ID: 1184369051

View in Genome Browser
Species Human (GRCh38)
Location 22:44070993-44071015
Sequence CCAGGCCAAGGCGGGCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 418}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184369051_1184369064 2 Left 1184369051 22:44070993-44071015 CCTGCCCGCCCGCCTTGGCCTGG 0: 1
1: 0
2: 4
3: 52
4: 418
Right 1184369064 22:44071018-44071040 GGGTAGGAGTCACTGTGAAAGGG 0: 1
1: 0
2: 1
3: 11
4: 160
1184369051_1184369065 3 Left 1184369051 22:44070993-44071015 CCTGCCCGCCCGCCTTGGCCTGG 0: 1
1: 0
2: 4
3: 52
4: 418
Right 1184369065 22:44071019-44071041 GGTAGGAGTCACTGTGAAAGGGG 0: 1
1: 0
2: 1
3: 13
4: 166
1184369051_1184369063 1 Left 1184369051 22:44070993-44071015 CCTGCCCGCCCGCCTTGGCCTGG 0: 1
1: 0
2: 4
3: 52
4: 418
Right 1184369063 22:44071017-44071039 GGGGTAGGAGTCACTGTGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 240
1184369051_1184369066 9 Left 1184369051 22:44070993-44071015 CCTGCCCGCCCGCCTTGGCCTGG 0: 1
1: 0
2: 4
3: 52
4: 418
Right 1184369066 22:44071025-44071047 AGTCACTGTGAAAGGGGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184369051 Original CRISPR CCAGGCCAAGGCGGGCGGGC AGG (reversed) Intronic
900000172 1:10483-10505 TCAGACCCGGGCGGGCGGGCCGG - Intergenic
900019877 1:181013-181035 TCAGACCCGGGCGGGCGGGCCGG - Intergenic
900189941 1:1349131-1349153 CGGGGCGCAGGCGGGCGGGCGGG - Intronic
900580305 1:3405439-3405461 CCAGGCCAAGGCGGGTGTCCAGG + Intronic
900971960 1:5996721-5996743 CCAGGTAAAGGCGGACGGCCAGG - Intronic
901459272 1:9382100-9382122 CCAGGCCAAGGGAGGAGGCCAGG + Intergenic
901511932 1:9721869-9721891 CAAGGCCCTGGGGGGCGGGCAGG + Intronic
901551206 1:9997384-9997406 TCAGGCGAAGGCGGCCGGGCCGG + Intronic
901922995 1:12549276-12549298 TTTGGCGAAGGCGGGCGGGCGGG - Intergenic
902072179 1:13749499-13749521 CCGGGGCCGGGCGGGCGGGCCGG - Intronic
902250767 1:15153251-15153273 CCAGGTAAAGGCGGGGCGGCTGG + Intronic
902783050 1:18716835-18716857 CAAGGGCAAGGGGGGCGCGCAGG - Intronic
902820871 1:18942408-18942430 CCAGGCCAGGGCAGGAGGGAGGG + Intronic
903163074 1:21503091-21503113 GGAGGCCAAGGCGGGCGGCTGGG + Intergenic
903289242 1:22297408-22297430 CCAGGCCCAGGTGTGTGGGCAGG - Intergenic
903294070 1:22332528-22332550 CCAGGCCAAGGCGGGTGGGAGGG + Intergenic
903324783 1:22563611-22563633 CCGGGCCGGGCCGGGCGGGCGGG - Exonic
903458221 1:23503631-23503653 GGAGGCCAAGGCAGGCGGGTGGG - Intergenic
904142845 1:28367579-28367601 GAAGGCCAAGGCTGGAGGGCTGG - Intergenic
904373082 1:30063008-30063030 CCAGGCCAAGATGGGCTGCCCGG - Intergenic
904390885 1:30185094-30185116 CCAGGCCAGGGCAGGCAGGCTGG - Intergenic
904540653 1:31230668-31230690 CCAGGCCATGGGGGGAGAGCTGG - Intronic
905028323 1:34865890-34865912 CCACGCGAAGGCGCCCGGGCTGG - Exonic
905046176 1:35004380-35004402 GGAGGCCAAGGCGGGAGGCCAGG + Intronic
905372056 1:37487594-37487616 CCAGGCCAGAGCTGGTGGGCAGG - Intergenic
906065852 1:42979697-42979719 GGAGGCCAAGGCGGGCGGTCAGG - Intergenic
906136766 1:43505530-43505552 CCAGGCCAGGGCAGGCAGTCCGG + Intergenic
906219612 1:44068541-44068563 CAAGGCCAAGGCCGAAGGGCAGG - Intergenic
907069300 1:51519317-51519339 CGAGGCCGGGGCGGGCGGGCGGG + Exonic
907486506 1:54781677-54781699 CCTGGCCAAGGCGGGCGAGTCGG - Exonic
908987409 1:70040581-70040603 GGAGGCCGAGGCGGGCGGTCAGG + Intronic
911664443 1:100538241-100538263 GCAAGCCCAGGCGGGTGGGCAGG - Exonic
914899125 1:151702723-151702745 CCGGGCCAGGCCGGGCGGGCTGG + Exonic
915288867 1:154869664-154869686 GCAGGCCAGGGTGGACGGGCTGG + Exonic
915530840 1:156501149-156501171 GCAGCGCCAGGCGGGCGGGCGGG - Intergenic
916747918 1:167698517-167698539 GCAGGCCCAGGCAGGAGGGCAGG - Intronic
918388837 1:184037361-184037383 CCGGGCCGAGGCGGGCGGCGGGG + Exonic
919451214 1:197775184-197775206 CCAGGCCAGCGCGCGGGGGCCGG - Exonic
920211573 1:204332339-204332361 CCATGCCAAGCCAGGCAGGCAGG + Intronic
920504743 1:206507837-206507859 CCAGGCCGGAGCGGGCGAGCGGG - Exonic
922295365 1:224245437-224245459 CCAGGCCAACGCAGGCAGACAGG + Intronic
922476684 1:225911461-225911483 CCAGGCCGGGGCTGGCGGCCTGG + Intronic
922775769 1:228213701-228213723 GCAGTCCAAGGCAGGCGGGGCGG + Exonic
922803579 1:228374779-228374801 CCAGGCCAGGGAGGCTGGGCTGG + Intronic
923261505 1:232272336-232272358 CCAGGCCAAGCAGGTGGGGCAGG - Intergenic
