ID: 1184358264

View in Genome Browser
Species Human (GRCh38)
Location 22:43996868-43996890
Sequence ACTGAAGCAAAGACGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184358260_1184358264 1 Left 1184358260 22:43996844-43996866 CCCAAACCGTGTAACATTAGGGA No data
Right 1184358264 22:43996868-43996890 ACTGAAGCAAAGACGGAGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 154
1184358261_1184358264 0 Left 1184358261 22:43996845-43996867 CCAAACCGTGTAACATTAGGGAC No data
Right 1184358264 22:43996868-43996890 ACTGAAGCAAAGACGGAGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 154
1184358262_1184358264 -5 Left 1184358262 22:43996850-43996872 CCGTGTAACATTAGGGACACTGA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1184358264 22:43996868-43996890 ACTGAAGCAAAGACGGAGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184358264 Original CRISPR ACTGAAGCAAAGACGGAGCC TGG Intronic
900922906 1:5685011-5685033 ACTGAAGCCAGGAGGGAGGCTGG + Intergenic
901571684 1:10166016-10166038 ACTGAAAGAAAGGCAGAGCCAGG - Intronic
905518282 1:38578239-38578261 ACGGAAGTAAAGACAGAGACCGG + Intergenic
905733760 1:40312756-40312778 ACTGGAGCCAAGGGGGAGCCTGG - Exonic
906002756 1:42441206-42441228 ACTGAAGCAGAGTCTGAGCTGGG + Intronic
910232213 1:84997919-84997941 AGTGAAGAAAAGAAGGGGCCAGG - Intergenic
912931145 1:113963341-113963363 AGTGAAACAAACACGGAGGCAGG - Intronic
919138841 1:193544609-193544631 ACTGAAGGAAACAGGGAGGCTGG + Intergenic
921402240 1:214738274-214738296 ACTGAAGAAGAGATGGAGGCTGG + Intergenic
922798016 1:228351131-228351153 CCAGAAGCCAAGACAGAGCCTGG - Intronic
924805348 1:247357318-247357340 ACTTAAGCATAGAAGGAGGCGGG - Intergenic
1064080042 10:12301048-12301070 ACAGAAGCAGTGACAGAGCCAGG + Intergenic
1065700757 10:28423303-28423325 ACAGAATCAAAGGCAGAGCCTGG - Intergenic
1069887406 10:71632689-71632711 ACTGAGGTAAAGATGGAACCTGG - Intronic
1070095527 10:73334515-73334537 ACAAAAGGAAAGACGGAGCCTGG + Intronic
1070521303 10:77255945-77255967 CCTGATGCAAAGAAGGAGCCTGG + Intronic
1073930651 10:108570582-108570604 ACTGAAGAAATGATGAAGCCAGG + Intergenic
1074311530 10:112327110-112327132 CAGGAAGCAAAGATGGAGCCAGG + Intergenic
1079162190 11:18005603-18005625 ACCGTGGCAAAGAGGGAGCCTGG + Intronic
1081756170 11:45546265-45546287 AATGAAGTATAGACAGAGCCAGG - Intergenic
1083022449 11:59520923-59520945 ACTGGAACAAGGATGGAGCCAGG - Intergenic
1083622597 11:64056498-64056520 ACGGACGGAGAGACGGAGCCTGG + Intronic
1083642962 11:64155379-64155401 ACAGAAGAAAAGGCGCAGCCTGG - Intronic
1084445991 11:69204121-69204143 ACTGAGGCCCAGAAGGAGCCAGG + Intergenic
1087269866 11:96100161-96100183 ACTGGAGCAGACATGGAGCCAGG + Intronic
1087496563 11:98897942-98897964 CCAGAAGCAAAGCCTGAGCCAGG + Intergenic
1089267672 11:117277674-117277696 ACTGAAGAAAAGTGGGGGCCAGG + Intronic
1093737549 12:22638804-22638826 AATGAAGCAAATACGGATTCTGG - Intronic
1102011390 12:109620940-109620962 TCTCAAGCAACGACGGAGCCAGG - Intergenic
1102256846 12:111420467-111420489 CCTGAGTCAAAGATGGAGCCTGG - Intronic
1102301860 12:111777152-111777174 ACAGCAGCAAAGGCAGAGCCAGG - Intronic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1102711037 12:114927192-114927214 AATGAATCAAAGACAGAGCCAGG + Intergenic
