ID: 1184369602

View in Genome Browser
Species Human (GRCh38)
Location 22:44074242-44074264
Sequence TCAGGGGCTCAGAAATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184369602_1184369609 6 Left 1184369602 22:44074242-44074264 CCCTGGCATTTCTGAGCCCCTGA 0: 1
1: 0
2: 1
3: 30
4: 289
Right 1184369609 22:44074271-44074293 CTGTTGCCTGCACGACGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 95
1184369602_1184369608 1 Left 1184369602 22:44074242-44074264 CCCTGGCATTTCTGAGCCCCTGA 0: 1
1: 0
2: 1
3: 30
4: 289
Right 1184369608 22:44074266-44074288 CGGTTCTGTTGCCTGCACGACGG 0: 1
1: 0
2: 0
3: 2
4: 44
1184369602_1184369610 7 Left 1184369602 22:44074242-44074264 CCCTGGCATTTCTGAGCCCCTGA 0: 1
1: 0
2: 1
3: 30
4: 289
Right 1184369610 22:44074272-44074294 TGTTGCCTGCACGACGGCCTGGG 0: 1
1: 0
2: 0
3: 0
4: 80
1184369602_1184369613 24 Left 1184369602 22:44074242-44074264 CCCTGGCATTTCTGAGCCCCTGA 0: 1
1: 0
2: 1
3: 30
4: 289
Right 1184369613 22:44074289-44074311 CCTGGGTGAGCAACACTGACAGG 0: 1
1: 0
2: 1
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184369602 Original CRISPR TCAGGGGCTCAGAAATGCCA GGG (reversed) Intronic
900410602 1:2510891-2510913 TCAGGGCCCCAGAGATGCCAGGG + Intronic
900483603 1:2910991-2911013 CTGGGGGCTCAGAACTGCCATGG - Intergenic
901186837 1:7379035-7379057 TCAGGTGCTCAAGAAAGCCAGGG - Intronic
901422488 1:9160499-9160521 CCAGGCGCTCAGTAATGTCAAGG - Intergenic
903587085 1:24424418-24424440 TATGTGACTCAGAAATGCCACGG + Intronic
903767946 1:25746849-25746871 TCTGGGTCTCAGAGATGACAGGG - Intronic
903811725 1:26038433-26038455 TCAGGGCAACAGAAGTGCCAGGG + Exonic
904403895 1:30274010-30274032 TCAGGGGCTGCCAAATGGCAAGG - Intergenic
904468320 1:30720838-30720860 GCAGGGGCTCAGAAATGGAAGGG - Intronic
906240129 1:44237827-44237849 TCAGGGGCTCCCGAAGGCCACGG + Intronic
906345594 1:45012543-45012565 TCAGGGGCTGAGAAATACCCAGG - Intronic
907053487 1:51345023-51345045 CCAGGTGGTCAGAAAGGCCATGG + Exonic
907669740 1:56464078-56464100 TCAGGAGCTCATAGAGGCCAGGG - Intergenic
908962184 1:69711458-69711480 TCAGGGGATTTGAAATGTCAAGG - Intronic
909336437 1:74480324-74480346 TCACACGCTCAGGAATGCCAAGG - Exonic
913058728 1:115185288-115185310 GCAGGGGCTCTGAAAAGCCATGG + Intergenic
913540732 1:119818313-119818335 TCAGGGACTCACAAAGCCCAAGG - Intergenic
913568527 1:120097569-120097591 CCAGGGGGTGAGAAATGCCAAGG + Intergenic
914289340 1:146258596-146258618 CCAGGGGGTGAGAAATGCCAAGG + Intergenic
914550376 1:148709349-148709371 CCAGGGGGTGAGAAATGCCAAGG + Intergenic
915400541 1:155618648-155618670 TCACAGGCTCAGGAATGCCATGG - Intergenic
915418066 1:155757654-155757676 TCACAGGCTCAGGAATGCCATGG - Intronic
916491239 1:165304220-165304242 TCATGGGATCAGAAAGCCCATGG + Intronic
918987431 1:191651123-191651145 TCAGTGGCTCAGTGATGCCAGGG - Intergenic
920847104 1:209603408-209603430 CAGGAGGCTCAGAAATGCCAAGG + Intronic
920906819 1:210178321-210178343 CCAAGGGCTCACAAATGTCATGG + Intergenic