1063521908 10:6748831-6748853 CCAGGGCAAGGGAGGCGTGCAGG + Intergenic
1064250884 10:13705669-13705691 GCAGGCCAAGTGGGGTGGGCGGG - Intronic
1065429404 10:25638411-25638433 ACAGGCCAGGACGGGCTGGCAGG + Intergenic
1066370509 10:34815165-34815187 CGAGGCGAGGGCGGCCGGGCCGG - Exonic
1067293835 10:44963073-44963095 CCAGGGCAAGGCGGGAGTGGAGG + Intronic
1068522583 10:58093971-58093993 CCAGGCCCAGGCTGTGGGGCCGG + Intergenic
1070074482 10:73121804-73121826 ACAGACCAAGGCTGGGGGGCAGG - Intronic
1070257591 10:74825407-74825429 CCCGGCCAGGCCGGGCGGGCTGG + Intergenic
1071026301 10:81117887-81117909 CCAGTCCATGGCTGGGGGGCAGG + Intergenic
1071137277 10:82466956-82466978 GCAGGCGAAGGCGGGTGGACAGG + Intronic
1072595478 10:96867648-96867670 GGAGGCCAAGGCGGGAAGGCGGG + Intronic
1072607552 10:96997460-96997482 CCAGGCCTGGGCAGGCAGGCTGG - Intergenic
1072645875 10:97253148-97253170 GGAGGCCGAGGCGGGCGGTCAGG + Intronic
1073045921 10:100638108-100638130 CCGGACCAAGGGGGGCGGGGAGG - Intergenic
1073460950 10:103665618-103665640 CCTGGCCAGGGCAGCCGGGCGGG + Intronic
1074722222 10:116272952-116272974 CCAGCCCAGGGCGAGCGCGCCGG + Intronic
1076266534 10:129113423-129113445 CCAGGCCAACTCTGGCAGGCCGG + Intergenic
1076356497 10:129857415-129857437 CCAGGCCAAGGAGTGCCAGCTGG - Intronic
1076779192 10:132714594-132714616 CCAGGCCCAGGAGGGAGGGCAGG + Intronic
1076882857 10:133248040-133248062 CCAGGGCCCGCCGGGCGGGCGGG + Intergenic
1076884321 10:133254690-133254712 CAAGGCCACGGCGGGCGGAAGGG + Intergenic
1077295288 11:1823607-1823629 CCAGGCCTGGGAGGGCAGGCTGG + Intergenic
1077341172 11:2027065-2027087 GCAGAGCAAGGCGGGTGGGCGGG - Intergenic
1077556271 11:3227640-3227662 ACATGCCCAGGCAGGCGGGCCGG - Intergenic
1078934742 11:15941040-15941062 CCAGGCCCAGGCTGCTGGGCAGG - Intergenic
1083170600 11:60922069-60922091 CGAGGCCAAGGTGCGAGGGCTGG + Exonic
1083207456 11:61161273-61161295 CCAGGATGAGGCGGGCAGGCGGG + Intronic
1083347039 11:62001031-62001053 CCTGGCCCAGGTGGGCGGTCCGG - Intergenic
1083657106 11:64234916-64234938 AGAGGGCACGGCGGGCGGGCGGG - Intronic
1083747640 11:64744651-64744673 CCAGGGCGGCGCGGGCGGGCTGG - Intronic
1084044197 11:66559672-66559694 CCAGGCCAAGGCTGATGGGGAGG - Intronic
1084087788 11:66862504-66862526 CGAGGCCAAGGCAGAGGGGCCGG + Intronic
1084095089 11:66906040-66906062 TCAGGCAGAGGTGGGCGGGCGGG + Intronic
1084192240 11:67504486-67504508 CCAGGCTCCGGCCGGCGGGCGGG + Intronic
1084480353 11:69416233-69416255 CCTGGCACTGGCGGGCGGGCAGG + Intergenic
1084588702 11:70078296-70078318 TAAGGCAAAGGCGGGCCGGCTGG + Exonic
1084643809 11:70442649-70442671 CCAGGGCCTGGCGGGCGGGGTGG + Intergenic
1087791365 11:102409626-102409648 GGAGGCCCAGGCGGGCAGGCGGG + Intronic
1090029669 11:123195893-123195915 CCAGGCCAAGGGGGGTAGCCGGG - Intergenic
1090116640 11:123980108-123980130 CCAGGCCAAGGGGTGCCTGCAGG + Intergenic
1090224735 11:125063245-125063267 CGGGGCCAGGGCGGGCCGGCCGG + Intronic
1202824157 11_KI270721v1_random:82254-82276 GCAGAGCAAGGCGGGTGGGCGGG - Intergenic
1091373255 12:10600-10622 TCAGACCCGGGCGGGCGGGCCGG - Intergenic
1091571600 12:1691367-1691389 TCAGGCCAAGGCGCGCCGGGCGG - Intronic
1092371431 12:7919647-7919669 GGAGGCCTAGGCGGGCGGTCAGG - Exonic
1096086025 12:48865589-48865611 CTACCCCAAGGCGGGCAGGCAGG + Intronic
1096181707 12:49554745-49554767 ACAGGCCAAGGAGAGCTGGCAGG - Intronic
1096514102 12:52146886-52146908 CCAGGTCTAGGCGGGGAGGCTGG + Intergenic
1096617162 12:52839897-52839919 TCAGGCCAAGGTGGACGAGCTGG - Exonic
1096803693 12:54127575-54127597 CCAGGACAAGGGGGAAGGGCGGG + Intergenic
1104685407 12:130781378-130781400 CAAGCCCAAAGCTGGCGGGCTGG - Intergenic
1104854312 12:131894911-131894933 GCGGGCCGGGGCGGGCGGGCCGG - Exonic
1106504950 13:30363063-30363085 CCAGGGAGAGGAGGGCGGGCTGG - Intergenic
1108610413 13:52079662-52079684 GGAGGCCAAGGCAGGCGGGTGGG - Intronic
1111441916 13:88292003-88292025 CCAGCGCAATGCTGGCGGGCTGG - Intergenic
1112344122 13:98576603-98576625 CCCGGCCGAGCCGGGCGCGCGGG + Intronic
1113077115 13:106477919-106477941 CCAGGCCAAGGAGAGAGGCCTGG - Intergenic
1114466061 14:22923739-22923761 GGAGGCCAAGGCGGGAGGTCAGG - Intronic
1114645650 14:24254717-24254739 CCACGTCAAGGAGAGCGGGCAGG - Exonic
1114957764 14:27845543-27845565 CCAGCCCGCAGCGGGCGGGCTGG - Intergenic
1115851900 14:37595577-37595599 GCGGGGCCAGGCGGGCGGGCGGG + Intronic
