ID: 1184358282

View in Genome Browser
Species Human (GRCh38)
Location 22:43997022-43997044
Sequence CTTGCTGGGCTGCGTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184358276_1184358282 13 Left 1184358276 22:43996986-43997008 CCTCTTGTAGTCTGGAGATCAGA 0: 1
1: 0
2: 2
3: 12
4: 115
Right 1184358282 22:43997022-43997044 CTTGCTGGGCTGCGTCCTCCTGG 0: 1
1: 0
2: 0
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184358282 Original CRISPR CTTGCTGGGCTGCGTCCTCC TGG Intronic
900179387 1:1304633-1304655 CCAGCTGGTCTGGGTCCTCCTGG - Intronic
900617472 1:3571843-3571865 CTGGGTGTGCTGGGTCCTCCTGG + Intronic
900617501 1:3571938-3571960 CTGGGTGTGCTGGGTCCTCCTGG + Intronic
900617561 1:3572171-3572193 CTGGGTGTGCTGGGTCCTCCTGG + Intronic
900617584 1:3572268-3572290 CTGGGTGTGCTGGGTCCTCCTGG + Intronic
900617596 1:3572307-3572329 CTGGGTGTGCTGGGTCCTCCTGG + Intronic
900617641 1:3572480-3572502 CTGGGTGTGCTGGGTCCTCCCGG + Intronic
901678455 1:10900129-10900151 CCAGCTGGGCTGCCTCCCCCAGG - Intergenic
902837950 1:19058753-19058775 CTGACTGTGCTGTGTCCTCCAGG + Intergenic
904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG + Intronic
904285924 1:29453262-29453284 CCTGCTGGACTCCGACCTCCAGG - Intergenic
908742602 1:67343989-67344011 CTTGCTGGACTGTGAGCTCCAGG - Intronic
910771492 1:90836172-90836194 CTGGTTGGGCCGCGACCTCCGGG - Intergenic
911069575 1:93821996-93822018 CTTGCTTGGCTCCTGCCTCCAGG - Intronic
912975285 1:114324113-114324135 CTTGGTGGGCTGTGTCCTGCTGG - Intergenic
916018988 1:160776563-160776585 CTTGCTCTGCTGGGACCTCCAGG + Intergenic
920385738 1:205569261-205569283 CCTGCTGGGCAGCGCCCTCGGGG + Exonic
920914792 1:210251365-210251387 CTTGCAGGGCCGCGCCCCCCGGG - Intergenic
921046416 1:211481076-211481098 CTTGCTGGGCTGCAGGCTCCAGG - Intronic
923357372 1:233172691-233172713 CTTCCTGCCCTGCTTCCTCCAGG + Intronic
924801043 1:247329966-247329988 CTTGGGTGGCTGGGTCCTCCTGG + Exonic
1064121287 10:12622289-12622311 CTTGCTAGGCTGCCTTCCCCTGG + Intronic
1064264820 10:13817376-13817398 CTTCCTGGCCTGCTTCTTCCAGG + Intronic
1066349555 10:34624786-34624808 CTGTCGGGGCTGCGTCCTCCAGG + Intronic
1067668973 10:48302571-48302593 ATTGCTGGGCTTCTTCCTCAAGG + Intergenic
1067837285 10:49649501-49649523 CCTGCTGCTCTGCGTCCTGCGGG - Exonic
1069818611 10:71213996-71214018 CTGGCTGGGCTGCGTCTTCTCGG + Intronic
1070279437 10:75037970-75037992 CTTGCTGGATGGCGTCCACCAGG + Exonic
1070744608 10:78925820-78925842 CTTACTGGGCTGTGCCCTCAAGG - Intergenic
1070794920 10:79210872-79210894 CTCTCTGGGCTCCCTCCTCCAGG - Intronic
1072125282 10:92440191-92440213 CTTGCTGGGCTTCCTCCTCTCGG + Intergenic
