ID: 1184376584

View in Genome Browser
Species Human (GRCh38)
Location 22:44117328-44117350
Sequence CTGTAGAGGGTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 776}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184376576_1184376584 -10 Left 1184376576 22:44117315-44117337 CCCCCAAAGGAGGCTGTAGAGGG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG 0: 1
1: 0
2: 5
3: 71
4: 776

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184376584 Original CRISPR CTGTAGAGGGTGAAGGAGGA GGG Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
900739121 1:4319887-4319909 CTGTTGAGGATAAAGGATGAAGG + Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901089770 1:6633465-6633487 CTGTCCAGGCTGATGGAGGAGGG - Exonic
901159065 1:7161278-7161300 CTGTGCAGGGTGGAGAAGGAGGG - Intronic
901236446 1:7669964-7669986 CTGCAGAAAGTGGAGGAGGAGGG - Intronic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
902882413 1:19381341-19381363 CAGTCGAGGGTGAGGGAAGAAGG - Intronic
903271595 1:22191927-22191949 GAGTAGCGGGTGAAGCAGGAAGG + Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903407078 1:23106813-23106835 CTGTGGAGGGTGGGGAAGGATGG - Intronic
903632851 1:24789971-24789993 CTGTGGAGGGAAAAGGAGAAGGG + Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903947067 1:26970682-26970704 ATGCAGAGGGTGAGGGAAGAGGG + Intergenic
903998475 1:27323045-27323067 CTGTCAAGGTTGAAGCAGGAGGG - Intronic
904468230 1:30720304-30720326 GTGGAGAGGGTGAAGGAGATGGG - Intronic
904711434 1:32433303-32433325 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
905460668 1:38120846-38120868 CTGAAGGGGGTGATGGAGGGAGG - Intergenic
906098362 1:43239442-43239464 CTGTAGAGGGTGGAGGGGGTGGG + Intronic
906103491 1:43277774-43277796 CTGTAGAGGGTAAAGGTGGGAGG + Intergenic
906142027 1:43539615-43539637 ATGTAGAGGGTGCAGCAAGAGGG + Intronic
906564292 1:46787027-46787049 CAGCAGAGGGTGAAAGAGAAAGG + Intronic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906661982 1:47589553-47589575 CTGGAGACGGTGAGGAAGGAGGG - Intergenic
906990309 1:50730075-50730097 CTCTGGAGGGTGAAGGGGGTTGG + Intronic
907408457 1:54268461-54268483 CTGTCGGGGGTGAAGGGGCAGGG - Intronic
907626461 1:56035231-56035253 CTCTAGAGGGTGTTGGAGGAGGG - Intergenic
907794179 1:57698192-57698214 CTTGAGAGGGTGAAGAAGGAGGG - Intronic
907831040 1:58064513-58064535 CCCTAGAGGACGAAGGAGGAAGG + Intronic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909223850 1:72992506-72992528 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909788472 1:79643508-79643530 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
909909731 1:81246286-81246308 CCGCAAAGGGTGAAGGAGCAGGG - Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910875832 1:91876879-91876901 TTGCAGAGGGTAAAGGAGAAAGG - Intronic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
911244415 1:95501030-95501052 ATGGAGAGGGTAAAGGAGAAAGG - Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913287527 1:117240549-117240571 CTGTTGGGGGTCAAGGTGGACGG - Intergenic
913474226 1:119221413-119221435 CTGTAGGGTGTGGGGGAGGAGGG - Intergenic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
914721664 1:150294321-150294343 CTGTAGAGCCTAAAGGATGATGG - Exonic
915040505 1:152964510-152964532 CTGTAGAGGGTGAGGGGCTAAGG - Intergenic
915236588 1:154487909-154487931 ATGTAAAGGGTGAAGGGAGAAGG - Intronic
915713109 1:157920121-157920143 CAGCAGAGGATGAAGGAGAATGG - Intergenic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
916624480 1:166540234-166540256 CTGTAGAAGGTGCAAGAGAAAGG + Intergenic
917518508 1:175728767-175728789 CTATACAGGGTAAAGGAGGTAGG + Intronic
917840416 1:178973065-178973087 CTACAGAGTGTGGAGGAGGAGGG + Intergenic
918851209 1:189693002-189693024 CTGGTGCTGGTGAAGGAGGAAGG - Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920347758 1:205317586-205317608 CGGTAGAGGGGGCTGGAGGATGG - Intronic
920496694 1:206459997-206460019 CTGTAGAGTGCGACTGAGGAGGG + Intronic
920850376 1:209624308-209624330 CCATAGAGAGCGAAGGAGGAGGG - Intronic
921219879 1:212965886-212965908 CTGTAAGGGGTGGAGGCGGAGGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921679673 1:218015710-218015732 CTGCAGAGGGTGCAAGAGAAAGG - Intergenic
922048205 1:221966912-221966934 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
922154277 1:223029134-223029156 CTGCTAAGGGTGAAGGAGAATGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923075001 1:230602201-230602223 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
924041831 1:239991661-239991683 CTGTAGATAGTGAAGGTGCAAGG + Intergenic
924180421 1:241434847-241434869 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
924416489 1:243861378-243861400 CTGTCCGGGGTGAAGGAGGCAGG - Intergenic
1062913620 10:1230754-1230776 CTGGAGAGCGTGGAGAAGGAAGG - Intronic
1063953599 10:11246468-11246490 AAGTAGAGGGGAAAGGAGGAGGG - Intronic
1065087187 10:22190413-22190435 CTACAGAGGGGGAAGGAGGCAGG - Intergenic
1065156010 10:22870860-22870882 CTCTGGAGGGTGAAGGAGGGAGG - Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065724963 10:28660554-28660576 CAGTAGAGCTTGAAGGAGCAAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067317557 10:45182259-45182281 CTGTTGTGGGGGCAGGAGGAGGG + Intergenic
1068230747 10:54167669-54167691 CTGCTAAGGGTGAAAGAGGAGGG - Intronic
1068503351 10:57868046-57868068 TTGTAGATGGTGAAGTATGAAGG - Intergenic
1069509590 10:69031886-69031908 TTGTAGACGGAAAAGGAGGAAGG - Intergenic
1069789670 10:71011591-71011613 CTGGGGAGGGTGTGGGAGGATGG + Intergenic