922912573 1:229230000-229230022 GCAGGAGCACAGAAGTGCCAGGG + Intergenic
924025599 1:239829818-239829840 TCAGAGCCTCAGAATTGCTAGGG + Intronic
1063062700 10:2574163-2574185 CCTGGGACTCAGGAATGCCAGGG - Intergenic
1063097097 10:2917848-2917870 TCTGGGGTTCAGAAAGACCAAGG - Intergenic
1063351744 10:5362875-5362897 TTATGGGCTCTGAGATGCCAGGG - Intergenic
1063583297 10:7329163-7329185 TCACGGACTAAGAAATGTCATGG + Intronic
1065168596 10:23005933-23005955 TGAGGGGCTCTGAAATGCTGGGG + Intronic
1067278406 10:44853771-44853793 TCAGGGGCACACTGATGCCAGGG - Intergenic
1067543600 10:47175833-47175855 TCAGGGTTGCTGAAATGCCAAGG - Intergenic
1069051786 10:63802974-63802996 TCAAGGGCACAGAAACCCCAGGG - Intergenic
1069577078 10:69538342-69538364 TCATGCCCTCAGAAAAGCCAGGG - Intergenic
1070471017 10:76779588-76779610 TCAGGGACCCAGAAATCTCAAGG - Intergenic
1071489145 10:86124109-86124131 TCAGGGACACAGAAATCCTAAGG - Intronic
1071491294 10:86138402-86138424 CCAGGTGCTAAGAAATCCCAAGG + Intronic
1071676957 10:87663575-87663597 TCAGGGGAGGAGAAATACCAGGG + Intronic
1071859278 10:89656078-89656100 TGAAGGTCTCTGAAATGCCATGG - Intergenic
1075236823 10:120738119-120738141 TCAGAGCCTCAGAGATGCTATGG + Intergenic
1076375457 10:129980893-129980915 TCAGCAACCCAGAAATGCCAAGG + Intergenic
1076597165 10:131631013-131631035 TCTGGGCCTCAGGGATGCCAAGG - Intergenic
1076992735 11:284263-284285 TCAGGGCCTCAGAAAGGTCTCGG - Exonic
1077179975 11:1207914-1207936 CCAGAGGCTCAGCAACGCCAGGG + Intergenic
1077240410 11:1507748-1507770 TCACAGGCTCAGAAAAGCCAGGG + Intergenic
1078589816 11:12630592-12630614 TCAGGGGCTCACTCTTGCCAGGG - Intergenic
1078663491 11:13305899-13305921 CCAGCAACTCAGAAATGCCAAGG - Intronic
1080656896 11:34265328-34265350 TCTTGGGCTGAGAACTGCCATGG - Intronic
1081218075 11:40426579-40426601 TCAGAGGCTGATAAATGCTAAGG - Intronic
1081660205 11:44883510-44883532 GCTGAGGCTCAGAAAGGCCAAGG + Intronic
1081744147 11:45461380-45461402 TCAGGGGCTGGGAAATTTCAGGG - Intergenic
1083078036 11:60061893-60061915 TCTGGGGAGCAGAAATGCAAAGG + Intronic
1083413909 11:62512975-62512997 CCATGGGCTCACAAATGGCAGGG - Intronic
1083714898 11:64569570-64569592 TCCTGGGCTCACAGATGCCAGGG - Intronic
1083942414 11:65903510-65903532 TCTGGGGCTCAGAGATGGGAAGG - Intergenic
1084475640 11:69387117-69387139 TCAGGGGCTAATACATGCCAAGG - Intergenic
1084928583 11:72535391-72535413 TCTGGGTTTCAGAAAGGCCAGGG - Intergenic
1085628463 11:78091944-78091966 TCACGTTCTCACAAATGCCATGG + Intergenic
1085639761 11:78186049-78186071 CCTGGGCCTCAGAAATGTCAAGG + Intronic
1086791452 11:91043581-91043603 TCAGGAGCTCAGAAAAGTCAGGG + Intergenic
1089307956 11:117538542-117538564 GCAGGGCCTCAGAATTGCCAAGG - Intronic
1089618555 11:119709297-119709319 TCAGGGGCTGAGACAGGCCCTGG - Intronic
1090225503 11:125069880-125069902 TCTGTGGCTCTGAAACGCCATGG - Intronic
1090306550 11:125696294-125696316 ACAGTGGCTGAGGAATGCCAGGG - Intergenic
1091762762 12:3097948-3097970 TCAGGAGCTCAGTGATGCCGGGG + Intronic