1073468119 10:103706242-103706264 CTTCCTGGGCTGCCTCCTGGTGG + Intronic
1075693593 10:124418286-124418308 CTTGGAGGGCTGGGTCCTCCCGG - Intronic
1076333825 10:129691748-129691770 CTTCCTGGGCTGGATCCTGCAGG + Intronic
1076362082 10:129896592-129896614 CGTGCTGGGGCGCGGCCTCCTGG + Intronic
1076451596 10:130560531-130560553 CTTGCCGGGCTGCAACCTCCTGG + Intergenic
1077103392 11:831978-832000 CTGACTGCACTGCGTCCTCCTGG + Exonic
1077311363 11:1890338-1890360 CGTGCGGGGCTGTGACCTCCTGG + Exonic
1078431189 11:11290024-11290046 CTGGCTGGGCTGTGGCCTCCAGG + Intronic
1078522300 11:12073247-12073269 TTGGCAGGGCTGCGTCCTCCAGG - Intergenic
1079011465 11:16832003-16832025 ATTGCTAGGCGGAGTCCTCCAGG + Intronic
1080691085 11:34558605-34558627 CTGGATGTGCTGGGTCCTCCAGG + Intergenic
1084120877 11:67068305-67068327 CTTCCTGGGCAGCCTCCCCCAGG - Intronic
1084673650 11:70622045-70622067 CTTGCTGGGCTGGCTGCCCCAGG + Intronic
1085186882 11:74583236-74583258 CTAGGTGAGCTGCCTCCTCCAGG + Intronic
1090377841 11:126303990-126304012 CTGGCTGGGCTGCTAACTCCCGG - Exonic
1091915612 12:4270347-4270369 CTGGCTGGGAGGCATCCTCCAGG + Intergenic
1095795049 12:46210105-46210127 CTGCGTGGGCTGCTTCCTCCTGG + Intronic
1097120066 12:56724827-56724849 CTGGCTGGGCTGGGGCCTCCTGG + Intronic
1100307228 12:93361972-93361994 GATGCTGGGCTGCATCCTGCAGG - Intergenic
1100433309 12:94549488-94549510 CCTTCTTGGCTGCATCCTCCAGG - Intergenic
1101997354 12:109534602-109534624 CACTCTGGGCAGCGTCCTCCGGG + Exonic
1104414347 12:128585493-128585515 CTTGCAGGACTGTGTCCTGCAGG + Intronic
1104554288 12:129786157-129786179 CATGCTGCCCTGCCTCCTCCAGG + Intronic
1104692646 12:130838806-130838828 CTTCCTGGGCGGAGTCCTCAGGG - Intronic
1105435355 13:20372786-20372808 CTTGCTGGATAGCGTCCTCCAGG - Intergenic
1107722075 13:43259435-43259457 CTTGCTGGGCTTAGTCCTGGTGG + Intronic
1108474164 13:50797222-50797244 CGTGCTGGGATTCATCCTCCAGG + Intronic
1108576939 13:51799012-51799034 CTTGCTGGGGTCCAGCCTCCAGG - Intronic
1110651751 13:77950346-77950368 CTTGCTGGGCTGAGTTCCTCAGG + Intergenic
1112009026 13:95278487-95278509 CTGTCTGGGCTTGGTCCTCCTGG - Intronic
1115752483 14:36506031-36506053 CTGGCTGGGCTGCACCCCCCAGG - Intronic
1122307128 14:100773275-100773297 CTGGCTGGGCTGCTGCCTCCAGG - Intergenic
1124433697 15:29630281-29630303 AATGCTGGGCTACTTCCTCCTGG + Intergenic
1130011340 15:80154943-80154965 CTGGCTGTGCTGCTGCCTCCTGG + Intronic
1132588214 16:715319-715341 CGCGCTGTGCTGCGGCCTCCTGG + Exonic
1133633235 16:7641857-7641879 ATTGTTGTGCAGCGTCCTCCAGG + Intronic
1134666417 16:16022176-16022198 CTGGCAGGGCTGGCTCCTCCAGG + Intronic
