ID: 1184348564

View in Genome Browser
Species Human (GRCh38)
Location 22:43927959-43927981
Sequence GAAGATGCATAGAGGAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184348564_1184348571 19 Left 1184348564 22:43927959-43927981 CCGAGCTTCCTCTATGCATCTTC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1184348571 22:43928001-43928023 CACTGGAAACCCTACAAGGGTGG No data
1184348564_1184348567 2 Left 1184348564 22:43927959-43927981 CCGAGCTTCCTCTATGCATCTTC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1184348567 22:43927984-43928006 TAATGAAGATGCCTTCTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1184348564_1184348572 20 Left 1184348564 22:43927959-43927981 CCGAGCTTCCTCTATGCATCTTC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1184348572 22:43928002-43928024 ACTGGAAACCCTACAAGGGTGGG 0: 1
1: 0
2: 0
3: 28
4: 215
1184348564_1184348570 16 Left 1184348564 22:43927959-43927981 CCGAGCTTCCTCTATGCATCTTC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1184348570 22:43927998-43928020 TCTCACTGGAAACCCTACAAGGG 0: 1
1: 0
2: 0
3: 21
4: 166
1184348564_1184348569 15 Left 1184348564 22:43927959-43927981 CCGAGCTTCCTCTATGCATCTTC 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1184348569 22:43927997-43928019 TTCTCACTGGAAACCCTACAAGG 0: 1
1: 0
2: 6
3: 46
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184348564 Original CRISPR GAAGATGCATAGAGGAAGCT CGG (reversed) Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
902709821 1:18230997-18231019 GAGGATGGAGAAAGGAAGCTGGG - Intronic
902713346 1:18255640-18255662 TAAGATGCAGAGAGGAAGAGAGG - Intronic
904209369 1:28876382-28876404 GAAGATAGATAGCGGAGGCTGGG + Intergenic
907328457 1:53656125-53656147 GAAGAGGAAAAGAGGAAGCACGG + Intronic
907610959 1:55870659-55870681 GAAGATGCATAAGTGATGCTGGG - Intergenic
908434384 1:64091046-64091068 GTAGATGGTTAGAGGCAGCTAGG + Intronic
909196766 1:72636527-72636549 GAAGATGGATAGAGGAAGAAAGG - Intergenic
909390879 1:75120206-75120228 GAAGATGCATAGAAGAATTAAGG + Intergenic
910028963 1:82692774-82692796 GAAAGTGCATTGAGGAAGTTTGG - Intergenic
910436724 1:87212892-87212914 AAAGCTGCATAGAGGAACCTGGG + Intergenic
910678450 1:89838734-89838756 GAAGAATGAGAGAGGAAGCTTGG + Intronic
911666216 1:100556219-100556241 GAAGATGCAGAGAGAGAGATTGG - Intergenic
912549436 1:110475504-110475526 GAAGCTGCAGAGATGAGGCTGGG + Intergenic
912588677 1:110791412-110791434 GAGGATGCATTGAAGAAGTTTGG - Intergenic
912982376 1:114387150-114387172 TAATAAGCATAGAGGAAGCAAGG + Intergenic
916959638 1:169876021-169876043 GAAGATGGACACTGGAAGCTAGG - Exonic
917495147 1:175533844-175533866 AACTAGGCATAGAGGAAGCTTGG + Intronic
918467198 1:184832791-184832813 TAAGGTGTATAGAGGGAGCTGGG + Intronic
918862534 1:189850208-189850230 GAAGATGGTTCTAGGAAGCTGGG - Intergenic
919633607 1:199982743-199982765 AAAGAAGCATAAAGGAAGCCAGG - Intergenic
920341275 1:205276534-205276556 GCAGATGGAAGGAGGAAGCTTGG + Intergenic
920383349 1:205548749-205548771 CAAGCTGCACAGTGGAAGCTGGG + Intergenic
920651804 1:207843118-207843140 GAAGCTGCAGAGAGTAAGATGGG + Intergenic
