ID: 1184358327

View in Genome Browser
Species Human (GRCh38)
Location 22:43997222-43997244
Sequence AATCCAGGGGTCTTATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184358321_1184358327 -5 Left 1184358321 22:43997204-43997226 CCTCGGATCTGCCCGGGGAATCC No data
Right 1184358327 22:43997222-43997244 AATCCAGGGGTCTTATTTCTAGG No data
1184358316_1184358327 6 Left 1184358316 22:43997193-43997215 CCCTGTGGTGACCTCGGATCTGC No data
Right 1184358327 22:43997222-43997244 AATCCAGGGGTCTTATTTCTAGG No data
1184358315_1184358327 7 Left 1184358315 22:43997192-43997214 CCCCTGTGGTGACCTCGGATCTG No data
Right 1184358327 22:43997222-43997244 AATCCAGGGGTCTTATTTCTAGG No data
1184358317_1184358327 5 Left 1184358317 22:43997194-43997216 CCTGTGGTGACCTCGGATCTGCC No data
Right 1184358327 22:43997222-43997244 AATCCAGGGGTCTTATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184358327 Original CRISPR AATCCAGGGGTCTTATTTCT AGG Intronic