-43910223 CCCCCTTCCTGGCAAGACTGAGG No data
1184345476_1184345480 8 Left 1184345476 22:43910159-43910181 CCCTTTGACTTCTAGAAAACCTG No data
Right 1184345480 22:43910190-43910212 CCATTGTCCCACCCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184345476 Original CRISPR CAGGTTTTCTAGAAGTCAAA GGG (reversed) Intergenic
No off target data available for this crispr