1091871042 12:3891585-3891607 TCTGGGGCTCAGGCATGGCAGGG - Intergenic
1092232445 12:6783718-6783740 TCTGAGGCTCAGCAGTGCCATGG - Intergenic
1092787123 12:12037024-12037046 TCAGAGGCTCAGGAATGTCAGGG + Intergenic
1094777297 12:33745612-33745634 TGAGGGTCTCTGAAATGCCCTGG - Intergenic
1095722258 12:45413489-45413511 TCAGGAGCTCAGAGGAGCCATGG + Intronic
1096862532 12:54540204-54540226 TCCGAGGCCCAGAAATGCTAGGG + Intronic
1098041713 12:66359558-66359580 TCTGAGGCTCAGAAAAACCAAGG - Intronic
1099981106 12:89603965-89603987 TCAGGGGCTCAGCAATTCTCAGG + Intronic
1100741182 12:97595357-97595379 TCATGGCTTCAGAAATCCCAGGG - Intergenic
1101774426 12:107780677-107780699 TCAGAGGCTCAGAGGTGACAAGG + Intergenic
1102224247 12:111216791-111216813 TCAGTGGCTCAGGAAAGCCCTGG + Intronic
1102962463 12:117101484-117101506 TCAGCGGCTCAGAACTCCCAGGG - Intergenic
1102983642 12:117261959-117261981 CCAGAGGCTCAGAAATACCCAGG + Intronic
1103204303 12:119116376-119116398 TCAGGGGCTCAGTCTTACCAGGG + Intronic
1103645507 12:122389171-122389193 GCAGGGGCACAGACTTGCCATGG - Intronic
1103860795 12:124011798-124011820 CCAGGGGCTCAAAAACGCAAAGG + Exonic
1104123184 12:125818906-125818928 TCAGGTGCTCATAAGTCCCAAGG + Intergenic
1105713147 13:23032989-23033011 TGAGGGGCAGAGAAAAGCCAAGG + Intergenic
1106587560 13:31070421-31070443 TCAAAGGCTCAGAAATGCTCAGG - Intergenic
1107724714 13:43287029-43287051 ACAGGGGCTCAGACAGGCCTAGG + Intronic
1107738606 13:43424801-43424823 TCAGGGCCTCATAAATGGTATGG + Intronic
1109691077 13:65890282-65890304 TCAGTGGCTCAATAATGTCAAGG + Intergenic
1109848860 13:68034583-68034605 CCAGGAGCTAAGAAATGGCAAGG - Intergenic
1110304308 13:73967291-73967313 AGAGAGGCACAGAAATGCCAAGG + Intronic
1111610023 13:90592355-90592377 TCAAGGACTCAGACATGACAAGG - Intergenic
1117102666 14:52366416-52366438 TCAGGGGCTCTAAAATGTGATGG - Intergenic
1120186361 14:81397512-81397534 TCAGGGGCTCAGTAACCACATGG + Intronic
1120454246 14:84711884-84711906 TCAAGGTCTCAGTGATGCCAGGG + Intergenic
1120497820 14:85258430-85258452 TCAAGGGCTCTGAAAAGCCCTGG + Intergenic
1121653099 14:95574433-95574455 TCAAGGTCTCAGAAATGACTAGG + Intergenic
1121739511 14:96241564-96241586 GCATGGGCCCAGGAATGCCAAGG + Exonic
1122141856 14:99667463-99667485 CCAGGGGCTCAGAACTCCAACGG + Intronic
1122810029 14:104283256-104283278 CCAGGGGCTCAGGAAGGCCCCGG + Intergenic
1122916817 14:104863258-104863280 TCCTGGGCTCCCAAATGCCACGG + Intergenic
1123449735 15:20352212-20352234 TCTGGGGGTCAGAAGTCCCACGG + Intergenic
1124594539 15:31081995-31082017 TCTGGGGCTGAACAATGCCAAGG + Intronic
1125759429 15:42086928-42086950 TCAGGGAGCCAGAAAAGCCAGGG - Intronic
1126198486 15:45957702-45957724 TCATGGGCTCAGAACTTTCAAGG + Intergenic
1126709735 15:51443075-51443097 TCTGGAGCTCAGGACTGCCAGGG + Intergenic
1127132330 15:55880373-55880395 TCTGGTGCTCTGAAATGTCACGG - Intronic
1128303161 15:66580069-66580091 GCAGAGGCTAAGAGATGCCAGGG + Intergenic
1129271568 15:74421843-74421865 GCAGGGGCTGAGCAAGGCCAGGG + Intronic