1135130754 16:19851927-19851949 CTTGGTGGTCTTCCTCCTCCTGG - Intronic
1135664214 16:24322279-24322301 CTGGCTGGGCGGTGTTCTCCCGG - Intronic
1135793986 16:25424052-25424074 CTTCATTGGCTGAGTCCTCCTGG + Intergenic
1136777392 16:32879198-32879220 CCTCCTGGGCTGCCTCCTCAGGG - Intergenic
1136893233 16:33982315-33982337 CCTCCTGGGCTGCCTCCTCAGGG + Intergenic
1137669629 16:50271755-50271777 GCTGCTTGGCTGTGTCCTCCAGG + Intronic
1140706986 16:77639946-77639968 TTGGCAGGGCTGCCTCCTCCTGG - Intergenic
1141687416 16:85578227-85578249 CTTGCTGTGCGGCTTCCCCCAGG + Intergenic
1142292564 16:89199729-89199751 GCTGCTGGGCTGTGTCATCCTGG - Exonic
1203079805 16_KI270728v1_random:1141307-1141329 CCTCCTGGGCTGCCTCCTCAGGG - Intergenic
1142755506 17:2014215-2014237 CATGCTGCTCTGTGTCCTCCAGG - Intronic
1143032649 17:3976465-3976487 CACGCTGGGCTGGGTTCTCCCGG + Intergenic
1143452228 17:7042981-7043003 CTCGCTGGGCTTCGTCTTCTCGG - Exonic
1144296856 17:13884566-13884588 ATTGCTGTGCTGCCTTCTCCTGG - Intergenic
1145053367 17:19681426-19681448 CATGCTGGCCTGTGTCTTCCTGG - Exonic
1145253820 17:21311921-21311943 CTTCCTGAGCTGGGTCCTGCTGG + Intronic
1146011683 17:29199607-29199629 CCTAGTGGACTGCGTCCTCCAGG - Intergenic
1146287014 17:31581033-31581055 CTTGCTTGTCTGAGTCCTCAGGG + Intergenic
1147614274 17:41819271-41819293 CTAGCTGGACAGCGTCCTTCGGG - Exonic
1147907536 17:43832885-43832907 CCTGCTGCTCCGCGTCCTCCGGG - Intronic
1149168892 17:53785824-53785846 CTTGCTGGGCTTGGTGCTACAGG + Intergenic
1151538107 17:74749835-74749857 CCTGCTGGACTTCATCCTCCCGG + Intronic
1151670269 17:75568421-75568443 AGAGCTGGGCTGCTTCCTCCTGG + Intronic
1152712239 17:81877853-81877875 TTTGCTGGGCTGAACCCTCCAGG + Intergenic
1152838840 17:82553355-82553377 CTGCCTGGGCTGTGGCCTCCAGG - Intronic
1152877181 17:82793576-82793598 CATGCTGGGCTGCACCCTGCAGG - Intronic
1152922666 17:83073663-83073685 CTGCCTGGGCTGAGTCATCCAGG + Intergenic
1153488753 18:5628453-5628475 CTGGCTGGGTTGGGTCCGCCTGG + Intronic
1156008417 18:32470392-32470414 CTCGCTGGGCTGCAGCCTCAAGG - Exonic
1156297706 18:35807986-35808008 TTTGCTGTGCTGGGACCTCCAGG - Intergenic
1157322805 18:46647203-46647225 CTGGCAGGGCTGGGACCTCCTGG - Intronic
1157441946 18:47718388-47718410 CTGGCTGGGCTGGTTCCTTCTGG + Intergenic
1159957015 18:74525918-74525940 CTTGCTGGACTGTGACCCCCAGG + Intergenic
1160987042 19:1843842-1843864 CGTCCTGTGCTGCCTCCTCCTGG - Intronic
1161028967 19:2049286-2049308 CCTGCTGGGCTGCTGCCTGCTGG + Intronic
1161046090 19:2135831-2135853 CTTGCTGGGCAGCTGCCACCTGG + Intronic
1162337626 19:10071414-10071436 GTCCCTGGGCTGCGCCCTCCAGG - Intergenic