1069802106 10:71088165-71088187 CTGTAGAGGGGAAAGGATGGAGG + Intergenic
1069853426 10:71425162-71425184 CTGGAGTGGGTGAGGGTGGAAGG + Intronic
1069980341 10:72248067-72248089 CTGAAGAGAGTGAACAAGGAGGG - Intergenic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070474616 10:76819204-76819226 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474636 10:76819268-76819290 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474655 10:76819332-76819354 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474675 10:76819396-76819418 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474694 10:76819460-76819482 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474713 10:76819524-76819546 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1070474732 10:76819588-76819610 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1071255658 10:83869626-83869648 CTCTAGAGGATGGAGGGGGATGG - Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072254981 10:93612921-93612943 CTGTGGACCGTGCAGGAGGAGGG + Exonic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072717084 10:97759427-97759449 CTGGAGAGAGTGAGGAAGGAAGG - Exonic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1073439464 10:103544082-103544104 CTGCAGAGGGGGACGGAGGCTGG + Intronic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074524870 10:114254480-114254502 CTGATGAGGGTGGAAGAGGAAGG - Intronic
1075657777 10:124173460-124173482 GGGCAGAGGCTGAAGGAGGAGGG - Intergenic
1075725137 10:124607121-124607143 GCGGAGAGGGTGAAGCAGGAGGG - Intronic
1076490817 10:130860136-130860158 CTTCAGAGGGTGCAGGAGGCTGG - Intergenic
1076619199 10:131776092-131776114 CTGGAGAGAGTTGAGGAGGAAGG - Intergenic
1076682590 10:132181502-132181524 CTCTAGAAGGTACAGGAGGAAGG - Intronic
1077141297 11:1026073-1026095 CCGTAGAGGGTGCAGGTGGATGG + Exonic
1077320578 11:1939097-1939119 CGGGAGGGGGTGAGGGAGGAGGG + Intergenic
1077532877 11:3105523-3105545 GTGGAGAGGGTTAAGGAGGACGG - Intronic
1078984674 11:16581444-16581466 CTGTGGAGGGTGGAAGGGGAGGG + Intronic
1079511631 11:21217119-21217141 AAGTACAGGGTGAAGGAGGGGGG - Intronic
1079672755 11:23188589-23188611 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1080807532 11:35668099-35668121 CTGGAGAGAGTGAAGGGGGAAGG + Intronic
1080873576 11:36257796-36257818 CTGTGGAGGGTGGAGGCAGATGG + Intergenic
1080884320 11:36352510-36352532 CTGTAAAGGGGAAAGGGGGAAGG - Intronic
1081356613 11:42121593-42121615 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
1081451733 11:43177362-43177384 CTTTTGAGGTTGAAGGATGAAGG - Intergenic
1081594799 11:44451847-44451869 CTGCAGAGGCTGCAGGATGAAGG - Intergenic
1081687615 11:45053752-45053774 CTGTGGAGGGTGATCCAGGATGG - Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082793189 11:57361440-57361462 CTGTTGGGGGTGCAGGGGGAAGG - Intronic
1084194144 11:67514412-67514434 CTGTAGGGGCTGAAGGAATAAGG + Intergenic
1084517713 11:69645468-69645490 CAGCGGTGGGTGAAGGAGGAGGG + Intronic
1084551689 11:69847303-69847325 GTGTAGAGGGAGAAGGGGCAGGG - Intergenic
1084613482 11:70219059-70219081 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084746762 11:71175411-71175433 CTGTAAAGAGAGCAGGAGGAAGG + Intronic
1084826885 11:71738422-71738444 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084930654 11:72553137-72553159 CTGTAGAGTGTGAAAGAGAGAGG - Intergenic
1085356027 11:75837906-75837928 CTTTGGAGGCTGAAGCAGGAGGG + Intronic
1085464522 11:76714891-76714913 CTGTAGAGGGCGCAGAAGGTGGG - Intergenic
1085907670 11:80783784-80783806 CTGTAAATGGTACAGGAGGAAGG + Intergenic
1085987799 11:81807119-81807141 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1086069655 11:82786793-82786815 GTGGAGAGGGTAGAGGAGGAGGG - Intergenic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087054654 11:93921879-93921901 CAGTAGAGGGTGCTAGAGGAAGG + Intergenic
1087974777 11:104531295-104531317 CAGTAGGGGGTGGAAGAGGAAGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1088888900 11:114029574-114029596 AGGTAGAGGGTGAGGGAGAAGGG - Intergenic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089674241 11:120079413-120079435 CTGTAAATGTTGAAGGGGGAAGG + Intergenic
1089987226 11:122825565-122825587 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1090234000 11:125133081-125133103 CTGAAGAGGGTGAAGGACTCTGG + Intergenic
1090850793 11:130569013-130569035 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1090872148 11:130758157-130758179 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092676752 12:10929393-10929415 CTATAGAGGGGGAAAGTGGAGGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093115035 12:15198708-15198730 TTCTAGAAGGTGAAGGAGGCAGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1093950888 12:25164229-25164251 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1094316263 12:29139725-29139747 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1094522629 12:31208946-31208968 CTGTAGAGGATGAAGGAAGCAGG - Intergenic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1097398379 12:59102816-59102838 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1097756565 12:63413588-63413610 CTGTACATGGTGAGAGAGGAAGG + Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1098401990 12:70086224-70086246 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1098402009 12:70086288-70086310 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1098402028 12:70086352-70086374 CCGCTGAGGGTGAAGGAGAAAGG - Intergenic