1132276231 15:100566677-100566699 TTAGATGCTCAGAAAGGCCAAGG + Intronic
1132747492 16:1443069-1443091 TCAGAGGCCCAGGAAAGCCATGG - Intronic
1132907493 16:2290401-2290423 CCAGGAGCTCAGAGAGGCCAGGG + Intronic
1133120965 16:3607398-3607420 TCAGGAGCTCAGAGAGCCCATGG + Intronic
1134813683 16:17188442-17188464 TCAGATCCTCAGATATGCCAGGG + Intronic
1135867885 16:26121449-26121471 TCTGAGGCTCAGAATTGCGATGG + Intronic
1136002706 16:27307082-27307104 TCAGCTGCTCAAAAATGTCAGGG + Intergenic
1137403266 16:48170660-48170682 TCAGGGGCACAGCAAAGACAAGG - Intronic
1137527043 16:49245352-49245374 TCAGAGGCTCTGAAATTCCCAGG + Intergenic
1137842699 16:51654482-51654504 TCAAGGGTTCAGATAAGCCAAGG - Intergenic
1137976174 16:53034016-53034038 TCAGTGGCTCATGAAAGCCATGG + Intergenic
1138314311 16:56055486-56055508 ACCGGGGCTCAGAAACACCAAGG - Intergenic
1138639278 16:58370357-58370379 TCAAGGGATCAGAATTGTCAGGG + Intronic
1138885519 16:61073145-61073167 TCATTGGCTCAGAATTGCAAAGG + Intergenic
1139432674 16:66919483-66919505 TCAGGGACTCAGGAATGACCTGG + Intergenic
1139563074 16:67756073-67756095 TCACAGTCACAGAAATGCCAGGG + Intronic
1139962908 16:70728175-70728197 TCTGGGGCTCAAACCTGCCATGG - Intronic
1141127840 16:81413765-81413787 TCAGAGGCTGCCAAATGCCAGGG + Intergenic
1141242160 16:82274227-82274249 TCAGGAGCTCAGAAATAAGATGG - Intergenic
1142153802 16:88524194-88524216 TTAGAGGCTCAGGAAGGCCAGGG + Intronic
1143599523 17:7935100-7935122 TCAGGGGCTGAGAGATGCATTGG + Exonic
1145211337 17:21015420-21015442 ACAGGGTCCCAGAAATGCCAGGG + Intronic
1145763439 17:27441297-27441319 TCAGGAGTTCAGAACTGACATGG - Intergenic
1145868100 17:28253502-28253524 TCAGGGGCTCCAAAATGGCCAGG - Intergenic
1146529889 17:33599495-33599517 TCTGGGGCTCAGAACTACCGGGG + Intronic
1146579629 17:34025174-34025196 TCAGGGGCTCAGAAGGAACAAGG - Intronic
1146667415 17:34714480-34714502 ATAGGAGCTCAGGAATGCCATGG - Intergenic
1147897140 17:43758219-43758241 TCAGGGGCTCAGAAAAGAAAAGG - Intronic
1147924009 17:43935702-43935724 TCAGGGGCTCCAAAATGGCCAGG + Intergenic
1148644439 17:49211054-49211076 TCAGAGCCTCAGAGATGCCTGGG + Intronic
1149524872 17:57347647-57347669 TCAGGGGGGTAGAAATCCCAGGG - Intronic
1149764200 17:59261290-59261312 GCAGGGGCTGAGAGATCCCAAGG + Intronic
1150952663 17:69821178-69821200 CCAGGAGCACAGAAATGCCTGGG - Intergenic
1150959820 17:69901079-69901101 TCAGAGGCTCTTCAATGCCAAGG + Intergenic
1152282927 17:79396042-79396064 TCAGGGGCTCAGACATCCTCAGG - Intronic
1152338906 17:79713678-79713700 TCTGGGGGTCAGAAGTCCCATGG - Intergenic
1152786898 17:82253004-82253026 CCAGGGGCTCACCAATTCCAAGG + Exonic
1153138579 18:1945925-1945947 TCGGTGACTCTGAAATGCCAAGG + Intergenic
1154062234 18:11072823-11072845 TCAAGGGCTCAGTAAGGTCAAGG + Intronic
1154989952 18:21591287-21591309 TCATAGGCCCAGGAATGCCAGGG + Intronic
1158523217 18:58189022-58189044 TCAGGGGATCACAAAGCCCACGG - Intronic
1161236879 19:3202556-3202578 TCAGCAGCTCAGAGAGGCCAGGG + Intronic