1162958451 19:14112696-14112718 CTGGCTGGCCTGCGTGCCCCAGG + Intronic
1163594837 19:18214979-18215001 CTGGCTGGGCTGAGTCCACATGG - Intronic
1164401132 19:27903118-27903140 CTGGCTGGGCTGGAGCCTCCAGG + Intergenic
1164792875 19:31002934-31002956 CTTGCTGGGCTGGTGGCTCCTGG - Intergenic
1165949624 19:39466763-39466785 CTGGCTGGGCTGGGTCCCCAGGG + Intronic
1166230422 19:41423144-41423166 CCTGCGGGACTGCTTCCTCCAGG - Exonic
1166384117 19:42370793-42370815 CCTGCAGGGCTACTTCCTCCTGG + Exonic
1167340495 19:48913028-48913050 CATGATGGGCTGCGTCGTACTGG - Exonic
1168148872 19:54434454-54434476 CTAGCAGGGATGGGTCCTCCAGG - Intronic
1168266329 19:55225619-55225641 CTTCCTGGTCCCCGTCCTCCAGG + Intergenic
925695460 2:6572843-6572865 CTCGCTGGGCTGTGAGCTCCAGG + Intergenic
926131273 2:10304285-10304307 CGAGCTGAGCTGCATCCTCCCGG - Intronic
926719092 2:15945631-15945653 CTCGCTGGACTGAGCCCTCCCGG - Exonic
927157275 2:20228112-20228134 CTGGCTGGGCTGCCTCCTAGAGG - Intergenic
929795236 2:45053988-45054010 CTTGCTGGCCAGCGCTCTCCAGG + Intergenic
931614116 2:64138351-64138373 CTTGCTGTGCTACCTCCTTCAGG + Intronic
932331794 2:70901908-70901930 CTTCCTGGGCTCCCTCCTCCCGG + Intronic
937255793 2:120554582-120554604 CCTGCAGGGCTGCGTGTTCCTGG - Intergenic
938289597 2:130142276-130142298 CTGGCAGGGCTGGGTCCTCCCGG + Exonic
938466933 2:131530662-131530684 CTGGCAGGGCTGGGTCCTCCCGG - Exonic
938747050 2:134289280-134289302 ATTGCTGGGCTGCATGCTCTTGG + Intronic
942746524 2:179240602-179240624 CTTGCTGGACTGCTCCTTCCTGG - Intronic
944927626 2:204480975-204480997 CCTGGTGGGCTGCTTCCACCAGG + Intergenic
945980567 2:216307208-216307230 CCTGCGGGGCTGCCTCCTTCAGG - Intronic
946710848 2:222503845-222503867 TTTGCTGGGGTGAGTGCTCCAGG + Intronic
946908941 2:224442237-224442259 CTGGGGGGTCTGCGTCCTCCCGG - Intergenic
947538085 2:230953522-230953544 CTGGCAGGACTGTGTCCTCCTGG - Intronic
947712254 2:232322979-232323001 CTTGCTGCCCTGCTTGCTCCTGG - Intronic
947979872 2:234399615-234399637 GTGGGTGGGCTGCATCCTCCTGG + Intergenic
948795119 2:240398739-240398761 CTCGCTGGGCTCCGGCCACCCGG - Intergenic
948853642 2:240720131-240720153 CTTGGTGGGCAGGGTCCCCCAGG + Intronic
1170533328 20:17315780-17315802 CCTGCAGGGCTGCGGCGTCCTGG + Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1173335635 20:42110382-42110404 CCTTCTGGGCTTCGTCCGCCAGG - Exonic
1173364197 20:42370218-42370240 CTTCCTGGGCTGTTTCCCCCAGG - Intronic
1175257546 20:57656350-57656372 CTTGGTGGGCTGGGTTCTCTCGG + Intronic
1175711927 20:61228186-61228208 CTTGCTGGGCTGAAGGCTCCAGG - Intergenic
1175830901 20:61965247-61965269 TTCGCAGGACTGCGTCCTCCTGG + Intronic
1175978589 20:62725869-62725891 CTTCCTGGGCTGGGTGATCCTGG - Intronic