1098402046 12:70086416-70086438 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1101032267 12:100672115-100672137 CTCTAGAGGGTGCAGTAGGGAGG + Intergenic
1101680095 12:106956113-106956135 CGGCAGAGGGCGACGGAGGAGGG - Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102902329 12:116648011-116648033 AGGCAGAGGATGAAGGAGGAAGG - Intergenic
1104105328 12:125653719-125653741 TTGCAGAGGGTGAAGGACAAGGG + Exonic
1104373521 12:128244542-128244564 CTCTGGAGGCTGAAGGAAGATGG + Intergenic
1104632685 12:130417569-130417591 CACTAGATGGTGAAGGAGGGAGG + Intronic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106943209 13:34799557-34799579 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1106943227 13:34799621-34799643 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1106943245 13:34799685-34799707 CTGCTGAGGGTGAAGGAGAAGGG - Intergenic
1107098297 13:36560311-36560333 CTGCACAGTGTGAAGGAGGCAGG - Intergenic
1107222139 13:37995571-37995593 CTGATGAGGGTGAAGTAGAAGGG - Intergenic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107585835 13:41847508-41847530 CAGTAGAGGGTCCAGCAGGAAGG + Intronic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1107959125 13:45543254-45543276 CTGTAGTGGGGGAAGAAGGTGGG - Intronic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1108123244 13:47212579-47212601 CTGTAGCTGGTGTAGGAAGATGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1109717006 13:66231321-66231343 CTGATAAGGGTGAAGGAGAAGGG + Intergenic
1110506235 13:76290363-76290385 TTGGAAAGGGTGATGGAGGATGG + Intergenic
1110650734 13:77938464-77938486 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1110765248 13:79275041-79275063 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1110978254 13:81867059-81867081 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1111985101 13:95057966-95057988 CTGCAGAGGGTGGAGAAGGCTGG - Intronic
1112004342 13:95241517-95241539 CTGCAGGGGGGGCAGGAGGAAGG - Intronic
1112098167 13:96158247-96158269 CTGTAGAGGGAGATGCGGGAAGG + Intronic
1112486924 13:99828195-99828217 CTATAGAGGGGAAAGGAGGCAGG + Intronic
1112889541 13:104212857-104212879 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1113184321 13:107670044-107670066 CAGTAGATGGTGAAGTAGAAAGG - Intronic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1114437970 14:22723826-22723848 CTGTAGAGGGTGGATGATGGGGG - Intergenic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1116573274 14:46545031-46545053 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1116590799 14:46769851-46769873 CTGTAGAGGTTGGTGGGGGAAGG - Intergenic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117717488 14:58595952-58595974 CTCCAGAGGTTGAAGCAGGAGGG - Intergenic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119235746 14:73017787-73017809 CTGTAGAGGGACAAGAAGGAAGG - Intronic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121449129 14:93996582-93996604 CCAGAGAGGGTGAAGGAGGCAGG - Intergenic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122893213 14:104742529-104742551 AGGTTGAGGGTGAAAGAGGAAGG - Intronic
1202837362 14_GL000009v2_random:88025-88047 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1202906748 14_GL000194v1_random:78155-78177 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1125045564 15:35239747-35239769 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1125148702 15:36505589-36505611 CTGTAGAGAGTGAGAGAGAAAGG - Intergenic
1125253854 15:37739617-37739639 CTGGAGGGGGTGAAGGAAGTGGG + Intergenic
1125481471 15:40083927-40083949 GTGTACACGGTGATGGAGGATGG - Intergenic
1125542447 15:40477771-40477793 CTGTGGAGGATAAAGGAGAAGGG + Intergenic
1125908502 15:43415407-43415429 CTGTAGGGGATGGGGGAGGAGGG + Intronic
1126893121 15:53227666-53227688 CTATAGAGAGTGAAGGAGAGAGG + Intergenic
1127212648 15:56789921-56789943 CTGTTGTGGGAGAAGGAGCAAGG + Intronic
1127471694 15:59295955-59295977 CTAAAGAGGGGGCAGGAGGAGGG + Intronic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1127833298 15:62769659-62769681 CAGGAGAGGGTGGAGGATGATGG - Intronic
1128154750 15:65385370-65385392 GGGGAGAGGGTGAGGGAGGACGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129057835 15:72834516-72834538 TGGCAGAGGATGAAGGAGGAGGG + Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1130327867 15:82896071-82896093 CTGTAGAGGGGGCTGGAGGTGGG + Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1132414516 15:101610803-101610825 GTGCAGAGGGTGACGCAGGAAGG - Intergenic
1132535045 16:474631-474653 CAGTAGTGGGAGAAGGAGGGAGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133598921 16:7320225-7320247 CTGTAGGGGGTGGTGGGGGAAGG - Intronic
1133803406 16:9103710-9103732 CTGTAGATGGTGGGAGAGGATGG + Intronic
1133869825 16:9676242-9676264 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134063832 16:11214108-11214130 CTTGGGAGGGTGAAGCAGGAGGG + Intergenic
1134318470 16:13140932-13140954 ATGTAAAGGGGGAAGGAGAATGG + Intronic
1134449392 16:14354212-14354234 AGGTAGAGGGAGGAGGAGGAAGG + Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136273735 16:29165522-29165544 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137613616 16:49834854-49834876 CTAAAGTGGGTCAAGGAGGAAGG + Intronic
1139046224 16:63062793-63062815 CTGTAGAGGGTGAAGGTATGGGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1140162717 16:72515183-72515205 CTGTAGGGGGTGGAGCTGGAGGG - Intergenic
1140255706 16:73334331-73334353 CTGCAGGGGGTTAAGGAGGAAGG + Intergenic
1141708375 16:85682741-85682763 CTGTAGAGGGGGAGGGCTGAGGG - Intronic