1162784884 19:13028453-13028475 ACAAGGGCTCAGGAAGGCCATGG - Intronic
1162795206 19:13083453-13083475 CCAGAGGCTCAGAATGGCCAGGG - Intronic
1164663593 19:30004083-30004105 TTAAGGGCTCAGATTTGCCATGG + Intronic
1166329163 19:42068932-42068954 GCAGGGGCACGGACATGCCAGGG + Intronic
1167507594 19:49878996-49879018 TCTGGGTCTCAGAATTGCCCAGG - Intronic
926192502 2:10739345-10739367 TCGAGGGCACAGAAAAGCCATGG - Intronic
926195950 2:10763590-10763612 CCAGGGGCACAGGAATTCCAGGG + Intronic
927866415 2:26590744-26590766 TCAGGGGCTCATAAATGCCCAGG - Intronic
928225204 2:29442563-29442585 GCAGAGGCTCAGAAAGGCTAAGG - Intronic
929937897 2:46307935-46307957 TCAGGGCCTCAGTAAAGACATGG + Intronic
932012679 2:67994024-67994046 TAAGGGCCTCAGAGAGGCCATGG - Intergenic
932812759 2:74837977-74837999 TCAGGGCCACAAAAATGGCAAGG - Intronic
932834562 2:75023996-75024018 TCAGGGACCCAGAATTGACAAGG - Intergenic
934677782 2:96261870-96261892 GCAGGGGCTGAGAAATGGTAAGG + Intronic
935416110 2:102821121-102821143 TCTGTGCCTCAGACATGCCAAGG + Intronic
935617334 2:105100269-105100291 TCAGGAGCTCAGCAGAGCCAGGG + Intergenic
936029114 2:109057636-109057658 TCGGAGGCTCAGAAAGACCAAGG - Intergenic
936671605 2:114662761-114662783 ACAGGGGCCCTGAAGTGCCAGGG + Intronic
936978003 2:118238411-118238433 TCAGGGGTTAAGAACTGCAAGGG + Intergenic
939660968 2:144889192-144889214 TTGGGGTTTCAGAAATGCCATGG + Intergenic
942457738 2:176149510-176149532 TCAGGGGCACAGGGATGCCCTGG - Intergenic
943044893 2:182848766-182848788 TCAAAGTCTCAAAAATGCCATGG + Intronic
945160693 2:206887383-206887405 TCAGGGGCTCATGGATGGCAGGG - Intergenic
945833753 2:214814046-214814068 GCAGGGTCTCAGTAAAGCCATGG + Intergenic
947333386 2:229054209-229054231 TCAGGGGATCAGAAAAGACCAGG + Intronic
947968564 2:234302645-234302667 TCAGGGGCTCTGAAATGAGAGGG - Intergenic
1170172429 20:13430307-13430329 TCTGTGGGTCAGAAATTCCACGG + Intronic
1170447949 20:16449373-16449395 TCTGGAGCTCAGTATTGCCAAGG - Intronic
1171152508 20:22839597-22839619 TCCTGGGCTCAGAAATCACAAGG - Intergenic
1171388093 20:24783648-24783670 CAAGGAGCTCAGAAATGCTAAGG + Intergenic
1171431788 20:25087591-25087613 TCAAGGTCACAGAACTGCCAAGG - Intergenic
1171847839 20:30288514-30288536 GCAGGAGCTCAGAGATGCCCGGG - Intergenic
1172775676 20:37405309-37405331 CCTGGGGCTCCGAAATTCCAAGG + Exonic
1173623705 20:44455981-44456003 TCTGAGGCTCAGAGATGGCAAGG + Intronic
1173946083 20:46952096-46952118 TCCGGGGGTGAGAAATGCAATGG + Intronic
1175562694 20:59944586-59944608 TCAGGGGCACTGAAAAGCCCTGG + Exonic
1175855340 20:62118082-62118104 TTAGGGGCTCAGGAATGGCTGGG - Intergenic
1175905353 20:62376838-62376860 TGAGGGGCTCTGAAGGGCCATGG - Intergenic
1177839868 21:26223562-26223584 TCAGGGCCTTACAAATTCCAAGG - Intergenic
1178437932 21:32575841-32575863 TCAGGGTGGCAGCAATGCCATGG + Intergenic
1178786447 21:35658141-35658163 CCAAGGGCTCAGAAATGGCTTGG + Intronic
1178811897 21:35891850-35891872 TCTGGGACTCAGAAATGGAATGG + Intronic