921650521 1:217672915-217672937 GAAGATACAAAGATGAAGATAGG - Intronic
922241861 1:223760572-223760594 GAGGATGCTTAGAGGAAGACTGG + Intronic
922623056 1:227006135-227006157 GAAGATGCTTACATGAGGCTGGG - Intronic
923318955 1:232810597-232810619 GCAGATGCATACAGTACGCTGGG + Intergenic
924599674 1:245477592-245477614 GCAGAGGCATAGAGGAAGTGGGG + Intronic
1062792330 10:316456-316478 GCAGTGGAATAGAGGAAGCTGGG - Intronic
1065085797 10:22174503-22174525 GAAGAGGCATAGAGGGGGCAAGG + Intergenic
1067126331 10:43518712-43518734 GAAGATGCATAGAAGAGCCCTGG - Intergenic
1067540503 10:47147740-47147762 GAAAAGCCATAGAGGAAACTGGG - Intergenic
1067975069 10:51015589-51015611 AGAAATGCATAGAGGAGGCTGGG + Intronic
1068568555 10:58603494-58603516 GAAGATACATAGAGGTAGCGGGG - Intronic
1068863507 10:61870299-61870321 GAGGAAGCATAGATGAAGTTTGG + Intergenic
1069056140 10:63847006-63847028 AAAGAGGCATTGAGGAAGGTAGG + Intergenic
1069862021 10:71477468-71477490 GAAGATTCAAAGAGGAGCCTGGG - Intronic
1069974834 10:72204738-72204760 TAAGATGTTTAGAGGAAGATTGG + Intronic
1070026063 10:72633283-72633305 GATGATGCTTACAGGAAGCTGGG - Intergenic
1070219050 10:74421326-74421348 GATGATGAATGGTGGAAGCTAGG + Intronic
1070254677 10:74803947-74803969 GAAGGTGGAAAGTGGAAGCTTGG - Intergenic
1070871504 10:79758074-79758096 GAAGAAGCAAAGCAGAAGCTTGG + Intergenic
1071638436 10:87280282-87280304 GAAGAAGCAAAGCAGAAGCTTGG + Intergenic
1071656806 10:87457670-87457692 GAAGAAGCAAAGCAGAAGCTTGG - Intergenic
1073524440 10:104166365-104166387 AAAAATACATAGAGGAGGCTGGG - Intronic
1073617548 10:105011971-105011993 AAAGGAGCATAGAGGAAGTTAGG + Intronic
1073881435 10:107985453-107985475 GAAGATGCTAAGAAGAAACTTGG - Intergenic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1074530548 10:114295677-114295699 GAAGATGAATCAAGGAAGCAGGG - Exonic
1076230528 10:128816814-128816836 GAGGATGAAGAGAGGGAGCTGGG + Intergenic
1078409295 11:11098653-11098675 AAAGCTGCTTAGAGGAGGCTTGG - Intergenic
1080391278 11:31849233-31849255 GAAAATGCATAGTGGTAGTTTGG - Intronic
1083240539 11:61384727-61384749 GCAGACGCACAGAGGAAGTTGGG + Intergenic
1084941154 11:72614065-72614087 GAGGAGGCATAGAGTCAGCTTGG - Intronic
1085047207 11:73360512-73360534 GATGAGGCCAAGAGGAAGCTGGG + Exonic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087411228 11:97792221-97792243 AAAAATACATAGTGGAAGCTGGG - Intergenic
1087950689 11:104217992-104218014 GAAGACTCATAGAGGAGTCTTGG + Intergenic
1089587706 11:119520681-119520703 GAAGATGCAGACAGGTAGTTAGG - Intergenic
1090085005 11:123642830-123642852 GAAGAGGCACAGAGGAGGGTAGG + Intronic
1090328819 11:125913207-125913229 GAAGCTGGAGAGAGGGAGCTTGG - Intronic
1090393349 11:126403674-126403696 GAAGATGGAGAGAGGGAGCAGGG + Intronic
1090882678 11:130847989-130848011 GAACATGCCTAGGAGAAGCTGGG + Intergenic
1091177315 11:133573107-133573129 GAGGCAGCATAGAGGAAGATAGG - Intergenic
1091345898 11:134853797-134853819 GAAGATGCATCCAGAAGGCTTGG + Intergenic
1091812398 12:3410367-3410389 GGAATTGCAGAGAGGAAGCTGGG - Intronic
1093149642 12:15605742-15605764 GAAGATGCAGAGAGGAGTCCGGG - Intergenic