1116192152 14:41675236-41675258 GGAGGCCAAGGCAGGCGGGTGGG + Intronic
1117478411 14:56119080-56119102 CCGGGCCGGGGAGGGCGGGCAGG + Intronic
1117974146 14:61281139-61281161 CCAGGTCATGGCGGCCGCGCGGG + Exonic
1119220208 14:72900382-72900404 CAAGGCCAAGGCCTGAGGGCTGG + Intergenic
1121103165 14:91264062-91264084 CCGGGCCCAGGCGGGAGGTCTGG - Intergenic
1121348002 14:93150313-93150335 CCAGGCCAAGGGGTGCAGACAGG + Intergenic
1121531486 14:94657786-94657808 GGAGGCCAAGGCAGGCGGGTGGG - Intergenic
1121764401 14:96473399-96473421 GGAGGCCAAGGCGGGTGGGTCGG - Intronic
1122035510 14:98946401-98946423 ACAGGCCAAGGCAGGGCGGCTGG + Intergenic
1122102128 14:99420936-99420958 CCAGGCGAGGGCGGGGGGGGGGG + Intronic
1122113876 14:99518245-99518267 CCAGGCCAGGGCGGGCGGGGAGG - Intronic
1122399449 14:101458388-101458410 TCACCCCCAGGCGGGCGGGCCGG + Intergenic
1122886244 14:104711714-104711736 CCTGGCTGAGGTGGGCGGGCTGG - Intronic
1122924740 14:104894414-104894436 CCAGGCAAAGGCAGGCTGGCTGG - Intronic
1123021047 14:105398216-105398238 CCAGGACGGGGCGCGCGGGCGGG - Intergenic
1123423163 15:20147883-20147905 ACAGACCCGGGCGGGCGGGCGGG - Intergenic
1123532389 15:21154422-21154444 ACAGACCCGGGCGGGCGGGCGGG - Intergenic
1124374097 15:29119849-29119871 CCAGGACAAGGCGGGGAAGCAGG + Intergenic
1124637015 15:31371817-31371839 CCAGGCGTGGGCGGGAGGGCAGG + Intronic
1124957203 15:34367252-34367274 CCCTGACAACGCGGGCGGGCTGG - Exonic
1125202347 15:37111047-37111069 ACACGCCGAGGAGGGCGGGCGGG - Intergenic
1126110131 15:45170071-45170093 CCAGGCTAAGGCAGGCTGGCAGG + Intronic
1126766495 15:52016160-52016182 GGAGGCCAAGGCGGGTGGTCAGG + Intronic
1126767034 15:52019570-52019592 CCAGGCCCGAGCGGGCGGGCAGG - Intronic
1126849830 15:52790192-52790214 GGTGGCCGAGGCGGGCGGGCTGG - Intronic
1127303271 15:57678322-57678344 CCAGGCCCAGGCTGGAGTGCAGG - Intronic
1128199436 15:65792164-65792186 GCAGGCCTGGGCGGGCGGGCGGG - Intronic
1128216238 15:65936209-65936231 CCAGGGCAGGGCTGGTGGGCTGG - Intronic
1128992519 15:72272574-72272596 GCAGGCCAAGGGGCGGGGGCCGG + Exonic
1129313672 15:74728634-74728656 GGAGGCCAAGGCAGGCGGGTGGG - Intergenic
1129823759 15:78621006-78621028 CCAGGCGCGGGCGGGCGGGCGGG + Exonic
1129880649 15:79004216-79004238 CCAGGCCTAGGCGGGCAGGCAGG - Intronic
1132409909 15:101568936-101568958 CCAGACCAGGGCAGGAGGGCTGG + Intergenic
1132482226 16:172485-172507 CCAGGCCGGGGCGGGGGTGCGGG + Intergenic
1132483074 16:176289-176311 CCAGGCCGGGGCGGGGGTGCGGG + Intergenic
1132742344 16:1421097-1421119 CCAGCCCAGGGCAGGCGGGCAGG - Intergenic
1132748027 16:1445096-1445118 CCAGGTGGAGGGGGGCGGGCCGG - Exonic
1133100426 16:3476005-3476027 CCAGGCCCAGGAGGGCAGGCAGG - Intronic
1133734061 16:8600663-8600685 CCTGGCCACGGAGGGCGTGCAGG - Intergenic
1134073692 16:11276072-11276094 GCAGGGCAAGGCGGGGGCGCAGG + Intronic
1135170812 16:20181667-20181689 CCAGGCCAAGGGTGTGGGGCAGG + Intergenic
1136845241 16:33571569-33571591 ACAGACCCGGGCGGGCGGGCCGG - Intergenic
1136927521 16:34388609-34388631 CCAGGGACGGGCGGGCGGGCTGG + Intergenic
1136977053 16:35023197-35023219 CCAGGGACGGGCGGGCGGGCTGG - Exonic
1137055781 16:35746190-35746212 CCAGGCCATGGTGGGGGTGCAGG - Intergenic
1137280686 16:46973818-46973840 CCAGGTCCAGGCGGCTGGGCAGG + Intergenic
1138595024 16:58025407-58025429 CGAGGCCTAGGCGGACGGGAAGG - Intergenic
1139188608 16:64836152-64836174 CCAGGCCATGACTGGCTGGCTGG - Intergenic
1140221625 16:73048161-73048183 CCCGGGGAAGGGGGGCGGGCGGG + Exonic
1140433499 16:74925295-74925317 GGAGGCCAAGGCAGGCAGGCAGG + Intronic
1141992950 16:87620799-87620821 CCAGACTGAGGCAGGCGGGCAGG - Intronic
1142197237 16:88744561-88744583 GCAGGGCAAGGCGGGTGGGCGGG - Intronic
1203106949 16_KI270728v1_random:1420222-1420244 ACAGACCCGGGCGGGCGGGCCGG - Intergenic
1203155409 16_KI270728v1_random:1871867-1871889 ACAGACCCGGGCGGGCGGGCCGG - Intergenic
1143569058 17:7743104-7743126 CCAGGAGAAGGCGGGCATGCTGG + Exonic
1143608077 17:8002618-8002640 CCAGGCCAGGGCGGGGGCGTGGG - Exonic
1145742218 17:27284850-27284872 CCAGGACAAGACTGGCTGGCAGG + Intergenic
1145950313 17:28812264-28812286 GCTGCCCAAGGCGGGCGGGGCGG - Intronic
1146888262 17:36486823-36486845 TCCGGCCATGGCGGGAGGGCGGG + Intronic
1147622238 17:41875804-41875826 GGAGGCCAAGGCAGGCGGCCGGG - Intronic
1147690937 17:42314080-42314102 GCCAGCCAAGGCGGGCAGGCGGG + Exonic