1179397001 21:41049711-41049733 TCAGAGGCTCAGAAAGGAGAGGG - Intergenic
1179780863 21:43700067-43700089 TCAGGGGCTGAGCACTGTCAGGG - Intergenic
1183080778 22:35454650-35454672 TCAGAGGCTCAGAGAGGTCAAGG - Intergenic
1184215907 22:43067115-43067137 TCAGCTGCTCAGAAGTGCCCGGG - Intronic
1184369602 22:44074242-44074264 TCAGGGGCTCAGAAATGCCAGGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185154831 22:49187197-49187219 TCATGTTCTCACAAATGCCAGGG - Intergenic
949273386 3:2248004-2248026 TCAGGTGGTGATAAATGCCATGG - Intronic
950313670 3:11981120-11981142 TCAGTGACTCATAAATGCTAGGG + Intergenic
952222948 3:31342677-31342699 TCAGGTGCTCAGTTGTGCCAAGG + Intergenic
952392969 3:32896588-32896610 TGAGGGGCTTATAAATGTCATGG + Exonic
953059298 3:39414037-39414059 TCAAGTGTCCAGAAATGCCAAGG - Intergenic
953583848 3:44181716-44181738 GCAGGGGGTCAGACAAGCCAAGG + Intergenic
954191655 3:48966810-48966832 TCAGGGTTTCAGAATTGCCAAGG - Intronic
955071086 3:55572934-55572956 CCAGGAGCTCAGAAACCCCAGGG + Intronic
955654841 3:61233878-61233900 TCAGCAGCTCAGAGATGTCAAGG - Intronic
957717770 3:83953132-83953154 GCAGTGGCCCAAAAATGCCAAGG + Intergenic
960269198 3:115656134-115656156 TCAAGGGCTATGAAATGTCATGG + Intronic
961048562 3:123726651-123726673 TCAAGGGCTCAGAGCTGCCGGGG + Intronic
961408795 3:126703804-126703826 TGAGGGGCGCTGTAATGCCAGGG + Intergenic
961528748 3:127526568-127526590 AGAGGGGCTCCGAAATGCCGGGG + Intergenic
962451071 3:135517605-135517627 TCAGGTTCTCAGAAATGGGATGG + Intergenic
965266715 3:166552757-166552779 TCAGGGAATGAAAAATGCCATGG + Intergenic
966813869 3:183872904-183872926 TCAGTGGCTCAAAAATGTCAAGG - Intronic
968131839 3:196196692-196196714 TCAGGGCCCCAGAAATGGTAAGG + Intergenic
968728724 4:2260003-2260025 TCAGGGGCTCAGAGATCCTCTGG + Intronic
968979875 4:3841484-3841506 TCAGCAGCTCAGAAAGGCCATGG - Intergenic
969343850 4:6559025-6559047 TCTGTGGCTCTGCAATGCCAGGG + Intronic
969528365 4:7715680-7715702 GCAGAGGCTCAGAAAGACCAGGG - Intronic
971021665 4:22543150-22543172 CTGGGGCCTCAGAAATGCCAAGG + Intergenic
971365047 4:25970768-25970790 CCTGGGGCTCAGGAATGCCATGG - Intergenic
972957614 4:44411865-44411887 TCAGGGTCTCAGAAAGAACAAGG + Intronic
974499660 4:62684019-62684041 GCAGGGGCTCTGAGATCCCAAGG + Intergenic
977334294 4:95676637-95676659 TCATGCTCTCAGTAATGCCATGG - Intergenic
978668424 4:111214963-111214985 CAAGGTGCTCAGAAAAGCCAAGG + Intergenic
979373952 4:119922168-119922190 AAAGGGAATCAGAAATGCCAGGG - Intergenic
980590678 4:134884008-134884030 TCATGAACTCAGAGATGCCAGGG - Intergenic
982428899 4:155298904-155298926 CCAGGGTCTCTGAAATGCCTTGG + Intergenic
984085706 4:175308696-175308718 TCTGGGGATCAGGAATGTCAGGG - Intergenic
984504865 4:180604795-180604817 TCAAGGGCTCACAAACGACAAGG - Intergenic
987095992 5:14550688-14550710 TCAGGGGGTCTGTAATACCAAGG - Intergenic
987338163 5:16915505-16915527 TCATGGTCTCAGTAATGGCAGGG + Intronic
988531593 5:32032332-32032354 TCAGGGGCTGAGAATGGCCTAGG - Intronic
