ID: 1184356215

View in Genome Browser
Species Human (GRCh38)
Location 22:43981142-43981164
Sequence CACCGAAGGCGAGCAGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184356215_1184356218 -10 Left 1184356215 22:43981142-43981164 CCGGGCCCTGCTCGCCTTCGGTG 0: 1
1: 0
2: 2
3: 11
4: 149
Right 1184356218 22:43981155-43981177 GCCTTCGGTGTGTCTTGATTTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1184356215_1184356220 -3 Left 1184356215 22:43981142-43981164 CCGGGCCCTGCTCGCCTTCGGTG 0: 1
1: 0
2: 2
3: 11
4: 149
Right 1184356220 22:43981162-43981184 GTGTGTCTTGATTTGGACTTTGG 0: 1
1: 0
2: 1
3: 20
4: 237
1184356215_1184356221 26 Left 1184356215 22:43981142-43981164 CCGGGCCCTGCTCGCCTTCGGTG 0: 1
1: 0
2: 2
3: 11
4: 149
Right 1184356221 22:43981191-43981213 GTGTTTTAATAGAATCCACGTGG 0: 1
1: 0
2: 0
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184356215 Original CRISPR CACCGAAGGCGAGCAGGGCC CGG (reversed) Intronic
901326315 1:8367570-8367592 AACCCCAGGCCAGCAGGGCCAGG + Intronic
903576459 1:24342498-24342520 GACCTCAGGCAAGCAGGGCCAGG + Intronic
905033904 1:34904938-34904960 CAGCGAGGGCCAGCAGGGGCAGG - Exonic
907750736 1:57260785-57260807 CACTGCATGCAAGCAGGGCCTGG + Intronic
911450271 1:98053555-98053577 CCGCGAAGGCGCGCTGGGCCTGG - Intergenic
912204247 1:107492993-107493015 CACTGCAGGGCAGCAGGGCCAGG + Intergenic
919945918 1:202318904-202318926 CAGAGAAGGCTACCAGGGCCTGG - Exonic
921343220 1:214154927-214154949 CTGCGAAGGCCAGCAGGGTCAGG - Intergenic
923778090 1:236997752-236997774 AAGAGAAGGGGAGCAGGGCCGGG + Intergenic
1065122746 10:22544523-22544545 CTCTCAAGCCGAGCAGGGCCTGG - Intronic
1069792229 10:71030072-71030094 CCCTGAAGGCAGGCAGGGCCAGG - Intergenic
1070151946 10:73810966-73810988 CACTGAGGGCCAGCAGGGCTGGG + Intronic
1075409856 10:122219306-122219328 CACTGAAGGCGGGCAGAGCCAGG - Intronic
1075778120 10:125001031-125001053 CACAGAAGACGACCAGGACCAGG - Intronic
1077056995 11:598640-598662 CACAGAAGCCGCGCCGGGCCCGG + Intronic
1077402552 11:2366349-2366371 CACCCCAGGCGGGCAGAGCCAGG - Intergenic
1077826892 11:5820527-5820549 CAGTGAAGGAGAGCAGGGCCAGG - Exonic
1078364150 11:10692899-10692921 CCCTGGAGGTGAGCAGGGCCGGG + Intronic
1078415049 11:11157942-11157964 CTCAGCTGGCGAGCAGGGCCTGG + Intergenic
1079714813 11:23731733-23731755 CACAGAAGGCGAGCAGAAGCAGG + Intergenic
1084153728 11:67302972-67302994 CCTCGGAGGCGAGCAGGGCAGGG - Intergenic
1085060700 11:73443890-73443912 CTTGGAAGGTGAGCAGGGCCAGG + Intronic
1087216951 11:95504731-95504753 CACCCCAGGTGAGCAGGACCAGG - Intergenic
1092163024 12:6326522-6326544 CAGGGAAGGCGTGGAGGGCCTGG - Exonic
1098016930 12:66114971-66114993 CACCAAATGGGAGCAGGGGCAGG + Intergenic
1100384486 12:94092816-94092838 CACCCAAGGCCACCAGGGCAAGG - Intergenic
1102031757 12:109743831-109743853 CCCAGATGCCGAGCAGGGCCGGG + Intronic
1102490642 12:113287909-113287931 CCACGAAGAGGAGCAGGGCCAGG - Intronic
1103505981 12:121442659-121442681 CACCGAAGGGGCCGAGGGCCCGG - Exonic
1103704735 12:122865402-122865424 CAGCGACGGCGAGCCCGGCCAGG + Exonic