1103953659 12:124565438-124565460 ACAGATGCAAAGACTGAGTCAGG - Intronic
1108013800 13:46052307-46052329 ACTCAAGCAAAGACGGGGGGGGG + Intronic
1108861754 13:54869096-54869118 ACTGCAGCAAAGAGGAACCCAGG - Intergenic
1110751782 13:79123224-79123246 ATTGAAGCAAAGCTGGAACCTGG - Intergenic
1112154713 13:96804648-96804670 ACTGAAGGAAGGAAGGACCCTGG - Intronic
1112381669 13:98896773-98896795 AATGAGGCAAAGAGGGAGCAAGG - Intronic
1113910402 13:113838721-113838743 ACTGGAGCAGGGAAGGAGCCGGG + Intronic
1116228401 14:42182948-42182970 ACTGAAGCAAAGAAAGAGGGAGG - Intergenic
1117036508 14:51735253-51735275 AATAAAGCAAAGAGGCAGCCAGG + Intergenic
1118915002 14:70095413-70095435 ACTGAGGCACAGAAGGAACCTGG - Intronic
1119935248 14:78586359-78586381 ATTGAAGGAAAGATGGTGCCAGG + Intronic
1121499394 14:94421582-94421604 ACTGAAACAAACAGGGAGACAGG - Intergenic
1121694300 14:95900368-95900390 ACTGGAGCAGAGACGGCACCAGG + Intergenic
1122065001 14:99166726-99166748 CCTAAAGCAAAGACTGAGCCGGG - Intergenic
1122328745 14:100898981-100899003 ACTGAGGCAAAGTCAGACCCAGG - Intergenic
1202921520 14_KI270723v1_random:33413-33435 ACGGAGGGAAAGACAGAGCCAGG + Intergenic
1202923396 14_KI270724v1_random:4167-4189 ACGGAGGGAAAGACAGAGCCAGG - Intergenic
1123723643 15:23081622-23081644 ACTGCAGAACAGAAGGAGCCTGG + Intergenic
1126111810 15:45179648-45179670 GCTGAGGCAGAGACTGAGCCCGG + Intronic
1128636024 15:69302930-69302952 AATGAAGCAAAGAAGAAGCAGGG - Intronic
1128944256 15:71810672-71810694 ACTGAGGCAAAGGCTGGGCCAGG + Exonic
1129862916 15:78876744-78876766 TCTGAATTAAAGACGGAGACTGG - Intronic
1130697568 15:86145964-86145986 AGTAAAGCAAAGAGTGAGCCAGG + Intronic
1132357210 15:101180652-101180674 ACTGAAGCAAAGAAGTAACCTGG + Intronic
1132374309 15:101318655-101318677 ACTGGGTCAAGGACGGAGCCTGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135390063 16:22085015-22085037 ACTGAAGCAAAGATGGACTTGGG - Intronic
1136723551 16:32341063-32341085 ACTGATGCCAAGAAAGAGCCAGG + Intergenic
1136841882 16:33547108-33547130 ACTGATGCCAAGAGAGAGCCAGG + Intergenic
1140135947 16:72205604-72205626 AATGATGCAAAGACAGAGCATGG + Intergenic
1140862619 16:79031364-79031386 CCTGAAGAAAAGAAGGAGGCAGG - Intronic
1141822156 16:86453921-86453943 ACGGAGGCAAAGGCTGAGCCTGG - Intergenic
1203002881 16_KI270728v1_random:176702-176724 ACTGATGCCAAGAAAGAGCCAGG - Intergenic
1203134486 16_KI270728v1_random:1713108-1713130 ACTGATGCCAAGAAAGAGCCAGG - Intergenic
1203152047 16_KI270728v1_random:1847405-1847427 ACTGATGCCAAGAGAGAGCCAGG + Intergenic
1143120354 17:4602828-4602850 GGTGAAGAAAAGAGGGAGCCAGG + Intronic
1146829388 17:36055077-36055099 ACTGAATCCAAGAGGAAGCCAGG - Intergenic
1147503049 17:40984278-40984300 CCAGAAGCAAAGACAGAGACTGG + Exonic
1148148721 17:45383501-45383523 ACAGAAGCAAAGGCGGAGGAGGG + Intergenic
1150293491 17:63995378-63995400 ACTGAAGCAAGGCTGGAGGCAGG - Intergenic
1159479055 18:68963578-68963600 AGTGAAGAACAGATGGAGCCAGG - Intronic
1161217355 19:3101088-3101110 ACAGAAGAGAAAACGGAGCCTGG - Intronic
1161719460 19:5895025-5895047 ACTGATGCACAGAGGGAGGCCGG + Intronic
1163583603 19:18152741-18152763 ACTGAAGCATAGATGGTTCCAGG - Intergenic
1164194556 19:22944656-22944678 ACTGAAGTATAGACTCAGCCAGG - Intergenic