989397334 5:40971853-40971875 TCCTGGGCTCAGAAAAGCAATGG - Intronic
990447394 5:55905320-55905342 GGCGGGGCTCAGAAATTCCAGGG - Intronic
992267104 5:75030407-75030429 ACAGGGCCTCAGAGATGCAAAGG + Exonic
993805943 5:92409506-92409528 TCAGGCTCTCAGAACTGCAAAGG + Intergenic
994153166 5:96473357-96473379 TGAGGGGCTCAGAATTGCACTGG + Intergenic
998444200 5:142186014-142186036 TCAGTGGCTCAGAAACACCCAGG - Intergenic
1000586864 5:163111178-163111200 TAAAGGTCTCAGAAAAGCCATGG - Intergenic
1002537609 5:179886145-179886167 TGAGGGGATCAGGAGTGCCAGGG - Intronic
1004162754 6:13229407-13229429 TCAGCTGCTCAGAAATGCTGGGG + Intronic
1006674499 6:35752480-35752502 TCAGGGGCTCCCCATTGCCATGG + Intergenic
1006723014 6:36172262-36172284 CCACGGGCTCATAAATGCTAAGG - Intergenic
1008703241 6:54127028-54127050 TCAAGGGCTCAGAGATGGGAAGG - Intronic
1014083237 6:117312377-117312399 TCTGGGGCTCACTATTGCCATGG + Intronic
1015315209 6:131808789-131808811 GCAGGTGCTCAGAAATTCCATGG + Intronic
1016126262 6:140408199-140408221 TGAAGGTCTCTGAAATGCCATGG - Intergenic
1016412024 6:143793411-143793433 TCTGGGGCTCAGATCTGCAAGGG - Intronic
1017445975 6:154508071-154508093 GCAGAGGCTCAGAAAAGCCAGGG + Intronic
1017584822 6:155909191-155909213 ACAGGGGCTCAGAAGGCCCATGG - Intergenic
1017710928 6:157167190-157167212 TCAGGAGCGCAGAGCTGCCAAGG - Intronic
1018304017 6:162435411-162435433 ACATGGGCACAGAAATGTCAAGG + Intronic
1018886781 6:167945302-167945324 TCAGGGGCAGTGACATGCCATGG + Intronic
1019618527 7:1978196-1978218 TCAGGAGCTCACCAAGGCCAAGG - Intronic
1022216002 7:28262086-28262108 ACAGAGCCTCAGAAATTCCATGG + Intergenic
1022499938 7:30876515-30876537 CCAGGGGCTCAGAAAGGGCTGGG + Intronic
1022685440 7:32591965-32591987 TCATGCTCTCAGGAATGCCAAGG + Intergenic
1023048074 7:36228811-36228833 TCTGGGACTCAGAAATGAAAGGG + Intronic
1023609080 7:41956235-41956257 TCCTGTGCTCAGAAATTCCAGGG - Intergenic
1024365703 7:48517827-48517849 TCAGGGGCTGAGAAATGACCTGG + Intronic
1024852663 7:53739136-53739158 TAAGGGGCCCAGAAAAGCTAGGG + Intergenic
1024964106 7:55006252-55006274 ACAGGGACCCAAAAATGCCAGGG - Intergenic
1025966741 7:66280077-66280099 ACAAGGGCCGAGAAATGCCAGGG - Intronic
1028498022 7:91484127-91484149 TGCGGGGTTCAGAAATGTCAGGG - Intergenic
1029481868 7:100818360-100818382 TCTGAGGCTCAGACAGGCCAAGG + Intronic
1031483881 7:122306398-122306420 TCAGGGACTTAATAATGCCAGGG - Intronic
1031485070 7:122315583-122315605 TCAAGGGCTCTGAAATGGGACGG - Intergenic
1032059929 7:128715843-128715865 TCTGGGGCTCAGCAAAGCCCAGG - Intronic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1034857657 7:154567682-154567704 AAATGGTCTCAGAAATGCCAGGG - Intronic
1034986682 7:155520355-155520377 GCAGGCGCTAAGAAATGCCCTGG - Intronic
1037309102 8:17536157-17536179 TCAGGGCCCCAGGAATACCAAGG - Intronic
1037706092 8:21316393-21316415 TCAGTTGCTCAGAAATCACAGGG + Intergenic
1038413324 8:27375160-27375182 ACATGGGCTCAGGAGTGCCAAGG + Intronic