1103809569 12:123602498-123602520 CAGCTACAGCGAGCAGGGCCAGG - Intronic
1104623955 12:130338007-130338029 CGCCGAAGGCGAGGTGGGCGCGG + Exonic
1104735271 12:131132529-131132551 ATGCGAAGGCGAGCTGGGCCCGG - Intronic
1107642045 13:42453462-42453484 CACGGAGGGCGAGCAGGACCAGG - Intergenic
1112314921 13:98352207-98352229 CACCGATGGCGTGCAGGCCTTGG - Intronic
1114418079 14:22557317-22557339 CCCCAAAGGAGAGGAGGGCCTGG + Intronic
1115770148 14:36658895-36658917 CGCCCAAGGGGAGCAGGGGCCGG - Intronic
1118166404 14:63340687-63340709 CATCAAAGGTGAGCAGGGTCCGG + Intergenic
1118615437 14:67571906-67571928 CAGAGAAGGGGAGCAGGGGCAGG + Intronic
1121044717 14:90779211-90779233 CACTTCAGGCCAGCAGGGCCAGG - Intronic
1121509743 14:94503521-94503543 CACGGAAGGGGAGGAGGACCAGG - Intronic
1121775959 14:96591030-96591052 CACCCAGGGCCTGCAGGGCCAGG - Intergenic
1122238497 14:100346238-100346260 CATGGAAGGAGAGCAGGGCAGGG + Intronic
1122882273 14:104695478-104695500 CACTGAGGGTGTGCAGGGCCTGG - Intronic
1122955816 14:105070478-105070500 GAGCGAAGGAGAGCAGGGCACGG + Intergenic
1123019661 14:105391721-105391743 CACCGACGGGGAGGAGGGCGGGG - Exonic
1123068007 14:105627884-105627906 CGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123068096 14:105628198-105628220 CGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1126099063 15:45108839-45108861 GCCCAAAGGCCAGCAGGGCCTGG + Exonic
1126373534 15:47971716-47971738 CACCGAAGTAGGGCAGGGCAGGG + Intergenic
1129483161 15:75843600-75843622 CGCGGAAGGGGAGCCGGGCCCGG - Exonic
1131368081 15:91856178-91856200 CAGCGAAGGCTAGAAGTGCCAGG - Intronic
1133035017 16:3029571-3029593 CGACGACGGCGACCAGGGCCAGG - Exonic
1133977443 16:10609406-10609428 CACAGAAGGCAGGCAGGGTCCGG + Intergenic
1136656497 16:31712349-31712371 CCCAGAAGGCGTGCAGTGCCGGG + Intergenic
1136656852 16:31714436-31714458 CCCAGAAGGCGTGCAGTGCCAGG + Intronic
1137725425 16:50653555-50653577 CAGCCAAGGTGAGCCGGGCCTGG - Intergenic
1140427744 16:74875034-74875056 CCCCGACGGCTGGCAGGGCCTGG + Intronic
1142135569 16:88450487-88450509 CTCCCAGGGAGAGCAGGGCCTGG - Intergenic
1142684937 17:1572213-1572235 CAAGGAAGGGGAGCAGGCCCAGG - Intronic
1142687752 17:1587502-1587524 CAAGGAAGGGGAGCAGGCCCAGG - Intronic
1143108941 17:4542898-4542920 GCCCGCAGGTGAGCAGGGCCTGG - Exonic
1144519632 17:15945196-15945218 TACCGAAGGCGCGCCGGGCGAGG - Exonic
1145251756 17:21300651-21300673 CCGTGAAGGTGAGCAGGGCCTGG + Exonic
1147139375 17:38452784-38452806 CCAGGAAGGCGAGCAGGGCAGGG + Intronic
1147257973 17:39193495-39193517 CCCCCTAGGCCAGCAGGGCCAGG - Intronic
1147357814 17:39911367-39911389 CACTCAAGGAGAGCAAGGCCAGG + Intronic
1147389246 17:40099280-40099302 CCCCGAACGATAGCAGGGCCAGG + Intronic
1148127487 17:45244304-45244326 CATTGCAGGTGAGCAGGGCCTGG - Intronic
1151500364 17:74484297-74484319 CCCCGAGGGCCAGCAGGGCTGGG + Exonic
1151714248 17:75823423-75823445 CGGAGAAGGCGGGCAGGGCCTGG - Exonic
1152225265 17:79089967-79089989 CACCGTGGGCGCCCAGGGCCAGG - Intronic
1152643575 17:81458962-81458984 CGCCCTAGGTGAGCAGGGCCAGG + Exonic
1158326947 18:56322677-56322699 CACAAATGGGGAGCAGGGCCCGG - Intergenic