1147833716 17:43315297-43315319 ACAGGGCAAGGCGCGCGGACGGG + Intergenic
1147935086 17:44006546-44006568 CCAGGTCCAGGTCGGCGGGCAGG - Exonic
1147971327 17:44220140-44220162 CGGAGCCTAGGCGGGCGGGCGGG + Intronic
1147971522 17:44220926-44220948 CTGCGCCGAGGCGGGCGGGCGGG - Intronic
1148122573 17:45221722-45221744 CCAGCCCCAGGGGGGCGGGCTGG - Intronic
1148156253 17:45426685-45426707 CCAGGCTCAGGTGGGTGGGCAGG - Intronic
1148558839 17:48594475-48594497 CCAGGCCGAGCCGGCAGGGCTGG + Intronic
1148818242 17:50346028-50346050 CCACGCCTAGGGAGGCGGGCCGG - Intergenic
1148842510 17:50508243-50508265 CTAGGCCACGGGGGGCGGGTGGG - Intergenic
1148970784 17:51479424-51479446 CCAGGCCAAGGGGTGGGGGTGGG - Intergenic
1149528884 17:57379316-57379338 CCAGCCCAGGGTGGGCGGGAGGG - Intronic
1150124543 17:62627818-62627840 CGAGGCCAGGGCGCGGGGGCCGG - Exonic
1151660133 17:75514598-75514620 TCAGGCACAGGCAGGCGGGCAGG + Intronic
1151727373 17:75892718-75892740 TGAGGCCATGGTGGGCGGGCAGG + Intronic
1151824328 17:76515288-76515310 CCGGGCCAAATCAGGCGGGCTGG + Intergenic
1151974310 17:77475800-77475822 CCAGGCCACGGCAGGGGAGCCGG - Intronic
1152085332 17:78214453-78214475 ACAGGGCAAGGCGGGCGTGGGGG - Intronic
1152552278 17:81035611-81035633 CGACGCCAAGGCGAGCGCGCGGG - Intronic
1152704019 17:81833584-81833606 CCAGGCCTAGGAGGGGTGGCGGG + Exonic
1152748424 17:82051656-82051678 CCGGGCCGGGGCGGGCGCGCGGG + Exonic
1152900701 17:82939493-82939515 CCAGGCCCAGGTGGCCGTGCAGG - Intronic
1154356263 18:13624867-13624889 CCAGGGCAAGGCGGCTGGGGAGG + Intronic
1154954598 18:21242122-21242144 GGAGGCCAGGGCGGGCGGGAGGG + Intergenic
1156150333 18:34234055-34234077 CCAGGACCAGCGGGGCGGGCCGG - Intergenic
1158478490 18:57801892-57801914 GCAGGCCAAGGGGGTCGGGTAGG + Intronic
1160013760 18:75125642-75125664 GCATGCCAGGGCGGCCGGGCAGG + Intergenic
1160658716 19:288231-288253 CCAGGCCAAGGCAGGTGTGTGGG - Intronic
1160659301 19:290955-290977 CCAGGCCAGGCGGGGCGGGATGG + Exonic
1160734451 19:655870-655892 CCAGGCCACGGCGGGGGGGAGGG + Intronic
1160772902 19:841017-841039 CCAGGGCAGGGCTGGGGGGCCGG - Exonic
1160793951 19:935248-935270 CCAGGCCGCGGCGGGGGGCCGGG + Intronic
1160830933 19:1104605-1104627 CTAGGCCAAGGTGCGGGGGCGGG - Intronic
1160879461 19:1312942-1312964 GCGGACAAAGGCGGGCGGGCTGG - Intergenic
1160906772 19:1455362-1455384 GCTGGCAAAGGCAGGCGGGCGGG - Exonic
1161038860 19:2099475-2099497 CCAGGGCCAGGAGGGCGGGAGGG + Exonic
1161129417 19:2579336-2579358 GGTGGCCAGGGCGGGCGGGCAGG + Intronic
1161401233 19:4066959-4066981 CCAGGCTGGGGGGGGCGGGCTGG - Intergenic
1161499710 19:4607163-4607185 CCAGGCCGAGGCAGGCGGGAGGG - Intergenic
1162111145 19:8400400-8400422 CCAGGCCCAGGTGGGAGGACAGG - Intronic
1162345452 19:10115671-10115693 CCAATCCAAGGTGGGCAGGCAGG - Exonic
1162940334 19:14005749-14005771 CGGGGCCAAGGTGGGTGGGCGGG - Intronic
1162956110 19:14099046-14099068 AGAGGCCAAGGCGGGGGGGGCGG + Intronic
1163284477 19:16337984-16338006 CCAGGCCTTGGGGGGCGGACTGG - Intergenic
1163385829 19:16999871-16999893 CCAGGCCATGGTGGTCAGGCTGG + Intronic
1163469158 19:17486836-17486858 CCTGGCCAAGGCGGGCATGGAGG + Exonic
1163478412 19:17540108-17540130 CCGGGCCAATGCGGGTGGGCGGG + Intronic
1163593156 19:18205364-18205386 CCAGGGCACTGGGGGCGGGCTGG - Intergenic
1163698933 19:18777580-18777602 CCAGCCCTGGGCGGGCGGGTGGG - Exonic
1163833299 19:19558203-19558225 ACAGGCAGAGGAGGGCGGGCGGG + Intergenic
1165157645 19:33797609-33797631 CCAGGTCAGGGGGTGCGGGCGGG - Intronic
1165159708 19:33808764-33808786 CCAGGCCAAGGGAGGCTGGGTGG + Intronic
1165421403 19:35723800-35723822 CCAGGCCCACGCCGGGGGGCGGG + Exonic
1165844962 19:38812396-38812418 CCAAGCCAGGCCGGGCTGGCAGG - Intronic
1166856714 19:45785971-45785993 CGGGGGCAAGGCGGGCGGCCCGG - Exonic
1166893131 19:46006737-46006759 CCAGGGCCAGGCTGGTGGGCGGG + Intronic
1166894886 19:46016902-46016924 ACTGGGCAGGGCGGGCGGGCTGG + Intronic
1166917619 19:46206268-46206290 CAAGGCCAAGGAGGGCCAGCTGG + Intergenic
1167586503 19:50378469-50378491 CCAGGGCTAGGCGGGGGGCCAGG - Intronic
1168100782 19:54139835-54139857 CCATGCCAAGGGTGGGGGGCTGG - Intronic
1168107607 19:54174064-54174086 CCGGGGCAAGGCTGGTGGGCTGG + Exonic
1168267919 19:55232290-55232312 TCAGCCCAAGGAGAGCGGGCTGG + Intronic
1168528431 19:57106649-57106671 GCCGCACAAGGCGGGCGGGCGGG - Intergenic
