ID: 1184349983

View in Genome Browser
Species Human (GRCh38)
Location 22:43937148-43937170
Sequence TTCCCCGGAGTCGGCTGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184349979_1184349983 5 Left 1184349979 22:43937120-43937142 CCAGCTGGGCAAACATGAGTCTG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1184349983 22:43937148-43937170 TTCCCCGGAGTCGGCTGCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1184349978_1184349983 6 Left 1184349978 22:43937119-43937141 CCCAGCTGGGCAAACATGAGTCT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1184349983 22:43937148-43937170 TTCCCCGGAGTCGGCTGCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1184349974_1184349983 21 Left 1184349974 22:43937104-43937126 CCTGAGGTCGCCATGCCCAGCTG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1184349983 22:43937148-43937170 TTCCCCGGAGTCGGCTGCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1184349977_1184349983 11 Left 1184349977 22:43937114-43937136 CCATGCCCAGCTGGGCAAACATG 0: 1
1: 0
2: 0
3: 20
4: 332
Right 1184349983 22:43937148-43937170 TTCCCCGGAGTCGGCTGCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184349983 Original CRISPR TTCCCCGGAGTCGGCTGCCT TGG Exonic