1158588668 18:58762160-58762182 CACTGAAGGACAGCAGGCCCGGG + Intergenic
1158934780 18:62354497-62354519 CACCGAGTGCGCGCCGGGCCTGG + Exonic
1163053315 19:14701047-14701069 AACCAAGGGCGAGGAGGGCCTGG - Intronic
1163155923 19:15439928-15439950 CCCCGCAGGCCAGCGGGGCCAGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165827016 19:38711354-38711376 CTCAGAAGGTGAGCTGGGCCAGG + Intronic
1167253935 19:48415922-48415944 CACGGACGGCGAGCAGAGACGGG - Intronic
1167454408 19:49591053-49591075 GACTGAGCGCGAGCAGGGCCTGG - Intergenic
1168213116 19:54906202-54906224 CACCGACGCAGAGCAGGGCAGGG - Exonic
1168221734 19:54965346-54965368 CTCCGCCGGCGAGTAGGGCCAGG + Exonic
1168221899 19:54966436-54966458 CTCCGCCGGCGAGTAGGGCCAGG + Intronic
1168350986 19:55675368-55675390 CACCGAGGCCGAGCGGGGCAGGG + Intronic
925730617 2:6917601-6917623 CACCGCGGACGAGCAGGCCCAGG + Exonic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
927844859 2:26466111-26466133 CACTGAAGATGAGCAGGGCATGG - Intronic
932620851 2:73264252-73264274 CACAGAAGGCAGGCAGGGGCAGG + Intronic
938408844 2:131047404-131047426 CGCCTAAGGCGAGCAGGGCCAGG + Intergenic
947678448 2:232007089-232007111 GGCAGAAGGGGAGCAGGGCCAGG + Intronic
948076933 2:235172339-235172361 CACCGGAAGCGAGCAGGCCCAGG - Intergenic
948207170 2:236168426-236168448 CACGTGAGGCGAGCCGGGCCAGG - Intergenic
948494760 2:238340142-238340164 GACCCTAGGGGAGCAGGGCCAGG - Intronic
948840267 2:240645304-240645326 CACCCCAGGGGAGCAGAGCCAGG - Intergenic
1169421412 20:5463667-5463689 CACAGAAGGCGAGCAGAAGCAGG - Intergenic
1173728391 20:45312388-45312410 CACCGATCGTGAGCAGGGCGGGG + Exonic
1175553652 20:59832716-59832738 CACCGAGGCTGAGCAGGGGCAGG - Intronic
1175989120 20:62778811-62778833 CACCGGAAGCCAGCAAGGCCGGG - Intergenic
1175992453 20:62796553-62796575 CGCCGCAGGCGACAAGGGCCCGG + Exonic
1178007033 21:28233889-28233911 CACAGAAGGCGAGCAGAAGCAGG + Intergenic
1178801883 21:35803244-35803266 CACCAAAAGCGAGCAGGGGTAGG + Intronic
1179150504 21:38805379-38805401 CACCGAAGGGCAGCCGGGCTTGG - Exonic
1180142902 21:45903107-45903129 CATCTGAGGCCAGCAGGGCCTGG + Intronic
1180593736 22:16960790-16960812 CAGGGAAGGAGGGCAGGGCCAGG - Intergenic
1184356215 22:43981142-43981164 CACCGAAGGCGAGCAGGGCCCGG - Intronic
1184468680 22:44683563-44683585 CCCCGAAGGAGGGCAGGGGCTGG + Intronic
1184663364 22:45975731-45975753 CACAGTAGGCGCGCAGGGCGCGG + Intronic
1184831937 22:46994340-46994362 CACAGCAGGTGGGCAGGGCCCGG - Intronic
1185008779 22:48301460-48301482 CACCGAAGTCCTCCAGGGCCAGG + Intergenic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
954831305 3:53423554-53423576 AACAGAAGGCAAGCAGGGCAGGG - Intergenic
962261842 3:133915368-133915390 CAAGGAAGGCCAGCAGGACCTGG - Intergenic
968520781 4:1033842-1033864 CACCGAGGGCCAGAGGGGCCAGG - Intergenic
968958856 4:3732614-3732636 CACCAAAGGGCAGCACGGCCCGG + Intergenic
969334850 4:6501755-6501777 GACTGAGGGCCAGCAGGGCCAGG - Intronic
969416990 4:7067531-7067553 CAGCGAGGCCGAGCCGGGCCGGG - Intronic
