ID: 1184371745

View in Genome Browser
Species Human (GRCh38)
Location 22:44086815-44086837
Sequence CTCTGAGTACGGATGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184371745 Original CRISPR CTCTGAGTACGGATGGAAGT TGG Intronic
901318378 1:8324097-8324119 CTCTGAGTAGGGAAGGCACTGGG + Intronic
901513411 1:9729819-9729841 GTCTGAGTATGGCTGGGAGTCGG - Exonic
902652435 1:17845356-17845378 CTCTGAGTCAGGATGGGGGTGGG + Intergenic
903509879 1:23867298-23867320 CTCTGAGAACTGTTGGAACTTGG - Intronic
904172682 1:28602453-28602475 CCCTGAGAAAGGATGGGAGTAGG - Intronic
904958538 1:34310603-34310625 CTTGTAGTACGGATTGAAGTTGG - Intergenic
906729717 1:48070636-48070658 CTCTGACTAGGGTTGGCAGTGGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
912040603 1:105384880-105384902 CTCTGATTAAGCATTGAAGTGGG - Intergenic
919606751 1:199692793-199692815 CTCTGAGCATGGTTGGAACTAGG + Intergenic
923995809 1:239492845-239492867 CTCTGAGTACTGATGAAAATTGG - Intronic
923999636 1:239536094-239536116 CTCTGAATTCAGATGGAATTTGG - Intronic
1063729884 10:8684612-8684634 CTCTGACTTGGGATGGAAGGTGG - Intergenic
1067942283 10:50667213-50667235 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1070863529 10:79692171-79692193 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1073106535 10:101035562-101035584 CCCTGTGTCCGGATGGAAGGCGG - Exonic
1077053779 11:580090-580112 CTCTGATCATGGATGGAGGTTGG + Intronic
1080045508 11:27803797-27803819 CTCTGAGTAGCAGTGGAAGTGGG - Intergenic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1089254790 11:117188563-117188585 CTCAGAGTTGGGGTGGAAGTGGG - Intronic
1089669774 11:120045807-120045829 GTCTGATTTGGGATGGAAGTAGG - Intergenic
1091683033 12:2540434-2540456 CTCTGAGAAGGGATGAAATTTGG + Intronic
1095085381 12:38053894-38053916 CTCTGAGTCCCGGTGGAGGTTGG + Intergenic
1095431013 12:42134605-42134627 GTCTGAGTAGGGAGGGAAATGGG - Intronic
1097235516 12:57536832-57536854 AACAGAGTACTGATGGAAGTAGG + Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099704268 12:86130000-86130022 CTCTGAGGAGTGATGAAAGTTGG + Intronic
1100236329 12:92664865-92664887 CTCTGAGTACCGAAGACAGTGGG - Intergenic
1101883229 12:108640120-108640142 CTCTGAGAACAGATTCAAGTGGG + Intergenic
1102548011 12:113670523-113670545 CTTTGAGTGAGGATGGGAGTTGG - Intergenic
1104047225 12:125171955-125171977 CTCTGCCTACGGAAGAAAGTAGG + Intergenic
1108380213 13:49847750-49847772 CTCTGAGTAGGTCTGCAAGTAGG + Intergenic
1112582525 13:100688727-100688749 CTCTGAGTAGGGAATGCAGTAGG - Intergenic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1125085091 15:35720705-35720727 CTCAGAGTACTCATGGAAGGAGG - Intergenic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1127737034 15:61851319-61851341 CCATGAGTACTGATGAAAGTGGG - Intergenic
1132090030 15:98940790-98940812 CTCTGATGACGGAGGGATGTGGG - Intronic
1133898522 16:9951606-9951628 CTCTGAGCACAAATGGAATTAGG + Intronic
1134844093 16:17425228-17425250 ATCTGGCTACGGAAGGAAGTTGG - Intronic
1144812006 17:18006609-18006631 CCCTGAGTTCGGGTGGAAGAAGG - Intronic
1150484700 17:65535827-65535849 GTCTCCGTAAGGATGGAAGTCGG - Intronic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155680850 18:28483691-28483713 CTCTGAGCAGGGAAAGAAGTGGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158683825 18:59594750-59594772 CTATGAGTAGGGATGAAAGGCGG + Intronic