1141796498 16:86278778-86278800 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796518 16:86278842-86278864 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796538 16:86278906-86278928 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796558 16:86278970-86278992 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1141796578 16:86279034-86279056 CCGCTGAGGGTGAAGGAGAAAGG - Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142077277 16:88127267-88127289 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142734124 17:1883978-1884000 CTGTAAAGTGTGCAGAAGGATGG + Intronic
1143141581 17:4744459-4744481 CTGCAGAGGGTGAGGGCTGAGGG + Exonic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1144233317 17:13231115-13231137 ATGAAGAGGGTGCAGGAAGAAGG - Intergenic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147453580 17:40520912-40520934 GTGTGGCGGGTGCAGGAGGATGG - Intergenic
1147717542 17:42518580-42518602 CTCGAGTGGGTGAAGGAGGAAGG - Intronic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148106434 17:45121264-45121286 CTGTACCGGCTGCAGGAGGACGG - Exonic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148570359 17:48663358-48663380 CTATAGAGTGTGCAGGAGAAAGG - Intergenic
1149013545 17:51882789-51882811 CCCTAGAGAGGGAAGGAGGATGG - Intronic
1149025340 17:52020801-52020823 CTGGAGGGGGTAAAGAAGGATGG - Intronic
1149498284 17:57132637-57132659 CTGGAGGGGGTGAGGGAGGGTGG + Intergenic
1149498295 17:57132661-57132683 CTGGAGGGGGTGAGGGAGGGTGG + Intergenic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1149974931 17:61256076-61256098 CAGTAGAGGCTGATGGAGGCTGG - Intronic
1150103953 17:62448060-62448082 GTGTAGAGGGTGAAACAGGCTGG - Intronic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151398423 17:73840259-73840281 CTGAAGAGGTTGCATGAGGAAGG + Intergenic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151648906 17:75453476-75453498 AGGTTTAGGGTGAAGGAGGAAGG - Intronic
1152079373 17:78176946-78176968 ATGTGGCGGGTGAAGGAGCAAGG - Intronic
1152242879 17:79169393-79169415 CCGCAGTGGGTGAAGGAGCAGGG - Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1157126458 18:44960815-44960837 GGGTGGAGGGTGGAGGAGGAAGG - Intronic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157327911 18:46682116-46682138 CTGGGGAGGGTGCAGGGGGAGGG + Intronic
1157358372 18:46955657-46955679 CTCCAGAGGCTGAAGCAGGAGGG - Intronic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157575102 18:48738451-48738473 GTGCAGAGTGTGAAGGGGGAGGG - Intronic
1157799166 18:50604984-50605006 GAGCAGAGGGTGCAGGAGGATGG + Intronic
1158462886 18:57662139-57662161 CTCTGGAGGTTGAAGCAGGAGGG - Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159834845 18:73325654-73325676 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1160013438 18:75123818-75123840 CTCCAGAGGGCAAAGGAGGAGGG - Intergenic
1160342657 18:78102597-78102619 TTGTGGAGCGTGAAGGGGGAGGG + Intergenic
1160719654 19:591594-591616 GTGTGGAGGGTGCAGGTGGAGGG + Intronic
1160762434 19:792173-792195 CTGGAGAGGGTGGGGGAGAAAGG + Intergenic
1160841413 19:1148471-1148493 CTGGGGTGGGTGAAGGAGGGTGG - Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161439399 19:4281994-4282016 CTGAAGTGGGCGAAGGAGGGAGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163190217 19:15672229-15672251 CCTTAGAGGGCGACGGAGGAAGG - Intergenic
1163636751 19:18440589-18440611 CTGTAGAGGGTGCCGGAGGATGG + Intergenic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164731051 19:30504577-30504599 TTGGAGAGAGGGAAGGAGGAAGG - Intronic
1164790353 19:30972298-30972320 TTGGAGTGGGTGAGGGAGGAGGG - Intergenic
1164886357 19:31782038-31782060 CTCTGGAGGCTGATGGAGGAGGG - Intergenic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1165510495 19:36264096-36264118 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167901942 19:52628745-52628767 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1202649937 1_KI270706v1_random:170775-170797 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
925439849 2:3876009-3876031 CTGAAGAGGCTGACCGAGGAAGG - Intergenic
925544299 2:5001763-5001785 CTGTTAAGAGTGAAGGAGAAGGG - Intergenic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
926212581 2:10882058-10882080 CTGTTGTGGGGGCAGGAGGAGGG - Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
927091957 2:19719151-19719173 CTGGAGAGGGGGAACCAGGAAGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927848717 2:26485682-26485704 CGGTAGAAGGTGGAAGAGGAGGG - Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928616402 2:33043928-33043950 TTGTAGAGGGTGGAGAAGGCAGG + Intronic
929147866 2:38722296-38722318 CTGTGGAGGGTGTAGGGGGTGGG - Intronic
929272678 2:39990105-39990127 CTGTAGGGGTTGAAGGAAGCAGG + Intergenic
929534927 2:42775670-42775692 CAGCAGAGGGTGCAGGAGAAAGG - Intronic
930428236 2:51239057-51239079 AAGTAGAGAGGGAAGGAGGAAGG - Intergenic
930767353 2:55097555-55097577 CAGCAGTGGGGGAAGGAGGAGGG + Intronic
931026582 2:58118056-58118078 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
931236656 2:60418328-60418350 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
931236673 2:60418392-60418414 CTGCTGAGGGTGAAGGAGAAGGG - Intergenic
931236706 2:60418520-60418542 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931236725 2:60418584-60418606 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931236741 2:60418648-60418670 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931625550 2:64253447-64253469 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932256212 2:70289514-70289536 CTGTAAAGAGTGAGGGAGTAGGG + Intronic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