979704228 4:123702021-123702043 CACCGAGGAGGAGCAGGGTCAGG + Intergenic
980223381 4:129948287-129948309 CACGGAGGGCAAGCAGGGGCAGG - Intergenic
983485987 4:168331649-168331671 CACAGAAGGCGAGCAGAAGCAGG - Intergenic
990742082 5:58922630-58922652 CCTCGTAGGCGGGCAGGGCCTGG - Intergenic
994355891 5:98793402-98793424 CATCGATGACGGGCAGGGCCAGG + Exonic
997934094 5:138095752-138095774 CACTGAAGGCAAGCAGAGCCTGG + Intergenic
999311081 5:150552652-150552674 AACCCAAGGCGGGCAGGGCCAGG - Intronic
1001896363 5:175385318-175385340 CACAGAAGGAGAGGAGGGCATGG - Intergenic
1002098786 5:176847183-176847205 CAGCGAAGACCACCAGGGCCTGG - Intronic
1003525943 6:6897498-6897520 CAGGGCAGGCAAGCAGGGCCAGG - Intergenic
1004948593 6:20643214-20643236 CACTGAAGGAAAGAAGGGCCAGG - Intronic
1006060423 6:31414627-31414649 CTCTGAAGGAGAGGAGGGCCTGG + Intronic
1006419710 6:33925437-33925459 GACCGGAGGCGAGCAGCCCCTGG - Intergenic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1019559295 7:1647995-1648017 CCCCCAAGGCGGGCAGGCCCTGG - Intergenic
1020210500 7:6154665-6154687 CACCGAGGGCGAGCGTGGCTGGG + Exonic
1025239124 7:57256843-57256865 CACCGACCGCGAGGAGGCCCGGG + Intergenic
1025958260 7:66199154-66199176 CAAAGAAGGCCAGCAGGGCACGG - Intergenic
1028991170 7:97050751-97050773 CATGGAAGGCGAGCAGAGGCAGG + Intergenic
1029475279 7:100779671-100779693 CCCCGAAGGCTTGCAGAGCCTGG - Exonic
1033012794 7:137640343-137640365 CAGCCAAGGAGAGAAGGGCCAGG + Intronic
1036674399 8:10818088-10818110 TACAGACGGAGAGCAGGGCCTGG + Intronic
1049420676 8:142515185-142515207 CAGGGAAGGCGTGCAGGGCAGGG + Intronic
1049465835 8:142750935-142750957 CACGGAAGGCGGGCAGGGCTGGG - Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1054907675 9:70424999-70425021 CAGTGAAGGTGAGAAGGGCCGGG - Intergenic
1056222490 9:84464162-84464184 CAGCCAAGCCGCGCAGGGCCAGG - Intergenic
1056755787 9:89381283-89381305 CACAGAAGGCCAGCGGGGCCTGG + Exonic
1057277452 9:93683627-93683649 CACTGAGAGCCAGCAGGGCCAGG + Intergenic
1057747201 9:97761876-97761898 TCCCAAAGGCGAGGAGGGCCAGG + Intergenic
1060198529 9:121638625-121638647 GGCCAAAGGCCAGCAGGGCCAGG + Intronic
1060312745 9:122477419-122477441 CACAGAAGGAAAGCTGGGCCAGG + Exonic
1062165397 9:135105031-135105053 CACAGATGGGGAGCATGGCCTGG + Intronic
1062715658 9:138008900-138008922 CCCCAAATGCCAGCAGGGCCTGG + Intronic
1203784420 EBV:119480-119502 AACCAAAGGCGAGTAGGGCCAGG + Intergenic
1186739790 X:12505430-12505452 AAAAGAAGGAGAGCAGGGCCAGG + Intronic
1187773397 X:22728645-22728667 CACCAAAAGTGAGCAGGGGCAGG - Intergenic
1188130100 X:26420065-26420087 CACCGAGGGCGAGCAGAAGCAGG - Intergenic
1189009936 X:37036850-37036872 CACCTGAGGCAAGCTGGGCCAGG + Intergenic
1189038639 X:37518865-37518887 CACCTGAGGCAAGCTGGGCCAGG - Intronic
1189787517 X:44572592-44572614 CAACAAAGGAGAGCAGGGCAGGG + Intergenic
1190109770 X:47582467-47582489 CACCAGAGGTAAGCAGGGCCCGG + Exonic
1192770250 X:74181809-74181831 GACCGAATTCCAGCAGGGCCTGG + Intergenic
1200098033 X:153673311-153673333 CCCCGAAGGCGACCAGCGCCTGG + Intronic
1200413045 Y:2880273-2880295 CACCTAAGGCCAGGAGAGCCTGG + Intronic