1176045265 20:63089405-63089427 CAGGCAGGCCTGCGTCCTCCCGG + Intergenic
1176059257 20:63165131-63165153 CTTCCTGGGCTGCCCCCACCCGG - Intergenic
1176098638 20:63355165-63355187 CTCTCTGAGCTGAGTCCTCCAGG - Intronic
1176370703 21:6060068-6060090 CTTGCTGGGCGGGTTCCTCAGGG - Intergenic
1179752816 21:43478473-43478495 CTTGCTGGGCGGGTTCCTCAGGG + Intergenic
1179774062 21:43648348-43648370 CCTGCTGGGCTTCATCCTCCTGG + Intronic
1180197641 21:46207228-46207250 CTTGCTGGGCTGTGTGCACAGGG - Intronic
1180944121 22:19680364-19680386 CTTGCGAGGCTGCTGCCTCCTGG - Intergenic
1181000765 22:19986919-19986941 CTGGCTGGGCTGCGTCAGGCTGG - Intronic
1183971694 22:41482260-41482282 CCAGGTGGGCTGAGTCCTCCAGG - Intronic
1184120316 22:42445763-42445785 CTGCCAGGGCTGGGTCCTCCAGG - Intergenic
1184228235 22:43143039-43143061 CGTGCTGGGCTACGACCTGCTGG - Exonic
1184358282 22:43997022-43997044 CTTGCTGGGCTGCGTCCTCCTGG + Intronic
1184609079 22:45590940-45590962 CCTGCTGGGTGGGGTCCTCCTGG - Intronic
1185038100 22:48489996-48490018 CTGGCTGGGCTCCGACCGCCGGG - Intronic
949264756 3:2143784-2143806 ATTGCTGTGCTGTGTCCTCCAGG + Intronic
950307594 3:11928403-11928425 CTTGCCAGGCTCCTTCCTCCTGG + Intergenic
950593030 3:13952685-13952707 CTTGCTGGGCTAAGTTCTTCAGG + Intronic
952211197 3:31231100-31231122 ACTTCTGGGCTGCGTCATCCAGG - Intergenic
953989819 3:47475634-47475656 CTTGCCGGCCTGCGGTCTCCAGG + Intronic
954419131 3:50409331-50409353 CTTGCTCTGCTGCCTCCTCCAGG - Intronic
955704546 3:61714689-61714711 CTTGCAGGGCTCCTTCCACCAGG + Intronic
956263815 3:67375770-67375792 CCTTCTTGGCTGCATCCTCCAGG + Intronic
961756802 3:129132656-129132678 CTTACTGGACTGCCTCCCCCTGG + Intronic
961816924 3:129555913-129555935 GTTTCTGGGCTGCAGCCTCCGGG + Exonic
962240332 3:133746461-133746483 CCTGCTGGTCTGCGCCGTCCTGG + Exonic
962863144 3:139423247-139423269 CTTGCTAGGCTGCCTTTTCCTGG - Intergenic
964010356 3:151885356-151885378 CTTGCTGGGCTCCGTGCTGGTGG - Intergenic
968509601 4:989597-989619 CGTGCTGGCCTGCGTCATCGTGG - Exonic
968911468 4:3478784-3478806 CCTGCTGGGCTGTATCCTCCTGG + Intronic
969655493 4:8495354-8495376 CACGCTGGGCTGCAGCCTCCTGG + Intergenic
969660734 4:8525935-8525957 CCTGCTGGGCTGCCATCTCCTGG + Intergenic
969662046 4:8536042-8536064 CTGGCTCGGCTGCTTCTTCCAGG + Intergenic
970319682 4:14862954-14862976 CTTGCTGGGCTGCGAGGTTCTGG - Intergenic
977020853 4:91757149-91757171 CTTGCTTGGGTGCTTCCTCTGGG - Intergenic
977908531 4:102503354-102503376 CTTCCTGGGCTGCAGCCTACTGG + Intronic
978703871 4:111681628-111681650 CCTGCTGGGCTGCATCCCCCAGG + Intergenic