932854407 2:75218490-75218512 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933585352 2:84174093-84174115 GTGGAGAGGGTGAAGAAGAAGGG + Intergenic
933680378 2:85094717-85094739 CTGTATTGTGTGGAGGAGGATGG + Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
934976350 2:98805555-98805577 CTCTGGAGGGTGGAGGAGGAGGG - Intronic
935580219 2:104750147-104750169 CTGTGGAGGTTGAAGGGGGGAGG + Intergenic
936042994 2:109163976-109163998 CTGGAGAGGATGTAGGGGGAAGG - Intronic
936393782 2:112102119-112102141 CTTTAGAAGGTAAAGGAGGTGGG + Intronic
936409084 2:112238094-112238116 TTGTAGAGGGAGCTGGAGGATGG - Intronic
936659221 2:114523608-114523630 CTGTAGAGGGAAAAGGAAGTGGG + Intronic
937096537 2:119239205-119239227 GTGTAGAGAGGGAAAGAGGAAGG - Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938562952 2:132490714-132490736 CTGAACAGGGTGAGGGAGGTAGG + Intronic
939183606 2:138833284-138833306 CTGTAGTGGGTGCAGGTGAAGGG + Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941923735 2:170875706-170875728 CTGAGGAGGGTAAAGGAGGTTGG - Intergenic
942096886 2:172542753-172542775 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
942111661 2:172688602-172688624 CTATAAAGGATAAAGGAGGAGGG + Intergenic
942425224 2:175853115-175853137 CAGCAGAGGGTGGAGGAGAAGGG - Intergenic
942747731 2:179254340-179254362 CTGTAGTGCGTTAAGGAGAAAGG - Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943195760 2:184746692-184746714 CTGGAAAGGGTGATGGGGGAGGG - Intronic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943570582 2:189569292-189569314 GTTTAGAGGGTGAAAGGGGAGGG - Intronic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945138078 2:206651595-206651617 GAGTAGAGGATGAAGAAGGAAGG - Intergenic
945301689 2:208220965-208220987 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
946893053 2:224297596-224297618 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
946979917 2:225199275-225199297 CTGTAGATGGTCAAGGAAGGAGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947424987 2:229975326-229975348 CTGTAGACAGTGAAGGAAGGAGG + Intronic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948017894 2:234704963-234704985 CTGCAGAGGGGGCAGGGGGAAGG + Intergenic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948514737 2:238497010-238497032 ATTTAGGGGGTGATGGAGGATGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
949036046 2:241816176-241816198 CTGTAGAAGGCGAAGGAGTGAGG - Exonic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1169599057 20:7236147-7236169 CTGTAGGGGGTACAGGGGGAGGG + Intergenic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1170867681 20:20174621-20174643 CTGAAGAGGGTGCAGGAGTGCGG - Intronic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171209150 20:23303613-23303635 AAGGAGAGGGTGAAGGATGAGGG - Intergenic
1171413266 20:24960476-24960498 CTGTTGGGGGTGCACGAGGAGGG + Intergenic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1171520015 20:25768653-25768675 TTTTAGAGGTTTAAGGAGGAAGG - Intronic
1171556904 20:26087840-26087862 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1171881431 20:30620508-30620530 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1172981659 20:38947386-38947408 GTGTTGAGGGTGAGTGAGGATGG + Intronic
1173373534 20:42461427-42461449 CTGGAGAGGGTGAGGTGGGAGGG + Intronic
1173418045 20:42876049-42876071 AGGGAGAGAGTGAAGGAGGATGG - Intronic
1173706780 20:45115718-45115740 CTGTTGAGGGTGGGGGAGCATGG + Intergenic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1174000020 20:47367760-47367782 CTCTAGAGGCTGAGGCAGGAAGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1176062013 20:63176589-63176611 CTGGAGAGGGTGGAAAAGGAAGG + Intergenic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176601885 21:8801772-8801794 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1176626098 21:9092954-9092976 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1176654148 21:9574940-9574962 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1177100423 21:16893170-16893192 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1180147000 21:45927309-45927331 ATGTAGGGGGAGAGGGAGGAAGG - Intronic
1180344170 22:11693323-11693345 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1180365423 22:11933901-11933923 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1180560687 22:16612271-16612293 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1180792506 22:18583697-18583719 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181118270 22:20647845-20647867 GGGGAGAGGGTGAAGGAAGAAGG - Intergenic
1181229231 22:21411618-21411640 CTGATTAGGGTGGAGGAGGAGGG + Intergenic
1181249420 22:21523245-21523267 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181904911 22:26186612-26186634 CTGGAGATGGTGGAGGATGAGGG + Intronic
1182113725 22:27742929-27742951 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
1182139276 22:27938831-27938853 CTGAAGAGGTTGAGGCAGGAGGG + Intergenic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1183201506 22:36388085-36388107 CTGCAGTGGGTGTAGCAGGAAGG - Intergenic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1184092504 22:42299895-42299917 TTGGAGCGGGTGGAGGAGGAGGG + Intronic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184430598 22:44439786-44439808 GGGTAGGGGGTGAGGGAGGAAGG - Intergenic
1184530440 22:45051945-45051967 CTGAGGAGGTTGAAGGAGGCTGG - Intergenic