925894959 2:8464023-8464045 CCAGGCTGAGGCGGGCAGGTGGG - Intergenic
927141856 2:20136280-20136302 GCAGGCTGAGGCGGGCAGGCTGG + Intergenic
927553347 2:24017061-24017083 CCAGGCACAGGCGGGTGGGGAGG - Intronic
927808852 2:26171003-26171025 CCTGGCCAGGGTGAGCGGGCTGG + Intergenic
929231817 2:39567952-39567974 CCAGGGCAAGGCGAACAGGCAGG - Intergenic
930136047 2:47905415-47905437 GGAGGCCGGGGCGGGCGGGCGGG - Intronic
931754774 2:65362935-65362957 GGAGGCCGAGGCGGGCGAGCAGG + Intronic
932248728 2:70220925-70220947 GGAGGCCAAGGCGGGCGGACTGG + Intronic
932305370 2:70698130-70698152 CCAGGCAAAGGTGGGCAGGTGGG + Intronic
932420342 2:71597703-71597725 CGTGGCCAAGGCTGGCAGGCTGG + Intronic
935197198 2:100824233-100824255 CCGGGCCAGGGCTGGAGGGCAGG + Intronic
935692569 2:105744747-105744769 CCAGGCCCGGGCGCGCGGGGCGG - Intergenic
936046773 2:109194564-109194586 TCAGGGCCCGGCGGGCGGGCTGG + Intronic
936569441 2:113602369-113602391 TCAGACCCGGGCGGGCGGGCGGG + Intergenic
937345562 2:121123389-121123411 CAAGGCCAGGGCGACCGGGCAGG - Intergenic
937880249 2:126859138-126859160 CCAGGCCCAGGAGGGCGTGCTGG + Intergenic
938547950 2:132352517-132352539 ACAGACCCGGGCGGGCGGGCCGG - Intergenic
944495791 2:200306613-200306635 CGAGGGGAAGGCGGGCGGGTCGG + Intronic
946252828 2:218423905-218423927 CAAGGCCAAGGAGGGAGGCCTGG + Intronic
946688982 2:222296965-222296987 CAAGCCCAAGGTGAGCGGGCGGG - Exonic
947521614 2:230850094-230850116 CCAGGCCCAGGCAGGCGCGCTGG - Intergenic
947713520 2:232328949-232328971 CCAGGCAAAGGCTGGGGGGCTGG - Intronic
947741970 2:232488718-232488740 TCTGGCCAAGGCAGGCAGGCAGG - Intergenic
947750546 2:232529883-232529905 CCAGGCCAAGGGGGCTAGGCAGG - Intronic
948140635 2:235670021-235670043 CCGGGCCAAGCGGGGAGGGCAGG - Intronic
948591415 2:239053229-239053251 CCAGGGCTAGGCTGGCGGGTGGG - Intronic
948605874 2:239134425-239134447 CCAGGGCACGGCGGGCCAGCAGG - Exonic
948787410 2:240359639-240359661 CCAGGCCCAGAGGGGAGGGCAGG - Intergenic
948787433 2:240359707-240359729 CCAGGCCCAGAGGGGAGGGCAGG - Intergenic
948875403 2:240824298-240824320 CCAGGGCAAGGGGGACGGGCAGG - Intergenic
948991880 2:241559570-241559592 CCAGGCCAAGGCGCTGGGCCGGG + Exonic
949023887 2:241755959-241755981 GCGGGCCGAGGCGGGCGCGCAGG - Exonic
1170594577 20:17795317-17795339 CCAGGCCAGGGAGGGCAGACAGG + Intergenic
1171521183 20:25775014-25775036 CCGGGCCAGGGCTGGCTGGCTGG - Exonic
1171876816 20:30585290-30585312 ACAGACCCGGGCGGGCGGGCCGG - Intergenic
1172165846 20:32898641-32898663 CCTGGCTAAGGCGGTGGGGCTGG + Intronic
1172547324 20:35772092-35772114 CCAGGCGAAGCCGGCCGGCCGGG + Intronic
1172874941 20:38158448-38158470 CCAGACCATGGTGGCCGGGCTGG + Intronic
1173494405 20:43508292-43508314 ATAGGCAAAGGCGGGCGGGGCGG - Intronic
1173868565 20:46328369-46328391 CCAGCCCAGGGCGGGCCGGCAGG - Intergenic
1174298030 20:49562595-49562617 CCAGGCCCTGGCGGGCAGGGCGG + Intronic
1174386847 20:50192364-50192386 CCAGGCGCCGGCGGGCGGGCCGG + Exonic
1175048322 20:56128206-56128228 CCAGGCAAACGAGGGAGGGCAGG + Intergenic
1175217746 20:57400430-57400452 CCAGGCCATGCCGGGAGGGTTGG - Intronic
1175757213 20:61537443-61537465 CCAGGCCAGCTCGGGAGGGCAGG + Intronic
1175925343 20:62468638-62468660 CCAGGCCAATGAGGCCGGGGAGG + Intronic
1176164267 20:63664591-63664613 CCAAGCCAAGGGGGACAGGCAGG - Intronic
1176179509 20:63742748-63742770 GGAGGACAAGGCGGGTGGGCAGG - Exonic
1176191627 20:63813563-63813585 CCAGGTAGAGGCGGGAGGGCTGG - Intronic
1176207165 20:63895363-63895385 TCAGGCCCGGGCAGGCGGGCGGG + Intronic
1178485910 21:33020175-33020197 CCAGGCCATGGCGGGACTGCGGG - Intergenic
1178485945 21:33020250-33020272 CCCGGCTCAGGCGGGAGGGCAGG + Intergenic
1178740823 21:35199538-35199560 CCAGTCCAGGGCGGGCTGCCAGG + Intronic
1178992199 21:37366197-37366219 CCAGGCCCGGGCGCGCGGGGTGG + Intronic
1179909512 21:44440627-44440649 GCAGGCCCAGGCAGGCTGGCGGG + Intronic
1181161338 22:20961727-20961749 CCAGGGCAAGGCAGAGGGGCAGG + Intergenic
1181356227 22:22297860-22297882 ACAGACCCGGGCGGGCGGGCCGG - Intergenic
1182123880 22:27802545-27802567 CCAGGGCAAGGTGTGCGGCCCGG - Intergenic
1183006661 22:34908613-34908635 CCAGGCAATGGCGGCAGGGCTGG + Intergenic
1183201408 22:36387753-36387775 GCAGGCGGCGGCGGGCGGGCGGG - Intronic
1183598175 22:38824739-38824761 CCAGGCCAAGGACGGCAGCCAGG + Intronic