979396150 4:120191967-120191989 CTTGCAGGGCTGCCATCTCCAGG + Intergenic
980163679 4:129198383-129198405 CTTGCAGGGCTGGTTCTTCCTGG - Intergenic
986319285 5:6614819-6614841 CTTGCTGGCCTGAGTCCACCGGG - Intronic
988934190 5:36066374-36066396 GTTCCTGGGCTGCCTTCTCCAGG - Intronic
991301406 5:65132562-65132584 GTTGATGGGCAGAGTCCTCCAGG - Intergenic
995208997 5:109515602-109515624 CTTTCTGGGCTGCATGCTCATGG + Intergenic
997466825 5:134093806-134093828 CTTCCTGGGCTCAGTCCTCTGGG - Intergenic
998171750 5:139876517-139876539 CTTCCTGGGCTTACTCCTCCCGG - Intronic
998667800 5:144318063-144318085 CTTGCTGTGATGCATTCTCCTGG + Intronic
999502307 5:152159751-152159773 CCTGCTGGGAGGTGTCCTCCAGG + Intergenic
999614965 5:153413540-153413562 CTTGCTGGACTCAGTGCTCCTGG + Intergenic
1001287690 5:170435732-170435754 CTTGCTGGGCTCCGTGCACGTGG - Intronic
1001953173 5:175830226-175830248 CTTGCTGGGCTGTGCTCCCCCGG - Intronic
1002431477 5:179206640-179206662 CTGGCTTGGCTGAGTCCTGCAGG - Intronic
1003498727 6:6686991-6687013 CTTCCTGGGCCTCCTCCTCCGGG + Intergenic
1006289165 6:33121245-33121267 CTTTCTGGGGGGCCTCCTCCTGG + Intergenic
1011633829 6:89352579-89352601 CTGGCTTGGCTCCGGCCTCCCGG + Exonic
1016666811 6:146651550-146651572 CTTGCAGACCTGCATCCTCCTGG - Intronic
1016767339 6:147809827-147809849 CTTGCTGGACTCCATCCCCCAGG + Intergenic
1017781235 6:157716986-157717008 CTTGCTGGGCTGCATTTTACTGG + Intronic
1017840621 6:158219418-158219440 CTTGCTGGGCAGAGACTTCCTGG + Intergenic
1018211877 6:161490071-161490093 ATTGCTGGTCTAGGTCCTCCTGG - Intronic
1018239970 6:161764016-161764038 CTTCCAGGACTGCATCCTCCAGG + Intronic
1018304473 6:162440634-162440656 CTTGCTGGGTGTCTTCCTCCTGG - Intronic
1018768989 6:166956134-166956156 CCTGCTGGGCTGCCTCTGCCTGG - Exonic
1018808644 6:167281271-167281293 CTTGGTGGGCATCCTCCTCCTGG - Intronic
1019145152 6:169971348-169971370 CTCCCGGGGCTGCGTGCTCCAGG - Intergenic
1019155083 6:170033280-170033302 CTTGCTGGGAGGGTTCCTCCGGG + Intergenic
1019729791 7:2623563-2623585 CTGGCAGGGCCGCCTCCTCCGGG - Intergenic
1024297568 7:47857690-47857712 CTTGCTGGGCACAGTCCTGCTGG - Exonic
1025106600 7:56175654-56175676 CCTGCTGGGCTGCCTCTGCCTGG + Intergenic
1025161455 7:56664838-56664860 CCTGCTGGGCTCTGCCCTCCTGG + Intergenic
1026380199 7:69791945-69791967 GTAGTTGGGCTGAGTCCTCCTGG + Intronic
1029367616 7:100126875-100126897 CTGGCTGGGCTCCAGCCTCCTGG - Exonic
1032683670 7:134209872-134209894 CTTTCTGAGCCGCCTCCTCCTGG - Intronic
1034286299 7:149885335-149885357 CTTGCTGGGGTGTGGTCTCCTGG - Intergenic
1034491445 7:151395174-151395196 CCTCCTGGGCTCCGTCCTCATGG - Intronic
1034841293 7:154400046-154400068 CTTGCTGGACAGAGACCTCCAGG + Intronic