1097486345 12:60207111-60207133 AATAATGCATAGAGGAAGCAAGG + Intergenic
1099562353 12:84193685-84193707 AAAGAGGCATTGAGGAAGGTAGG - Intergenic
1099645778 12:85354245-85354267 GATGAGGCTTCGAGGAAGCTGGG + Intergenic
1100669151 12:96791462-96791484 AAAGTTGCATAAAAGAAGCTGGG + Intronic
1100782101 12:98038000-98038022 GAAGGTGCATACAGGAAGATAGG + Intergenic
1102785168 12:115598948-115598970 GAAGATGCCTAGAGCAGGGTTGG + Intergenic
1102946254 12:116991260-116991282 AAAGTTACATAGATGAAGCTTGG - Intronic
1104744173 12:131200826-131200848 GAAGATGGAAAGAGGGAGGTGGG - Intergenic
1104790206 12:131476397-131476419 GAAGATGGAAAGAGGGAGGTGGG + Intergenic
1105763457 13:23534416-23534438 GCAGATGCTTAGAGGGAGTTTGG + Intergenic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1109607005 13:64708981-64709003 GAAGATGTCTATAAGAAGCTTGG - Intergenic
1110394506 13:75013871-75013893 GAAGATGCAAAGAGGGTACTGGG - Intergenic
1113075309 13:106462205-106462227 GAAGTTGCAGAGAGACAGCTTGG + Intergenic
1116372504 14:44154336-44154358 AAAGATGCATTGAAGAAGGTAGG + Intergenic
1118400139 14:65372269-65372291 GAAGATACATAGAGGAGTCCTGG - Intergenic
1119687448 14:76643999-76644021 GAAGCTGCAGAGAGGAGGATGGG + Intergenic
1202841588 14_GL000009v2_random:126020-126042 TAAGAGGCACAGAGGAAACTGGG + Intergenic
1202910975 14_GL000194v1_random:116252-116274 TAAGAGGCACAGAGGAAACTGGG + Intergenic
1124651557 15:31477869-31477891 GAAGATGCAGAGAGGTGGGTAGG + Exonic
1126454031 15:48841750-48841772 GCAGATGCTAAGATGAAGCTTGG - Intronic
1127137142 15:55936013-55936035 TAAGAAGCATAGAAGAAGGTTGG - Intronic
1127939153 15:63676195-63676217 TAAGATGCATACAGTAGGCTGGG - Intronic
1128907744 15:71483181-71483203 GAAGATGCATAGGCCAAGTTGGG + Intronic
1128918792 15:71592197-71592219 GAAGAAGCAGAGAGGAAGTTTGG + Intronic
1129121393 15:73399012-73399034 GGATCTGCACAGAGGAAGCTGGG + Intergenic
1130755363 15:86757173-86757195 GAAGATACATAGAAAAAGCGTGG + Intronic
1132285383 15:100658642-100658664 GAAGAAGCATAAAGAGAGCTGGG - Intergenic
1135711830 16:24723947-24723969 GAAGATGCAGTGGGGTAGCTAGG - Intergenic
1137572086 16:49573242-49573264 GAACATGTCTAGAGGATGCTGGG + Intronic
1138446888 16:57070278-57070300 AAGGCTGCAGAGAGGAAGCTGGG - Intronic
1138807027 16:60102122-60102144 GAAGAAGCATATAGGAAAATTGG - Intergenic
1141186334 16:81790132-81790154 GAAGATGCATTGGAGAGGCTCGG + Intronic
1144158517 17:12533571-12533593 GAAGAAGCTTAGAGGAGGCCAGG - Intergenic
1145819160 17:27818043-27818065 GGAGATGCACAGAGCAAGGTGGG - Intronic
1146138214 17:30341650-30341672 GCAGATGCATGGAAGGAGCTGGG + Intergenic
1147551247 17:41443571-41443593 GAAGATGCAGGGAGGCATCTAGG + Intergenic
1149019763 17:51949750-51949772 GATGTTCCATAGAGGAACCTTGG + Intronic
1150138582 17:62710013-62710035 GAAGTTGCAAGGAGCAAGCTGGG - Intronic
1150258740 17:63771554-63771576 AAAGATGGTTAAAGGAAGCTAGG - Intronic
1150293816 17:63997535-63997557 GAAAATCCAGACAGGAAGCTGGG - Intergenic
1151257452 17:72889929-72889951 GAAAATGCATAGAGTTAGGTGGG + Intronic
1151508371 17:74543695-74543717 GAAGATGCTCCGAGGAACCTGGG + Intronic
