ID: 1184349746

View in Genome Browser
Species Human (GRCh38)
Location 22:43935877-43935899
Sequence CGCTTCCTGTCCCGCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184349746_1184349749 -3 Left 1184349746 22:43935877-43935899 CCCTGGATGCGGGACAGGAAGCG No data
Right 1184349749 22:43935897-43935919 GCGAGATACCAGTGTCTAGGAGG No data
1184349746_1184349751 6 Left 1184349746 22:43935877-43935899 CCCTGGATGCGGGACAGGAAGCG No data
Right 1184349751 22:43935906-43935928 CAGTGTCTAGGAGGCCAGTGAGG No data
1184349746_1184349752 16 Left 1184349746 22:43935877-43935899 CCCTGGATGCGGGACAGGAAGCG No data
Right 1184349752 22:43935916-43935938 GAGGCCAGTGAGGCAGCCACAGG No data
1184349746_1184349754 26 Left 1184349746 22:43935877-43935899 CCCTGGATGCGGGACAGGAAGCG No data
Right 1184349754 22:43935926-43935948 AGGCAGCCACAGGCTCCACCAGG No data
1184349746_1184349748 -6 Left 1184349746 22:43935877-43935899 CCCTGGATGCGGGACAGGAAGCG No data
Right 1184349748 22:43935894-43935916 GAAGCGAGATACCAGTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184349746 Original CRISPR CGCTTCCTGTCCCGCATCCA GGG (reversed) Intronic