1184574959 22:45356273-45356295 CTGTAGAGGGAGGAGGATGGTGG - Intronic
1185096733 22:48811017-48811039 CTCTAGAGGCTGAGGCAGGAGGG + Intronic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
949190568 3:1244346-1244368 CCGCTGAGGGTGAAGGAGAAGGG + Intronic
949190587 3:1244410-1244432 CCGCTGAGGGTGAAGGAGAAGGG + Intronic
949190606 3:1244474-1244496 CCGCTGAGGGTGAAGGAGAAGGG + Intronic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950129708 3:10533797-10533819 GTGTAGACTGTGGAGGAGGAAGG - Intronic
950589726 3:13928412-13928434 TTGTGGAGGGCGGAGGAGGATGG - Intergenic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
952266656 3:31793504-31793526 CTGTGTAGGTTTAAGGAGGATGG + Intronic
953176963 3:40561849-40561871 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
953356873 3:42263633-42263655 CTGTAGCGAGCAAAGGAGGAGGG + Intronic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
954969465 3:54639185-54639207 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
955144849 3:56306999-56307021 CCATGCAGGGTGAAGGAGGATGG - Intronic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
955567229 3:60260201-60260223 CCGTAGAGGGTGTAGGAGGTTGG + Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956517018 3:70060874-70060896 CTGTAGAGGGTCATGGATGTAGG + Intergenic
957060107 3:75474814-75474836 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
958677707 3:97288232-97288254 CTACAGAGGGTGAGGAAGGAAGG - Intronic
958871969 3:99570318-99570340 TTGTAGAGGGTGGATGAGGAAGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960310343 3:116110099-116110121 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961131126 3:124468089-124468111 CTGTTGAGGGAGAATGAGCAAGG + Intronic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
961293278 3:125864592-125864614 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
961730367 3:128960742-128960764 CCGCTGAGGGTGAAGGAGAAGGG - Intronic
961730386 3:128960806-128960828 CCGCTGAGGGTGAAGGAGAAGGG - Intronic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
962369349 3:134807915-134807937 GCATGGAGGGTGAAGGAGGAGGG + Intronic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
963468418 3:145711401-145711423 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963693463 3:148535056-148535078 CTGTAGAGTTGGATGGAGGAGGG + Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
964906737 3:161726674-161726696 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
965657770 3:171007093-171007115 CTGTAGAGGATGAAGTAGATGGG + Intronic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
966066590 3:175828488-175828510 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
966105274 3:176326270-176326292 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
966191541 3:177276261-177276283 CTGGTGAGGGTGAAGAATGATGG + Intergenic
966279013 3:178208260-178208282 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
966592894 3:181701001-181701023 GTGTAGGGGGTGGAGTAGGAAGG + Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967370877 3:188744700-188744722 CTGAAGAGGGGAAAGGAGGTTGG - Intronic
967644036 3:191900126-191900148 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968330501 3:197865108-197865130 CTGTAGAGGCTGAGGAGGGAGGG - Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969633234 4:8350680-8350702 GTCTAGATGGTGAAGCAGGAAGG - Intergenic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
969809907 4:9639826-9639848 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970041902 4:11807302-11807324 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
970087361 4:12364759-12364781 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
972433406 4:39006833-39006855 CTACAGAGGGTGAAGTAGGAGGG + Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
972812529 4:42606317-42606339 GTGTTGAGGGTGAAAGAGAAGGG - Intronic
973113826 4:46429458-46429480 CTGTAGGGTGTGCAGGAGGAAGG - Intronic
973365208 4:49203579-49203601 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
973395384 4:49588875-49588897 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974769193 4:66388565-66388587 CTGTTGGGGGTGGAGGATGAGGG + Intergenic
975067483 4:70086045-70086067 CTGAAGTGGGTGAAGGTGGGAGG + Intergenic
975237724 4:72019727-72019749 CTGTATTGAATGAAGGAGGAAGG + Intergenic
975395683 4:73870430-73870452 CTCTAGAGGCTGGAGGAGCAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975762845 4:77635318-77635340 CAGCAGGGGGTGAAGGAGGTGGG - Intergenic
975934113 4:79558754-79558776 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
976696321 4:87922797-87922819 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
977041847 4:92026984-92027006 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
977167168 4:93714086-93714108 CTGTTGGGGGTGGGGGAGGAAGG - Intronic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978339784 4:107710062-107710084 CTGAAGTGGGTGCAGAAGGAAGG - Intronic
978357242 4:107890302-107890324 CAGCAGAGGGTGAAAGAGAAAGG + Intronic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979442607 4:120769338-120769360 CTGAGGAGGGTAAAGGAGCATGG + Intronic
980308334 4:131094493-131094515 CTCTACAGGTTGAGGGAGGATGG + Intergenic
980903705 4:138928780-138928802 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981729765 4:147885065-147885087 CAGTAGAGGGTGAAGGAGTGGGG + Intronic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982180668 4:152746001-152746023 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