1153498416 18:5722883-5722905 GGAGATGCAGGGAGGATGCTTGG - Intergenic
1153831938 18:8931415-8931437 GAATCTGCATAGAGGAAGCCAGG - Intergenic
1156330513 18:36117304-36117326 GAAGAGGCATGGAAGAAGCCAGG - Intronic
1157419683 18:47535965-47535987 CAAGATGCATAGAGGAGGGCAGG + Intergenic
1157876132 18:51275273-51275295 GGAGATGCATAGAGCAGGATAGG - Intergenic
1158038156 18:53059759-53059781 GAAGATGAGTAGAAGAAGTTCGG - Intronic
1158715303 18:59873782-59873804 CCAGATGCACAGAAGAAGCTTGG - Intergenic
1162793775 19:13076340-13076362 GAAGATCCCTAGAGGAGACTGGG - Intronic
1168072054 19:53958870-53958892 GAAGATGCGGAGAGGGAGCGGGG - Intergenic
927053842 2:19352691-19352713 GAAGATGAGTAAAGGGAGCTGGG + Intronic
928392996 2:30923565-30923587 GGAGATGCAGAGGTGAAGCTGGG + Intronic
928556524 2:32432111-32432133 GGAGATCCAAAGAGGTAGCTGGG + Intronic
930094249 2:47554755-47554777 CAAGGAGCATAGAGAAAGCTGGG + Intronic
930109062 2:47662775-47662797 GAAGATGCTCAGAAGAAGGTGGG + Intergenic
931791761 2:65669855-65669877 GAAGATACAGTGAGGAAACTAGG - Intergenic
933299182 2:80523485-80523507 GTAGATGGAAAGAGGAAGATAGG + Intronic
933369174 2:81393558-81393580 GAATCTGCATAGATGAAGCCAGG - Intergenic
933371934 2:81425368-81425390 GAAGATGCATAGAGAAGGATAGG - Intergenic
935984688 2:108661370-108661392 GAAGATACATAGAGCATGTTTGG - Intronic
936137123 2:109905021-109905043 GAAGATACATAGAGCATGTTTGG - Intergenic
936207574 2:110466464-110466486 GAAGATACATAGAGCATGTTTGG + Intronic
937295363 2:120806855-120806877 GAAGATGCATTTAAGAAGCAGGG + Intronic
937730957 2:125228363-125228385 GAACTTCCAAAGAGGAAGCTGGG + Intergenic
938449920 2:131408939-131408961 GCAGATGCATACAGGAAGTGGGG + Intergenic
939997134 2:148930444-148930466 GAAACTGCACAGAGGAAGTTTGG + Intronic
940036547 2:149318167-149318189 GAAGATGTCTAAAAGAAGCTCGG + Intergenic
940303331 2:152198848-152198870 GAAGATGCAAGGAGGAGGCATGG - Intergenic
940577136 2:155523053-155523075 GAAGATGACAAGAGGAAGCCTGG - Intergenic
940788294 2:158005436-158005458 GAAGATGAAAAGAGAAAGCCAGG + Intronic
941244244 2:163077519-163077541 GAAGATCTGCAGAGGAAGCTTGG - Intergenic
942109746 2:172669010-172669032 GAAGCAGCATGGATGAAGCTAGG - Intergenic
942518407 2:176777434-176777456 GTAGCTGCATGGAGGACGCTGGG + Intergenic
943623811 2:190178247-190178269 GAAGATGCGTCGAGGGAACTTGG - Intronic
944373499 2:199012470-199012492 AAAGATGCATTGAAGAAGGTAGG - Intergenic
944533377 2:200685924-200685946 CAAGAGTCAAAGAGGAAGCTGGG + Intergenic
946457651 2:219840911-219840933 GAAGTTGCAGATAAGAAGCTGGG - Intergenic
947983471 2:234429074-234429096 GAAGATGCAGACAGGGAACTGGG - Intergenic
948017721 2:234703399-234703421 GAAGCTGAATAGAGACAGCTTGG - Intergenic
948073087 2:235143406-235143428 GAAGCTCCATATAGGAAGATGGG + Intergenic
1168791665 20:581628-581650 GAAGATACATAGATGATGATAGG - Intergenic
1169461830 20:5802234-5802256 GAAGGTGCAAAGAGCAAGCATGG - Intronic
1171142251 20:22753500-22753522 GAAAATAAATAGAGGAATCTAGG - Intergenic
1172788407 20:37485839-37485861 GAAGATGTAGAGAGGAAGATGGG + Intergenic
1174378733 20:50142959-50142981 GAGGGTGGCTAGAGGAAGCTGGG + Intronic