1160199409 18:76783722-76783744 CTCTGAGGAAGGATGGAGGGAGG + Intergenic
1162744532 19:12791243-12791265 CTCGGGGTACGCATGGAAGGAGG - Intronic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
934743733 2:96744610-96744632 CACTGAGGAAGGGTGGAAGTGGG + Intergenic
942235913 2:173904746-173904768 CTCAGAGAAGGGATGTAAGTCGG + Intergenic
943890810 2:193284619-193284641 CTTTGGGGAAGGATGGAAGTGGG - Intergenic
946803422 2:223445257-223445279 CTCTGACTACAGATGGAAAATGG + Intergenic
946805431 2:223466234-223466256 TTCTGAGTAGGGATAGAATTTGG - Intergenic
948887227 2:240890365-240890387 CCCTGAATACGGAGGGATGTAGG + Intronic
1174130971 20:48343120-48343142 CTCTGTGCACTGATGGAAGCTGG + Intergenic
1174495659 20:50939916-50939938 CTCTGATTGCGGATGGGCGTTGG - Intronic
1177069785 21:16490226-16490248 CTCTGAGTGCTTATGGAAGGAGG - Intergenic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1181859181 22:25805107-25805129 CTCTCAGTGGGGATGGAACTGGG + Intronic
1184371745 22:44086815-44086837 CTCTGAGTACGGATGGAAGTTGG + Intronic
949374293 3:3370040-3370062 CTCGGGGAAAGGATGGAAGTGGG - Intergenic
962893419 3:139692767-139692789 CTCTGGGTACAGATGGAAATAGG + Intergenic
964057408 3:152478024-152478046 GTCTGGATATGGATGGAAGTAGG + Intergenic
967984797 3:195086802-195086824 CTCTAAGAACGGATGCATGTAGG + Intronic
975590449 4:75994516-75994538 CTCTGAGTGAGAAGGGAAGTTGG - Intergenic
976316751 4:83666860-83666882 CTCTGTTTATGAATGGAAGTGGG + Intergenic
982150432 4:152449349-152449371 CTTTGAGGACTGATGGAAGAGGG + Intronic
987175122 5:15300114-15300136 CTCTGAGTAAGAATGGTGGTAGG + Intergenic
988530572 5:32023722-32023744 CTCTGGGTACAGATGGCAGTGGG + Intronic
989493929 5:42089554-42089576 CGCTGAGGAAGGATGGAAATAGG - Intergenic
989494024 5:42090493-42090515 CACTGAGGAAGGATGGAAATAGG - Intergenic
992671791 5:79068990-79069012 CTTTGAGTACATATGGGAGTCGG - Intronic
998623313 5:143818363-143818385 CTTTGAGTAGGGGTGGAGGTGGG - Intronic
1004116384 6:12771832-12771854 CTCTGGGGAGGGATAGAAGTTGG + Intronic
1005940767 6:30557563-30557585 CGCTGGGGAGGGATGGAAGTGGG + Intronic
1011664562 6:89622051-89622073 CTCTGAGCATGGGTGGATGTGGG - Intronic
1018090668 6:160345152-160345174 CTCAGAGTGTGGTTGGAAGTGGG - Intergenic
1020512625 7:9077302-9077324 GTCTGAGTACAGATGGATGAAGG - Intergenic
1020944523 7:14585441-14585463 ATCTGAGTACCAATGTAAGTGGG - Intronic
1023121904 7:36918086-36918108 CTCTGAGGAGGGAAGGAAATGGG + Intronic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1033658176 7:143387225-143387247 CTCTGGGTACAGATGGGGGTCGG + Intronic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1040737789 8:50531687-50531709 CTCTGAGGACTGATGGAAGCAGG - Intronic
1040820612 8:51552670-51552692 TTCGGAGTAAGGATGGAAGCGGG + Intronic
1047893007 8:129333797-129333819 CTCTCAGTAAGAATGGAAGAAGG + Intergenic
1050986254 9:12087008-12087030 CTTTGAGTACAGTTTGAAGTTGG + Intergenic
1060365547 9:123008773-123008795 CTCTGAGTACTTGTGGAACTTGG + Intronic
1189697868 X:43684317-43684339 CTGTGGGTACTGATGAAAGTAGG + Intronic
1189732540 X:44036556-44036578 CTCTGAGTACGTATGGGATGTGG + Intergenic
1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG + Intergenic
1198994370 X:142557290-142557312 TTCTTAGTACGTTTGGAAGTTGG + Intergenic