1038717102 8:30000828-30000850 TCAGGCGATCCGAAATGCAAAGG - Intergenic
1041425778 8:57718759-57718781 TCAGTGGCTCAGAATGGCCAAGG + Intergenic
1043552003 8:81385234-81385256 TGAGAGGCTCAGCAATTCCAAGG - Intergenic
1043587518 8:81786350-81786372 ACTGAGGCTCAGAAATGCAAAGG + Intergenic
1045355819 8:101388119-101388141 CCAGCCACTCAGAAATGCCAAGG + Intergenic
1045541214 8:103087439-103087461 TCTGGGACTCAGAAATGGAATGG - Intergenic
1047375215 8:124289270-124289292 CCAGGGGCTGAGAAAGGCTAAGG + Intergenic
1047595065 8:126370144-126370166 TCTGGGGTGCAGAACTGCCAGGG + Intergenic
1048044197 8:130757895-130757917 TCAGTGGCTCAGTGATGTCATGG + Intergenic
1048063386 8:130943650-130943672 TCAGGAGCTCAGGAAGGACAAGG + Intronic
1048358521 8:133674250-133674272 TCAGGGGCTCGAAAATGCAGGGG - Intergenic
1048708689 8:137183763-137183785 TCAGGTTTTCAGAAAAGCCAGGG - Intergenic
1049002929 8:139837634-139837656 TCAGCAGCTCAGAAACGCCTTGG - Intronic
1049608187 8:143539418-143539440 GCAGGGGCTCAGAAGTGAGATGG - Intronic
1050627383 9:7519436-7519458 TCAGAGAATCAGAGATGCCAAGG + Intergenic
1050651125 9:7778106-7778128 TCAGGTGCTCAGACATGCACTGG + Intergenic
1051878304 9:21813476-21813498 TCAGGGGCTCTGAAATTCAGCGG + Intronic
1053785972 9:41653160-41653182 GCAGGAGCTCAGAGATGCCCGGG - Intergenic
1054159082 9:61661037-61661059 GCAGGAGCTCAGAGATGCCCGGG + Intronic
1054174687 9:61867093-61867115 GCAGGAGCTCAGAGATGCCCGGG - Intergenic
1054478856 9:65592042-65592064 GCAGGAGCTCAGAGATGCCCGGG + Intergenic
1054662851 9:67713700-67713722 GCAGGAGCTCAGAGATGCCCGGG + Intergenic
1054769507 9:69070410-69070432 ACAGGGGCTCAGAAGTGCTAGGG + Intronic
1055375129 9:75640648-75640670 TCTGTGGCTCAGGAATACCAGGG - Intergenic
1055788346 9:79895151-79895173 TGAGGGGCTGAGCAATCCCATGG - Intergenic
1056309361 9:85323342-85323364 ATAGGGGCTCAGAAGTACCAGGG + Intergenic
1056899602 9:90585314-90585336 GCAGGGGTCCAGAAGTGCCAGGG + Intergenic
1057487714 9:95499047-95499069 TCACTGTCTCAGAAATGCTAGGG + Intronic
1059210524 9:112510718-112510740 TCAGGTGATAATAAATGCCATGG + Intronic
1059779851 9:117514941-117514963 TCAGGGGCTCCATAATACCAGGG - Intergenic
1060376694 9:123120804-123120826 TCAGGCTCTCAAAACTGCCAGGG + Intronic
1060479647 9:124010906-124010928 TTAGGAACTCAGAAAGGCCAGGG - Intronic
1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG + Intronic
1061198440 9:129121840-129121862 ACAGGGGCTCAGACTTGCCCTGG + Intronic
1061645331 9:131996319-131996341 TGAGGGGCTCAGACCTGCCAGGG + Intronic
1062401813 9:136376122-136376144 TCAGGGGCACAGTGGTGCCAAGG + Intronic
1187590016 X:20707310-20707332 TCAGGGGCTCAGGACAGACAGGG + Intergenic
1187824247 X:23318735-23318757 TCAATGGCTCAAAAATGTCAGGG - Intergenic
1192165274 X:68823993-68824015 TCAGGGGCACAGGAATTCGAGGG - Intergenic
1194525067 X:94968068-94968090 TCTGGGCCACAGAAATGCCAGGG + Intergenic
1199779267 X:151043451-151043473 TTAGGGGCTCAATATTGCCAGGG + Intergenic
1200050275 X:153425714-153425736 TCAGGGGCTCCCACTTGCCATGG + Intergenic