1174830923 20:53811574-53811596 GGAGATGGAGAGAAGAAGCTAGG + Intergenic
1175105117 20:56609685-56609707 GAAGATTCTTAGAGGAAGCAGGG - Intergenic
1176597125 21:8757845-8757867 TAAGAGGCACAGAGGAACCTGGG - Intergenic
1176630329 21:9130949-9130971 TAAGAGGCACAGAGGAAACTGGG + Intergenic
1178687612 21:34723625-34723647 GAGGAGCCATAGAGGAAGTTTGG - Intergenic
1180740135 22:18047732-18047754 GATGATGCTTAGAAGAACCTAGG + Intergenic
1181661612 22:24354537-24354559 GAAGGTGCATTGAGAAAGCAAGG - Intronic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
1184709889 22:46243398-46243420 GAAGTTGGAGAGAGGATGCTGGG - Exonic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
950217236 3:11168381-11168403 GATGACGCACAGAGGAAGCGGGG + Intronic
951344539 3:21531103-21531125 GATGATACATAGAGCAATCTTGG + Intronic
952171598 3:30812990-30813012 GAAAATGCAGTGAGGAAGCCTGG + Intronic
954913887 3:54132925-54132947 GAAGATGCATGCAGGATGCTTGG + Intronic
955098550 3:55824045-55824067 GGACATGCATAGAGGTAGCAGGG - Intronic
955711524 3:61784078-61784100 GAACCTGCATAGAGAAGGCTAGG + Intronic
955927450 3:64022382-64022404 GAAGATGCAGAGAAGAATCTAGG - Exonic
956481255 3:69675920-69675942 CAGGAAGCATAGAGGGAGCTTGG - Intergenic
956922224 3:73941940-73941962 CAAGATAAATAGAGGAAACTGGG - Intergenic
959401680 3:105910269-105910291 AAAAATGCATAGTGGTAGCTGGG + Intergenic
961635582 3:128330747-128330769 GGAGATGCACTGAGGAAGCGGGG - Intronic
961635738 3:128331308-128331330 GGAGATGCATTGAGGAAGGGGGG - Intronic
961635789 3:128331485-128331507 GGAGATGCATTGAGGAAGTGGGG - Intronic
962425566 3:135266328-135266350 GAGGATGAATAAAGGAAGCATGG + Intergenic
963106388 3:141651002-141651024 GAAGCTGCAAAGAGGACCCTGGG - Intergenic
963749808 3:149164841-149164863 GAAGATGCATGAGGGCAGCTAGG - Intronic
964275056 3:155000694-155000716 GAAGATCCACTGAGGAACCTAGG - Intergenic
965539915 3:169861633-169861655 GACTTTGCATAGAGGAAGATAGG - Intronic
965638892 3:170812472-170812494 GCAGATTCAAAGAGGCAGCTTGG - Intronic
965854177 3:173067663-173067685 GAAGATGTAGAGAGGGAGATAGG + Intronic
966921534 3:184614940-184614962 GAAGAAGCAGAGAGGAAGCCGGG - Intronic
967363177 3:188655501-188655523 GAAGATGCATGGAAGAAGCATGG + Intronic
969980587 4:11150133-11150155 TAGGATGGCTAGAGGAAGCTGGG + Intergenic
972350336 4:38230903-38230925 GAAGAAGGATAGAGCTAGCTTGG - Intergenic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
978345626 4:107765625-107765647 GAAGAGGCATAGTGGAAGAAAGG + Intergenic
978489243 4:109294094-109294116 AAAGATTCATGGAGGAAGCAAGG - Intronic
979590947 4:122479792-122479814 GACGGTGCTGAGAGGAAGCTTGG - Intergenic
979701714 4:123675756-123675778 GATGAAGCCTAGGGGAAGCTAGG + Intergenic
979997055 4:127443720-127443742 AAAGATGCATGCAGGAAGATTGG - Intergenic
980514827 4:133841812-133841834 GAAGATCCATAGTGGGATCTAGG + Intergenic
982792003 4:159603637-159603659 GGAGATGTATAGAAGAAGATTGG + Intergenic
985631852 5:1017997-1018019 GAGGAGGCATGGAGGAAGCGTGG + Intronic
985913442 5:2900480-2900502 GGAGCTGCAGAGAAGAAGCTGGG - Intergenic
988850502 5:35175676-35175698 AAAAATGCATAGAGCAAGGTGGG - Intronic