983055294 4:163094179-163094201 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
983452126 4:167923856-167923878 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
984099237 4:175466085-175466107 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
984437036 4:179721367-179721389 CTGCTAAGGGTGAAGGACGAAGG - Intergenic
1202762589 4_GL000008v2_random:125206-125228 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
985582070 5:703518-703540 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
985582133 5:703765-703787 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
985818492 5:2144391-2144413 CTGTTGAGGGAGAGGGAGGTGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986077585 5:4354085-4354107 CTGTAAAGGGGAAAAGAGGATGG + Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986555780 5:9008693-9008715 CTGCTAAGGGTGAAGGAGGAGGG + Intergenic
986766424 5:10932197-10932219 CTCTAGGGGGTGTAGGTGGAGGG + Intergenic
986788759 5:11140250-11140272 CTGGACAGGTTGAAGGAGGCAGG - Intronic
986905563 5:12490811-12490833 CCGCTGAGGGTGAAGGAGAAGGG - Intergenic
987341387 5:16942560-16942582 CTTTGGAGGGAGAAGGAGAAGGG - Intergenic
987427273 5:17787402-17787424 CTGTGAAGGGTGAAGGGTGAGGG - Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988273858 5:29054997-29055019 TTGTACAGGGTGAAGATGGATGG - Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
989194783 5:38706283-38706305 CTGTTGTGGGTGGAGAAGGAGGG - Intergenic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
992307785 5:75461391-75461413 ATGTAGTGGGTGACGGGGGATGG - Intronic
992389026 5:76313420-76313442 AAGTAGAGGGTGAAGGGGGTGGG + Intronic
993513540 5:88801188-88801210 TTTTAGAGGGTTAAGGAAGAGGG + Intronic
994157280 5:96518265-96518287 CTGTAGAGGAGGAAGAGGGAAGG - Intergenic
994379934 5:99058717-99058739 TTGTAGAGGTTGTGGGAGGAAGG + Intergenic
994532744 5:100988968-100988990 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
995496397 5:112748887-112748909 CTCTAGAGGCTGAAGCAGGAGGG + Intronic
996203513 5:120702517-120702539 CTGTTAAGGGTGAAGGACCAAGG + Intergenic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
996527848 5:124498002-124498024 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
996633691 5:125666169-125666191 GGGTAATGGGTGAAGGAGGAGGG + Intergenic
997613095 5:135228930-135228952 CCTTAGAGGGGAAAGGAGGAGGG - Intronic
997635491 5:135400974-135400996 CTGTAGAGGGGCATGGAGGTGGG - Intergenic
997769904 5:136544447-136544469 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
997844185 5:137271082-137271104 ATGTCCAGGATGAAGGAGGAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998512606 5:142725771-142725793 ATGTAGAGTGTGAAGAAGGAGGG + Intergenic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
1000362702 5:160462722-160462744 TTGTAGAGGGGGAAGCAGGTTGG + Intergenic
1000894179 5:166835200-166835222 ATATAGAGGGTGAGGGAGGAGGG + Intergenic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001604885 5:172952436-172952458 CTGTAGAGGGTGGGGCAGGGTGG + Exonic
1001971249 5:175956614-175956636 CAGCAGCGGGTGAAGGAGGAGGG - Intronic
1002246193 5:177887163-177887185 CAGCAGCGGGTGAAGGAGGAGGG + Intergenic
1002314984 5:178337627-178337649 CTGTAGAGGGGGCAGGAGGTTGG + Intronic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003744895 6:8989725-8989747 AAGAAGAGAGTGAAGGAGGAGGG + Intergenic
1003893068 6:10580647-10580669 CTGCAGAGGGTGATGAAGAACGG + Intronic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005407050 6:25500604-25500626 TTGTAGAGCGTGAAAGAGAATGG + Intronic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006133486 6:31882432-31882454 AGGTAGAGGGTGGAGGTGGAGGG + Intronic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006906613 6:37537320-37537342 CTTTGGTGGGTGAAGGAGGGTGG + Intergenic
1006964026 6:37963643-37963665 CTGTTGCTGGTGAAGCAGGATGG - Intronic
1007269606 6:40626541-40626563 GTCTAGAGGGTGATTGAGGAGGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1008850496 6:56015813-56015835 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1008927558 6:56902907-56902929 GTGTAGAGGGTGGAGGGGGCGGG - Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1009972599 6:70640913-70640935 CAGTAGAGGGGTAAGGAGGCAGG - Intergenic
1010037556 6:71343914-71343936 CTGTGAAGGGTAAAGGAGGAGGG + Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010403295 6:75473233-75473255 CTTTAAAGGGTCAAAGAGGAAGG + Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1013007824 6:106090558-106090580 CTTTAGAAGGTGAAAGAGGATGG + Intronic
1013891435 6:115032663-115032685 CTGCTGAGGGTGAAGGACCAAGG - Intergenic
1014015884 6:116529448-116529470 CTGTAGGGTGGGAAGCAGGAGGG - Intronic
1014360395 6:120467114-120467136 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015269436 6:131324304-131324326 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015271163 6:131339871-131339893 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016650497 6:146455150-146455172 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1017779534 6:157705390-157705412 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
1019332303 7:466481-466503 CGGATGAGGGTGAAGGATGAGGG - Intergenic
1019332316 7:466533-466555 TGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019332335 7:466610-466632 GGGTGGAGGGTGAGGGAGGAGGG - Intergenic
1019332377 7:466779-466801 GGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019502892 7:1374012-1374034 AGGAAGAGGGTGAAGGGGGAGGG + Intergenic