1183603062 22:38851144-38851166 CCAGCCCAAGGTGGGCCTGCGGG - Intergenic
1183667043 22:39252166-39252188 ACAGGCCAAAGCAGGCAGGCAGG + Intergenic
1183856078 22:40636247-40636269 CCGGGCCGGGCCGGGCGGGCGGG - Intronic
1184086899 22:42270692-42270714 CCGGGCCGCGGCGCGCGGGCGGG + Intronic
1184148778 22:42626819-42626841 GCAGGCCAGGGCGGGCAGGCAGG + Intronic
1184369051 22:44070993-44071015 CCAGGCCAAGGCGGGCGGGCAGG - Intronic
1184680704 22:46071112-46071134 CGCGGCCGAGGCGGGCGGGCGGG - Intronic
1185095731 22:48804998-48805020 CCTGGGCAGGGCGGGCGGGCTGG + Intronic
1185337451 22:50276932-50276954 CCTGGCCAAGGGGGCCAGGCTGG + Intronic
1185374097 22:50474425-50474447 CCACCCCAAGGAGGCCGGGCAGG + Intronic
950330103 3:12149346-12149368 CCAGGCCCAGATGGGCAGGCAGG + Intronic
950436250 3:12982076-12982098 CCAGTCCCAGGTGGGCAGGCAGG - Intronic
950486439 3:13276664-13276686 CAAGGCCAAGGCTGATGGGCTGG + Intergenic
950648537 3:14392798-14392820 GCACACCAAGGCGGGAGGGCAGG + Intergenic
951550631 3:23872006-23872028 GGAGGCCAAGGCAGGCGGGTGGG + Intronic
952267670 3:31802117-31802139 GGAGGCCGAGGCGGGCGGACTGG - Intronic
952324913 3:32312488-32312510 CCAGGGCAAGGCATGTGGGCAGG + Intronic
953884942 3:46709870-46709892 CCAAGCCTAGGCTGGGGGGCAGG - Exonic
953926973 3:46987575-46987597 CCAGGACATGGCGGGCGGCGGGG + Intronic
954130045 3:48556296-48556318 CCTGGCCAAGGAGTGTGGGCCGG - Intronic
954278064 3:49554996-49555018 CCACGCCAAGGCGGGGCAGCTGG - Intronic
954540810 3:51391986-51392008 CCGGGCCAGGGCGTGCTGGCGGG - Exonic
954660343 3:52223721-52223743 CCAGGCCAAGGAGGGCACCCGGG + Exonic
956745778 3:72310069-72310091 CCAAGCCATGGCGGGTGGGAGGG + Intergenic
961451937 3:127006194-127006216 CCAGGCCCAGGCGGGCGGAGGGG - Intronic
963116887 3:141738144-141738166 CCAGCGCCAGGGGGGCGGGCAGG - Intergenic
964665984 3:159172755-159172777 GCAGCCAAAGGCGGGCGGGGGGG + Intronic
966967024 3:185004113-185004135 GGAGGCCAAGGCAGGCGGCCGGG + Intronic
968123830 3:196144178-196144200 CCAGGTCAATGCTGGGGGGCTGG - Intergenic
968454421 4:689662-689684 GCAGGCCAAGGCTGGAGGGAAGG + Intergenic
968515413 4:1013542-1013564 CCAGGCCCATGTGGGCAGGCGGG - Intronic
968651936 4:1763593-1763615 CCACCGCAGGGCGGGCGGGCGGG + Intergenic
968689490 4:1983420-1983442 CCTGCCCAAGGCGGACGGCCAGG - Exonic
969348104 4:6581769-6581791 CCAGGCCCTGGCGGGCAGCCAGG - Intronic
969589555 4:8114107-8114129 CCAGGCCAGGGGAGGCAGGCAGG - Intronic
969617459 4:8262044-8262066 CCAGGGCCAGGCCTGCGGGCAGG + Intergenic
973613736 4:52659486-52659508 CCAGGCCTGGGCGGGCGAGCTGG - Intergenic
974021320 4:56693921-56693943 GGAGGCCAAGGCGGGCGGCTGGG + Intergenic
974497209 4:62647420-62647442 GGAGGCCAAGGCAGGCAGGCAGG - Intergenic
975159731 4:71111623-71111645 GGAGGCCAAGGCGGGTGGGGTGG - Intergenic
978576952 4:110197772-110197794 CAGGGCCAAGGGCGGCGGGCGGG + Intronic
980040426 4:127933480-127933502 GGAGGCCAAGGCGGGCGGACTGG - Intronic
980231151 4:130048191-130048213 CCTGGCCAGGGCAGTCGGGCAGG - Intergenic
981504140 4:145481868-145481890 CCAGGAGAAAGCAGGCGGGCGGG + Intronic
983270736 4:165558563-165558585 CCAGCTCAAGGCAGGCAGGCTGG - Intergenic
983904537 4:173169511-173169533 CCACTCCCCGGCGGGCGGGCCGG - Intronic
984075510 4:175173022-175173044 GGAGGCCAAGGCGGGTGGTCAGG - Intergenic
984852820 4:184168783-184168805 CCCGGGCAGGGCCGGCGGGCAGG + Intronic
984905354 4:184621086-184621108 GGAGGCCAAGGCGGGCGGGGTGG + Intergenic
984998890 4:185465565-185465587 CCAGGCCAAGCTGAGCGGGTTGG + Intronic
985781112 5:1872342-1872364 CCAGGCCACGGGGGGCGGGGGGG - Intergenic
985843648 5:2328758-2328780 CCAGGCAGAGGAGGGAGGGCAGG - Intergenic
986449570 5:7851033-7851055 CGCGGCCAAGGCGGGGGCGCTGG - Exonic
986506532 5:8457798-8457820 CCAGTGCTAGGCGGGCGGTCGGG - Intergenic
987156729 5:15096598-15096620 GGAGCCCATGGCGGGCGGGCGGG + Intergenic
987231078 5:15894047-15894069 GGAGGCCAAGGCGGGCGGTCGGG + Intronic
989294018 5:39802836-39802858 GGAGGCCAAGGCGGGCGAGGAGG + Intergenic
990462122 5:56039229-56039251 GGAGGCCAAGGCAGGCGGGTGGG + Intergenic
992105542 5:73447306-73447328 CGCGGCCAAGGCGGGCGGCCCGG - Exonic
993095646 5:83474696-83474718 CGAGGCCAATGGGGGCGGGGCGG + Intronic
995610838 5:113909022-113909044 GGAGGCCAAGGCGGGGGGGCGGG + Intergenic
995645350 5:114305337-114305359 GCAGGCCAAGGCAGGCTGGTGGG + Intergenic