989064918 5:37450559-37450581 GTAAATGGATAGTGGAAGCTAGG - Intronic
989652134 5:43702869-43702891 GAAGCTGGATATAGGAAACTGGG - Intronic
990007198 5:50957374-50957396 GAAGATTTATAGAGGAAGGGTGG + Intergenic
990722963 5:58718772-58718794 GAATATGCATAAATGAAGCCAGG + Intronic
991645357 5:68795619-68795641 GAAGAGGCAGAGAGGCAACTTGG - Intergenic
992350957 5:75928779-75928801 GAAGATGGAGAGAGGAGACTGGG - Intergenic
992742863 5:79791423-79791445 GAAAAGGCATAGAAGAGGCTGGG + Intronic
992949114 5:81839259-81839281 GTAGATGCATAGAAGAAGTCTGG + Intergenic
993645682 5:90457511-90457533 GAAGACCCATAGAAGAAGATAGG - Intergenic
994335119 5:98555767-98555789 GAAGATAATTAGATGAAGCTAGG + Intergenic
994418726 5:99506369-99506391 GTAAATGGATAGTGGAAGCTAGG - Intergenic
994575444 5:101573068-101573090 GGAGATGCTTAGAGGGAGGTAGG - Intergenic
995746501 5:115409381-115409403 GAAGAAACAAAGAGGAAGCAAGG + Intergenic
998174332 5:139892399-139892421 GAGGATGCATAGAGAAAGGATGG - Intronic
1000471512 5:161648219-161648241 GAAAAGGCATAGAAGAACCTTGG - Intronic
1001004222 5:168035941-168035963 GGAGATGCATTGAGAAAGTTTGG + Intronic
1001419739 5:171577585-171577607 GATGATGCAGAGAGGCAGCCTGG + Intergenic
1001540120 5:172531934-172531956 GGAAATGCTTAGAGGATGCTTGG - Intergenic
1002959907 6:1905004-1905026 AAAGATGGATAGAGGTAGCATGG + Intronic
1003416098 6:5909766-5909788 GAGGATCCATGGAGGAAGCAGGG - Intergenic
1003774360 6:9343323-9343345 GAAGCTGCATGGAGGAAGTAGGG - Intergenic
1004733226 6:18379582-18379604 GAAGAGGAATACAGGAAGCTGGG + Intergenic
1007287880 6:40761260-40761282 GAAAAAGCATGGTGGAAGCTAGG + Intergenic
1007805688 6:44444098-44444120 CCAGATGCATAGATGTAGCTGGG + Intronic
1008006292 6:46413057-46413079 GAAGATGCAATGAATAAGCTGGG + Intronic
1010732350 6:79404533-79404555 AGAGAGGCAGAGAGGAAGCTTGG + Intergenic
1012553234 6:100483187-100483209 TAAGAAGCATACAGGCAGCTGGG - Intergenic
1013465263 6:110412467-110412489 GAAGATGGATAGCAGAAGCATGG - Intronic
1013970410 6:116011495-116011517 GAAAATGCAGAAAGGAAACTGGG + Intronic
1015723365 6:136270366-136270388 GAAGATGGAAAGAGGCATCTAGG + Intronic
1015847320 6:137534478-137534500 GAAGATGCCCAAAGGAAACTAGG + Intergenic
1016544228 6:145202520-145202542 GAAAATGGAAAGAGGAAGCATGG + Intergenic
1016640154 6:146338930-146338952 GAAGATTTATGGAGGAGGCTGGG - Intronic
1016749918 6:147621154-147621176 GTAAAAGCATACAGGAAGCTTGG - Intronic
1017723934 6:157263839-157263861 GAAGATGCAAAATGGAAGCTTGG - Intergenic
1018674012 6:166203391-166203413 GAGGATGCATAGAGGTAGAAGGG - Intergenic
1018786687 6:167113903-167113925 GAAGATGGATAGATGAAGAAAGG + Intergenic
1022109531 7:27219966-27219988 GGAGATGCAAGGAGGATGCTGGG + Intergenic
1022550494 7:31234761-31234783 GAAGATGCCTAGAGCCGGCTTGG - Intergenic
1023291251 7:38671220-38671242 GGAGTTTCAGAGAGGAAGCTAGG - Intergenic
1023635790 7:42208849-42208871 GAAGATGAGTATAGGAAGCCTGG + Intronic
1024128503 7:46325772-46325794 GAGGTTGCAGAGAGGACGCTGGG + Intergenic
1029065942 7:97848362-97848384 GAAGAAGCAAAGTGGAAGCTGGG - Intergenic