1035006859 7:155669944-155669966 GTGGCTGGATTGCGTCCTCCAGG - Intronic
1036702071 8:11019478-11019500 GCTGCTGGGCTGCCTCCTCTGGG + Intronic
1040558873 8:48506157-48506179 TTGGCTGAGCTGCCTCCTCCAGG + Intergenic
1040605133 8:48924051-48924073 CTGGCTGGGCTGTGTCCACGTGG - Intergenic
1040982961 8:53264283-53264305 TTGGCTGGGCTGCTTCCTTCTGG - Intergenic
1041327160 8:56680456-56680478 CATGCTGGACTGTATCCTCCAGG - Intergenic
1042334917 8:67620009-67620031 TCCGCTGGGCTGCCTCCTCCAGG + Intronic
1046848954 8:118951791-118951813 CTTGCTGTGCTGCGCGCTCGTGG - Exonic
1048925151 8:139264893-139264915 CTTGCTGGGCTGCAACCTGAGGG - Intergenic
1049352783 8:142172959-142172981 CTGGCAGGGCTGGTTCCTCCTGG - Intergenic
1049526470 8:143129186-143129208 CCTCCTGGGCGCCGTCCTCCAGG + Intergenic
1049543514 8:143219040-143219062 CTGGCTGGGCTGCGTTTTCTTGG + Intergenic
1049799103 8:144509583-144509605 CTTGCCGGGCTGCCCCCTCCTGG + Exonic
1049967508 9:792655-792677 CTTCCTGGCCTGCCTCCACCTGG + Intergenic
1049988269 9:971627-971649 CCTGCTGGGCCCCGTCCGCCGGG + Intergenic
1056595825 9:88007017-88007039 CTGGCTGGACTGCGGCCTCAGGG - Intergenic
1056873836 9:90308807-90308829 CACGATGGGCTGCTTCCTCCGGG - Intergenic
1058110725 9:101028798-101028820 CTTCCTCCGCTGCCTCCTCCTGG - Exonic
1060848487 9:126856430-126856452 CTTCTTGGTCTGCGCCCTCCTGG - Intergenic
1061450495 9:130664653-130664675 CATGATGGGCTCCGTGCTCCCGG + Exonic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1062155233 9:135044589-135044611 CTGGCTGGGCTGCTTCCTTCTGG + Intergenic
1062162425 9:135087705-135087727 CTTGCCCGGCTGCGTCCCTCCGG - Intronic
1062180060 9:135186499-135186521 CGTGCAGGGCAGGGTCCTCCAGG - Intergenic
1062194657 9:135266278-135266300 CCTCCTGGGCTGCCTCCTCCTGG + Intergenic
1062491534 9:136807422-136807444 TGGGCTGGGCTGAGTCCTCCCGG + Intronic
1185765881 X:2725565-2725587 CTGCCTGGGCTCCTTCCTCCAGG + Intronic
1189284178 X:39840065-39840087 CTTCATGGGCTCCTTCCTCCAGG + Intergenic
1189845665 X:45134397-45134419 CTTGCTTGGCCGCTTCCTGCTGG + Intergenic
1190316986 X:49157365-49157387 CTGGCTGCCCTGCGTCCACCCGG - Intergenic
1197599305 X:128508569-128508591 TTTGCTGGGCTCCGTTCACCTGG - Intergenic
1199600543 X:149539160-149539182 CTTGCAGGGCTGAGCCCCCCAGG - Intergenic
1199650041 X:149940781-149940803 CTTGCAGGGCTGAGCCCCCCAGG + Intergenic
1200102462 X:153694847-153694869 CCTCCTGGGCTGCCTCCTCAGGG + Exonic
1200281529 X:154781111-154781133 CCAGCTGGGCTTCTTCCTCCAGG - Intronic
1201770369 Y:17612494-17612516 CTGTCTGGGCTGAGTCGTCCGGG - Intergenic
1201831185 Y:18293493-18293515 CTGTCTGGGCTGAGTCGTCCGGG + Intergenic