999255782 5:150209419-150209441 CCAGTCCATGGCCGGCCGGCTGG - Exonic
1000097807 5:157986593-157986615 CCAGGCCAAGGTGGGAGAGGAGG - Intergenic
1001585017 5:172827986-172828008 CCAGGCCTAGGCTGGCAGCCAGG - Intergenic
1002193849 5:177491941-177491963 GCCGGGCAGGGCGGGCGGGCAGG + Intronic
1002497081 5:179622981-179623003 CGAGGCCGGGGCGGGCGGGCTGG - Intronic
1002927853 6:1615065-1615087 CCAGGCCGAGGCGGGTGGGCCGG - Intergenic
1004903255 6:20212601-20212623 GCAGGCCAGGCTGGGCGGGCCGG - Intergenic
1005614922 6:27563428-27563450 CCATGCCAAGCCGGGCGCGGTGG + Intergenic
1006517881 6:34554781-34554803 CCAGGCCCAAGCTGGTGGGCAGG - Intronic
1006717689 6:36130756-36130778 CCAGCCCAGGGCGGGCTGGGCGG - Intronic
1006764733 6:36494867-36494889 CCAGGCCTAGGCAGGAGGCCTGG - Exonic
1006932804 6:37697756-37697778 GCAGGCCAAGGCCGCCGGGCGGG - Exonic
1010563913 6:77384963-77384985 GGAGACCAAGGCGGGGGGGCGGG + Intergenic
1010791547 6:80070583-80070605 CCAGGCCCGAGCGGGCGGGAAGG - Intergenic
1013251579 6:108339685-108339707 GGAGGCCAAGGCGGGAGGTCAGG - Intronic
1015910183 6:138161867-138161889 CCTGACCCAGGCGGGCGGGGCGG + Intergenic
1019279108 7:191483-191505 GCAAGCCCAGGCGGGTGGGCCGG - Intergenic
1019342355 7:514515-514537 CCAGGCCCAGGTGGCCTGGCCGG + Intronic
1019453089 7:1109753-1109775 CCAGGGCCCGGCGGGCGGGAAGG - Intronic
1019708633 7:2508291-2508313 ACAGGCCAAGGTGGGAGGCCAGG - Intergenic
1019718753 7:2555404-2555426 CCCGGCCGAGGGGGGCGGGCGGG - Intronic
1019998947 7:4743812-4743834 CCAGGCTAAGGCGGGGGCGCTGG - Intronic
1020660354 7:10974124-10974146 CCAGGCGAGGCCGGGGGGGCGGG + Exonic
1021274729 7:18636284-18636306 CCAGGGCAGGGGGGGCTGGCAGG - Intronic
1021510537 7:21428144-21428166 CCGAGCCACCGCGGGCGGGCGGG + Exonic
1022109696 7:27220710-27220732 CCCGGGCAAGCCGGGCAGGCGGG - Intergenic
1023075819 7:36482043-36482065 GGAGGCCAAGGCTGGTGGGCTGG - Intergenic
1024472158 7:49775407-49775429 CCACGTCCCGGCGGGCGGGCGGG - Exonic
1025227967 7:57180190-57180212 CCAGGCCTAGAGGGGCGGGATGG + Intergenic
1025729913 7:64100142-64100164 CCAGGCCTGGAGGGGCGGGCGGG - Intronic
1025796120 7:64739199-64739221 GGAGGCCAAGGCAGGCGGCCGGG + Intergenic
1026266359 7:68799110-68799132 GGAGGCCAAGGCGGGGGGGGGGG - Intergenic
1026770022 7:73190260-73190282 GGAGGCCAAGGCGGGCGGATCGG + Intergenic
1027077152 7:75202397-75202419 GGAGGCCAAGGCGGGCGGATCGG - Intergenic
1028885470 7:95928019-95928041 CCAGGCCAAGTGTGGCTGGCAGG - Intronic
1029525610 7:101092150-101092172 GGAGGCCAAGGCGGGCGGCTGGG - Intergenic
1032001346 7:128267512-128267534 CCCAGCCAAGGAGGGAGGGCAGG + Intergenic
1032006134 7:128303452-128303474 CCAGGCCAAGCAGGGCTGCCTGG - Exonic
1032075063 7:128832228-128832250 CCAGGACAGGGCAGGCGGGTGGG - Intronic
1032756016 7:134891555-134891577 CCTGGCCAGGCCGGGCGGTCAGG - Intronic
1033359377 7:140627440-140627462 GGAGGCCAAGGCAGGCAGGCAGG - Intronic
1033717428 7:144017298-144017320 GGAGGCCAAGGCGGGCGGTCAGG + Intergenic
1034489540 7:151385980-151386002 GAAGGCCAGGGCGGGCAGGCGGG + Intronic
1035024538 7:155817242-155817264 CCAGGCCCAGCCGGGCAGACGGG - Intergenic
1035321434 7:158032129-158032151 CCAGGGCCAGGCGTGGGGGCAGG - Intronic
1036918560 8:12829868-12829890 CCAGGGCAAGGCGGGAGGGAGGG - Intergenic
1038035475 8:23682891-23682913 TCAGGCCAAGGCGGGGCCGCCGG - Exonic
1039613520 8:38937339-38937361 ACAAGCCAGGGAGGGCGGGCAGG - Intronic
1039842516 8:41304088-41304110 GGAGGCCAGGGCAGGCGGGCGGG + Intronic
1039846304 8:41328151-41328173 CCAGGCCAGGGCGGGGCAGCTGG - Intergenic
1041693596 8:60714079-60714101 CCAGGCCTCGGCGGGCGGGGTGG + Intronic
1042560849 8:70071270-70071292 CCAGGCTTAAGAGGGCGGGCGGG + Exonic
1042877722 8:73455185-73455207 CCAGCCCAAGCAGAGCGGGCAGG - Intronic
1043388206 8:79768163-79768185 CCAGGCCAATCGGGGCGCGCGGG - Intergenic
1043734274 8:83724322-83724344 CCATGCCAAGGGGGGCCTGCAGG + Intergenic
1045005533 8:97913851-97913873 GAAGGCCAAGGCGGGCGGATCGG - Intronic
1045583403 8:103501481-103501503 CCGGGCGAAGGCGCGCTGGCAGG + Intronic
1046108191 8:109691485-109691507 CCGGGCTAAGGCGGGCGGAGCGG - Exonic
1048970566 8:139643064-139643086 CCTGGCCAAGGGGGTCAGGCAGG - Intronic
1048976097 8:139673949-139673971 CAAGGCCAGGGCGGTGGGGCAGG - Intronic
1049004489 8:139846063-139846085 CAAGGCCAAGGGGGCCGGCCTGG + Intronic
1049040403 8:140108509-140108531 CCTGGGCAAGGGGGGCGAGCGGG - Intronic
