ID: 1184365294

View in Genome Browser
Species Human (GRCh38)
Location 22:44047242-44047264
Sequence CCTCATAGTGGAAGGTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3962
Summary {0: 1, 1: 11, 2: 206, 3: 1170, 4: 2574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184365290_1184365294 -9 Left 1184365290 22:44047228-44047250 CCTCAGGGGCTTCTCCTCATAGT 0: 1
1: 0
2: 1
3: 13
4: 201
Right 1184365294 22:44047242-44047264 CCTCATAGTGGAAGGTGAAGAGG 0: 1
1: 11
2: 206
3: 1170
4: 2574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184365294 Original CRISPR CCTCATAGTGGAAGGTGAAG AGG Intronic
Too many off-targets to display for this crispr