1031077333 7:117225536-117225558 GAAGATGCAGAGAAGACTCTGGG - Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1032098321 7:128951453-128951475 GTAGATGAATTGGGGAAGCTTGG + Intergenic
1034906350 7:154950819-154950841 GAAAAGACATGGAGGAAGCTGGG + Intronic
1037016788 8:13917634-13917656 GAAAATACATGGAGGAAACTTGG - Intergenic
1038562304 8:28590993-28591015 GAAAATGCATTGAGGAGGCTGGG - Intergenic
1040891455 8:52321238-52321260 GGAGGAGCACAGAGGAAGCTGGG + Intronic
1043144769 8:76639348-76639370 GAAGAGGCATTGAGGAAGGCCGG + Intergenic
1044557183 8:93575976-93575998 GAAGATGAATAGAAGGAGTTAGG + Intergenic
1045446848 8:102275244-102275266 AAAAATTCATAGAGGATGCTAGG + Intronic
1047403604 8:124566845-124566867 GAAGATGAATGGAGGAAGTCAGG + Intronic
1050536906 9:6638508-6638530 AAAGAAGCAAAGATGAAGCTGGG - Intronic
1050949062 9:11565359-11565381 GAAGAGGCAGAGAGAAAGATAGG - Intergenic
1051490190 9:17654810-17654832 CAAAATGCATAGAGGAAATTAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053154915 9:35770813-35770835 GGAGATGCTTAGCGGAGGCTGGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057514473 9:95709966-95709988 GAAGACGCAGAGTGGAAGATAGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057787346 9:98096811-98096833 GAAGATGGACAGAGGAGGCCAGG - Intronic
1057929887 9:99184343-99184365 GGAGCTGCAGAGAGCAAGCTGGG + Intergenic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1059036687 9:110761523-110761545 GAAGATGCATAAAGCAGACTTGG - Intronic
1060548084 9:124472243-124472265 GAAGATTCAGAGATGAAGATTGG - Intronic
1060899614 9:127245709-127245731 GAAAATGCATTTAGGATGCTTGG - Intronic
1203753161 Un_GL000218v1:98634-98656 TAAGAGGCACAGAGGAAACTGGG + Intergenic
1187425779 X:19176267-19176289 GAAGAAGCCTAGAAGAAGGTGGG + Intergenic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188657231 X:32713395-32713417 GAAGAGGGAAAGAGAAAGCTGGG + Intronic
1189110872 X:38287138-38287160 GAAGGTGCATGGAGGAAGAAAGG - Exonic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190298367 X:49041948-49041970 GAAGTTGGGAAGAGGAAGCTCGG + Intronic
1192465154 X:71349716-71349738 GATGATACCTAGAGGAAGCTGGG + Intergenic
1192473135 X:71416773-71416795 GATGATACCTAGAGGAAGCTGGG - Intronic
1193712592 X:84896277-84896299 AAAGATCCATAGAAGAAGCATGG + Intergenic
1195726878 X:107926872-107926894 GAAGATGGAGAGAGTTAGCTGGG - Exonic
1195859476 X:109367688-109367710 GAAGAAGAGTAGAGAAAGCTAGG + Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1198279684 X:135129422-135129444 CAAGATGCATAGGGGAAACTGGG + Intergenic
1198291273 X:135243092-135243114 CAAGATGCATAGGGGAAACTGGG - Intergenic
1201166807 Y:11216203-11216225 TAAGAGGCACAGAGGAAACTGGG + Intergenic
1201341025 Y:12934591-12934613 GGAGCTGCCTAGAGGAACCTAGG + Intergenic
1201366330 Y:13210793-13210815 AAAGATGCAGAGTGGCAGCTGGG - Intergenic
1202101986 Y:21319193-21319215 AAAAATTCATAGAGGAAGTTAGG - Intergenic
1202240501 Y:22762548-22762570 GAAAATTCATGGAGGAAGTTAGG + Intergenic
1202393487 Y:24396301-24396323 GAAAATTCATGGAGGAAGTTAGG + Intergenic
1202477298 Y:25273799-25273821 GAAAATTCATGGAGGAAGTTAGG - Intergenic