1049107569 8:140623448-140623470 ACAGGCCAAGGCTGGAGTGCCGG - Intronic
1049338731 8:142100532-142100554 CCAGGTCAAGGGGGACGGGATGG + Intergenic
1049387361 8:142350018-142350040 CCAGGGCAGGCAGGGCGGGCAGG + Intronic
1049387400 8:142350126-142350148 CCAGGGCAGGCAGGGCGGGCAGG + Intronic
1049387430 8:142350207-142350229 CCAGGGCAGGCAGGGCGGGCAGG + Intronic
1049406217 8:142452842-142452864 CCAGGCCCAGGCGGCCGGCGCGG + Intronic
1049414642 8:142489691-142489713 CCAGGCCAATGGGGGCTGGAGGG - Intronic
1049660109 8:143816022-143816044 GCCGTCCAAGGCGGGCGGGCGGG - Intergenic
1049712474 8:144071532-144071554 GGAGGCCAAGGCGGGAGGTCAGG - Intergenic
1049967880 9:795832-795854 GGAGGCCAAGGTGGGCGGTCTGG - Intergenic
1050526161 9:6548672-6548694 CCAGGTGCAGGCGGGTGGGCTGG + Intronic
1051170317 9:14314328-14314350 GCGGGGCGAGGCGGGCGGGCGGG - Intronic
1051774592 9:20621012-20621034 CCAAGCCGGGCCGGGCGGGCGGG - Intronic
1052928585 9:34038645-34038667 GGAGGCCAAGGCAGGCGGGTGGG - Intronic
1053000306 9:34574148-34574170 CCAGGCCGAGGAGGGAGGCCTGG + Intronic
1053129077 9:35605304-35605326 GCGGGCGGAGGCGGGCGGGCGGG - Exonic
1053752942 9:41274216-41274238 ACAGACCCGGGCGGGCGGGCCGG + Intergenic
1054324398 9:63705907-63705929 ACAGACCCGGGCGGGCGGGCCGG + Intergenic
1054333304 9:63781476-63781498 ACAGACCCAGGCGGGCGGGCCGG - Intergenic
1055355821 9:75436051-75436073 CCAACCCAAGGCGGGAAGGCTGG + Intergenic
1057054121 9:91948873-91948895 CCGGCCCGAGGCGCGCGGGCGGG + Intronic
1057275418 9:93673690-93673712 CCAGGCCAAGGGGAGCTCGCTGG + Exonic
1057294652 9:93828064-93828086 GCGGCCCAGGGCGGGCGGGCGGG + Intergenic
1057744629 9:97741402-97741424 CCCGGCAGAGGCGGGCGGGCAGG - Intergenic
1057757312 9:97848580-97848602 TCCGACCCAGGCGGGCGGGCGGG - Intergenic
1059452070 9:114376820-114376842 CCAGGCCAACGCGGCAGGGCAGG - Exonic
1059456972 9:114405980-114406002 CCAGGCCATGGCGGACAGGAAGG + Intronic
1059499050 9:114735068-114735090 GGAGGCCAAGGGGGGCGGGGTGG + Intergenic
1060334706 9:122711151-122711173 GGAGGCCAAGGCAGGCGGGTGGG - Intergenic
1060478132 9:124000181-124000203 CCGGGCCAGGGCCGGGGGGCGGG - Intergenic
1061075844 9:128340883-128340905 CCAGGCCGAGTCGGGCGAGGTGG + Intronic
1061121925 9:128648482-128648504 CCAAGCCAAGCCAAGCGGGCAGG + Intronic
1061136403 9:128736609-128736631 GGAGGCCAAGGCGGGTGGTCAGG - Intronic
1061275911 9:129569240-129569262 CCAGGCCAGGGAGGGAGGGCAGG + Intergenic
1061852507 9:133424317-133424339 CCAGGGGAAGGAGGGCGGCCTGG - Exonic
1061872599 9:133528714-133528736 CCCGGCCCAGGAGGGCTGGCCGG + Intergenic
1061993025 9:134170379-134170401 CCAGGCCAAGGCCAGCAGGACGG - Intergenic
1062025571 9:134338731-134338753 CCAGGGCAAGGCTGGGGTGCCGG - Intronic
1062174174 9:135151752-135151774 CCAGGCCAAGGCCTGGGGGACGG - Intergenic
1062403212 9:136381502-136381524 CCAGGCCAGGGTGGGAGGGGAGG + Intronic
1062405277 9:136393251-136393273 TCAGGCCACGGGGGGCAGGCGGG + Intronic
1062439653 9:136564071-136564093 CCAGGCCCTGTCGGGTGGGCAGG - Intergenic
1062485778 9:136774791-136774813 CCAGGCCATGGCAGGCGTACAGG - Intergenic
1062574539 9:137200169-137200191 CCCGGGCGCGGCGGGCGGGCTGG + Exonic
1062599658 9:137314177-137314199 CCAGGCCTCGGCGGGCAGGTTGG - Intronic
1189335580 X:40168919-40168941 GCCGGCCAGGGCGGGCGGGCGGG - Intronic
1191025376 X:55908222-55908244 CCAGGACAAAGGGGGCGGGGAGG + Intergenic
1191105438 X:56769340-56769362 CCAGGCGAAGTGGGGCAGGCTGG - Intergenic
1191106431 X:56774742-56774764 CCAGGCGAAGTGGGGCAGGCTGG - Intergenic
1191107424 X:56780144-56780166 CCAGGCGAAGTGGGGCAGGCTGG - Intergenic
1192153099 X:68724140-68724162 CAAGGCCAAGGGGGTCGAGCAGG - Intronic
1192177523 X:68895205-68895227 GCAGGCTCAGGCGGGCAGGCAGG + Intergenic
1192583271 X:72301949-72301971 CCAGGCCAACCCGGGGAGGCAGG - Exonic
1192738840 X:73874384-73874406 CCTGGCCAAGGAGGGAGGTCAGG + Intergenic
1193144990 X:78067037-78067059 GGAGGCCAAGGCGGGCGGATTGG + Intronic
1193362093 X:80590751-80590773 GGAGGCCAAGGCAGGCGGGTGGG - Intergenic
1196630001 X:117927272-117927294 CCAGGCCAGGCCGGGAGGGGCGG - Intronic
1198056888 X:133004443-133004465 GGAGGCCAAGGCGGGTGGTCAGG + Intergenic
1200101126 X:153689421-153689443 CTGGGCCCGGGCGGGCGGGCGGG - Intronic
1200202960 X:154295287-154295309 CCAGGCTATGGCGGGCAGGGTGG - Intronic
1200212005 X:154350873-154350895 GCAGGGCAGGGCGGCCGGGCAGG + Intronic