ID: 1184373419

View in Genome Browser
Species Human (GRCh38)
Location 22:44097107-44097129
Sequence CACACAGCTCAGAGATGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184373415_1184373419 18 Left 1184373415 22:44097066-44097088 CCACCGAGAGGAGCATGGCACAG 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG No data
1184373416_1184373419 15 Left 1184373416 22:44097069-44097091 CCGAGAGGAGCATGGCACAGTTT 0: 1
1: 0
2: 0
3: 16
4: 143
Right 1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184373419 Original CRISPR CACACAGCTCAGAGATGGCA TGG Intronic
No off target data available for this crispr