1168105390 19:54162973-54162995 CCTGAAGGAAAGATGGAGCTGGG - Intronic
1168293799 19:55369446-55369468 CCAGAAGCCAGGACGGAGCCCGG + Intronic
926120869 2:10240635-10240657 ACTGAGGCAAGCACGGGGCCTGG + Intergenic
927737817 2:25537809-25537831 AAGGAAGCAAAGAGGGAGCGAGG + Intronic
929563334 2:42969336-42969358 ACTGCAGCAAAGACAGTCCCTGG + Intergenic
934985880 2:98884206-98884228 ACTGAGTCCAAGAGGGAGCCTGG + Intronic
935503737 2:103873238-103873260 CCTAAAACAAAGATGGAGCCAGG + Intergenic
937040061 2:118814090-118814112 ACTGCAGCAAAGCCGGACCCAGG - Intergenic
941084099 2:161096568-161096590 ACTGAAACAAAGAATGAGCTTGG + Intergenic
941236158 2:162976910-162976932 TGTGAAGCAAAGAGGGAGCCAGG - Intergenic
944311328 2:198236991-198237013 GCTGCAGCAAGGAAGGAGCCAGG + Intronic
944978044 2:205080104-205080126 ACTGAAACAAAATAGGAGCCAGG - Intronic
945331554 2:208545688-208545710 ACTTAAGCAAAGACAGAAGCTGG + Intronic
945989933 2:216387403-216387425 ACTGAAACAGTGAAGGAGCCAGG - Intergenic
948284413 2:236772661-236772683 ACTTTAGCAAAGACTGAGGCAGG - Intergenic
948876860 2:240834036-240834058 ACTGCAGCAAAGGGGCAGCCAGG + Intergenic
1169018347 20:2309938-2309960 ACTGAATCAATGACAGAGCAAGG - Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1170048675 20:12115119-12115141 AGGGAAGCAAAGACAGAGCAGGG + Intergenic
1175520599 20:59600223-59600245 TCTGGAGCAGAGAGGGAGCCTGG - Intronic
1180078467 21:45475275-45475297 ACTGAAGCTCAGATGGTGCCTGG + Intronic
1182646617 22:31815221-31815243 GCTGAAGCACAGACAGAGCCAGG + Intronic
1183241084 22:36658874-36658896 ACTGAAGATAAGATGGAGCCTGG + Intronic
1183322161 22:37171581-37171603 TCTGAAGGAAGGAGGGAGCCAGG + Intronic
1184358264 22:43996868-43996890 ACTGAAGCAAAGACGGAGCCTGG + Intronic
950494680 3:13326658-13326680 ACTTAAGCAAAGAAGGACACTGG - Intronic
950659464 3:14457927-14457949 CTTGAAGCAAACACAGAGCCAGG - Intronic
951252881 3:20415054-20415076 TCTGAAGCAAAGACTGAACATGG - Intergenic
952652087 3:35738873-35738895 GCTGTTGCAAAGATGGAGCCAGG - Intronic
954590662 3:51778844-51778866 GTTGGAGCAAAGACGGCGCCTGG - Exonic
954625928 3:52021850-52021872 ACTGAACCAGAGACACAGCCGGG - Intergenic
955609672 3:60743797-60743819 ACTGAAGCAAGGAAGGAGAAAGG + Intronic
963785750 3:149532863-149532885 GCTGAAGCAAAGACAAAGACAGG + Intronic
964791131 3:160453652-160453674 ACAGAAGGACAGACGGACCCAGG + Intronic
969238619 4:5885546-5885568 ACTGAAGGAAAGACGGCCTCGGG - Intronic
970609113 4:17709223-17709245 CCTGAAACCAAGTCGGAGCCAGG - Exonic
972704658 4:41530485-41530507 ACTGGAGGAGAGACCGAGCCCGG - Intronic
976050916 4:81010548-81010570 ACTGAATCAAACACTGAGCCAGG + Intergenic
984555182 4:181205185-181205207 TCAGAAGGAAAGACGAAGCCAGG + Intergenic
984726797 4:183029368-183029390 ACTGAAGCAATGATGTAGCTGGG + Intergenic
985523442 5:389867-389889 AATGAAGAAAAGACAGAGGCAGG + Intronic
985770732 5:1808589-1808611 AGAGAAGCAAAGACGAAGCTGGG - Intronic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
987199354 5:15558994-15559016 AATGTACCAAAGACGGTGCCTGG + Intronic
988907561 5:35804805-35804827 AATTAAGCAAAGAAGGAACCTGG - Intronic
989359035 5:40578505-40578527 CCTGAAGCTAAGAGGGAGCGTGG + Intergenic
990834251 5:59998008-59998030 TCTGAAGCAAGGCTGGAGCCAGG - Intronic
992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG + Intergenic
995072747 5:107943111-107943133 AGTCAAGCAATGACAGAGCCTGG - Intronic
1002138400 5:177122781-177122803 ACTGAGGCAAAGAAGGTGCGGGG - Intergenic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1005844044 6:29763549-29763571 ACTGAAGCAAAGCCCAGGCCTGG - Intergenic
1009055760 6:58332898-58332920 ACTGCTGCAAAGACAGGGCCTGG - Intergenic
1009235411 6:61117697-61117719 ACTGCTGCAAAGACAGGGCCTGG + Intergenic
1013972459 6:116038102-116038124 ACAGAAGCAAAATGGGAGCCAGG + Intronic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1014665161 6:124228638-124228660 ACTGCAGCCAAGTGGGAGCCAGG - Intronic
1015581712 6:134732021-134732043 AATGAAGCAAACCCGGAGACTGG + Intergenic
1016819686 6:148335590-148335612 ACTGAAGCAAGAAAGGAGCAGGG + Intronic
1016823256 6:148365652-148365674 ACTGAAGGAGAGATGGAGCTAGG + Intronic
1018653133 6:166007820-166007842 ACCCCAGCAAAGAAGGAGCCAGG + Intergenic
1019164853 6:170091370-170091392 ACAGAAGCAAAGACAATGCCAGG + Intergenic
1019276325 7:177855-177877 ACAGGAGCACAGAGGGAGCCTGG - Intergenic
1022141000 7:27492627-27492649 ACAGAAGAAACGAGGGAGCCCGG - Intergenic
1024529201 7:50376800-50376822 ACTAAAGGAAAAACTGAGCCAGG - Intronic
1032404332 7:131644783-131644805 AGTTTATCAAAGACGGAGCCAGG - Intergenic
1033542826 7:142372856-142372878 ACTGAGTCAAACACGGAGCTAGG + Intergenic
1034239495 7:149598946-149598968 ACTGCAGGAAAAAGGGAGCCGGG + Intergenic
1035064848 7:156097021-156097043 ACTGAAGCAAACACGGACCTGGG + Intergenic
1035070681 7:156143295-156143317 ACGGAAGCGCAGACGGAGGCCGG - Intergenic
1035783000 8:2243725-2243747 ACTGAAGCAAAGGCTGTCCCTGG - Intergenic
1036198502 8:6745266-6745288 ACTGAGGCAACGATGGAGACAGG - Intronic
1036771153 8:11579133-11579155 GTTGAAGCAAAGGGGGAGCCAGG - Intergenic
1037871534 8:22501931-22501953 ACTGAAGGATAGATTGAGCCTGG + Intronic
1041473163 8:58233797-58233819 TCTGAAGGAAAGAGGGAGCAAGG + Intergenic
1042892793 8:73631759-73631781 ACTGAAGCCAAGAAAAAGCCTGG + Intronic
1043359265 8:79451916-79451938 ACTGAAGCAGGGAAGGAGCAGGG + Intergenic
1044236131 8:89832562-89832584 ACTGAATGAAAGAGGCAGCCTGG - Intergenic
1046746258 8:117879336-117879358 AGTGAAACAAAAACAGAGCCTGG + Intronic
1049536073 8:143183114-143183136 ACAGGAGCAAACACAGAGCCTGG - Intergenic
1049570046 8:143365415-143365437 ACTGAACCAGAGAGGCAGCCAGG - Intergenic
1052082400 9:24223422-24223444 ACAGAAGAAAAGAAGGGGCCGGG - Intergenic
1053114778 9:35490691-35490713 ACTGAAGCAACGCCGGCGCCGGG - Intronic
1059260471 9:112971255-112971277 ATTGAAGGAAAGAGGGAGGCAGG + Intergenic
1060598170 9:124860670-124860692 ACTGAAGCAAACAACGAGCCAGG + Intronic
1060897748 9:127229117-127229139 ACTTAAGCATAAACAGAGCCAGG - Intronic
1062349671 9:136132769-136132791 ACTGAGGCACAGAGAGAGCCAGG - Intergenic
1188059620 X:25585030-25585052 ACTGAATAAAAGACACAGCCAGG - Intergenic
1189203064 X:39214556-39214578 ACTGGAGCAAAGACAGGGCTTGG + Intergenic
1197159168 X:123304515-123304537 ACTGAATAAGAGAAGGAGCCTGG - Intronic
1198595269 X:138229262-138229284 TCTGAGGCAAAGAGGGAGACAGG - Intergenic
1200069729 X:153522250-153522272 CCTGAAGCAAACACAGAGCCTGG - Intronic
1200582696 Y:4969702-4969724 ACAGAAACAAAGATGGAGCAAGG + Intergenic