1019676576 7:2317010-2317032 CAGAAGAGGGTGAAGGGTGAAGG + Intronic
1019843088 7:3468900-3468922 CTTCAGAGGGTGAAGGGGGTAGG + Intronic
1019892057 7:3954663-3954685 GTGTAGAGGGTGTAGAAGGGAGG - Intronic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1021810451 7:24397254-24397276 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022304526 7:29134192-29134214 CTGCAGAGGCTGAAGAATGAAGG - Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022372686 7:29785947-29785969 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1024154232 7:46603821-46603843 GTGGAAAGGGTGAGGGAGGATGG - Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024605109 7:51016675-51016697 CTGCAGAGGGTCAAGGAGCAGGG - Exonic
1025045552 7:55689274-55689296 CCGGAGAGGGTGAAGCAGGCAGG - Intergenic
1025280500 7:57623614-57623636 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1025304231 7:57841893-57841915 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1026305287 7:69134966-69134988 AGGTAGAGAGTGAAGGAGGAAGG - Intergenic
1026827795 7:73595200-73595222 CCGTGGAGGGGCAAGGAGGAGGG - Intronic
1028689977 7:93640897-93640919 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1029334955 7:99890721-99890743 GGGTAGAGGGTGGAGGAGGGTGG + Exonic
1029571232 7:101371000-101371022 CTGTAGGGAGTAAATGAGGAAGG - Intronic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030652176 7:112128022-112128044 CTGTCGGGGGTGAGGGTGGAGGG + Intronic
1030877020 7:114826180-114826202 CTGGATAGGGTGAAGAAAGATGG + Intergenic
1031399817 7:121316724-121316746 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1031819339 7:126480047-126480069 CTGAAGTGGGTGAAGAAGAAAGG + Intronic
1031953725 7:127920394-127920416 CTGCAGAGGTCGCAGGAGGATGG + Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032632377 7:133668052-133668074 CTGTAGAGCATGAAGGAGAGAGG - Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033332771 7:140429877-140429899 CTCCTGGGGGTGAAGGAGGAGGG - Intergenic
1033347203 7:140534698-140534720 CTGCAGAGTGTGGAGGTGGAGGG + Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036371925 8:8169572-8169594 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1036434897 8:8723860-8723882 CTGTTGGGGGTGAAGGGGAATGG + Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036719413 8:11159223-11159245 TTCTAGAGGGTGAAGGACAAGGG - Intronic
1036777830 8:11625671-11625693 CTGAAGACGGTGAGGGAGGCTGG + Intergenic
1036854651 8:12231461-12231483 CTGTGGAGGTTGAAGTGGGAGGG + Intergenic
1036878979 8:12496071-12496093 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1037637098 8:20710013-20710035 CTGTTGCGGGGGCAGGAGGAGGG - Intergenic
1037763949 8:21760225-21760247 CTGGAGAGCATTAAGGAGGAAGG + Intronic
1038893676 8:31756349-31756371 CTGTTAAGGGCAAAGGAGGAAGG + Intronic
1039285637 8:36037641-36037663 CTGTATGGGGTGAAAGTGGAAGG + Intergenic
1039312135 8:36328193-36328215 CTGTAGATGGTGACGTAGTAGGG - Intergenic
1039363195 8:36902416-36902438 GTGGAGAGGGTGGAGAAGGAGGG + Intronic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1042502625 8:69525897-69525919 CTTTAGAGGTTGTTGGAGGAGGG + Intronic
1042784390 8:72531545-72531567 TTGTAAAGGGTGATGGAGGTAGG - Intergenic
1043520383 8:81038615-81038637 ATATAGAGTGTGAAGGAGCAAGG - Intronic
1043718123 8:83509956-83509978 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1043837507 8:85063861-85063883 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044148697 8:88746844-88746866 CTGTTAAGGGTGAAGGAGAAGGG + Intergenic
1044416887 8:91949041-91949063 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044689672 8:94864345-94864367 TTGTAGAGGGTGCAGTAGCAAGG - Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045197265 8:99944670-99944692 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
1045533384 8:103004874-103004896 CTTTTGTGGGTAAAGGAGGAAGG + Intergenic
1046093312 8:109528624-109528646 ATGTAGAGTGGGAAGGAAGAAGG - Intronic
1046386579 8:113514359-113514381 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1046447921 8:114347418-114347440 GTGCAGGGGGAGAAGGAGGAAGG - Intergenic
1046743113 8:117849006-117849028 CTGTAGATGGTGACTGAGGATGG - Intronic
1046889196 8:119402494-119402516 CTCAAGAGGGTGAATGAGGTTGG - Intergenic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047559101 8:125966954-125966976 CTCTTGTGGGTGAAGGACGAAGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1048828816 8:138456394-138456416 CTGAAGAGGGTGAAGGGAGTGGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1051308494 9:15742880-15742902 CTCAAGAGGGTGAAGGTGGGAGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1052285015 9:26775342-26775364 CTGTAGAGGGTTGAGAGGGAGGG + Intergenic
1052324818 9:27206325-27206347 CTGTAAAGGGTGACGGAGGAAGG - Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1056060967 9:82884802-82884824 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1056437435 9:86587981-86588003 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056437489 9:86588173-86588195 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056437508 9:86588237-86588259 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056437545 9:86588365-86588387 CCGCTGAGGGTGAAGGAGAAGGG + Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056552409 9:87663159-87663181 CAGTGGAGGGTGCAGGAGTAGGG - Intronic
1056807102 9:89737252-89737274 CTGCAGAGGGTCAAGGGGTAGGG - Intergenic
1056905015 9:90638967-90638989 CTAAAGATGGTAAAGGAGGAAGG + Intronic
1057257798 9:93564550-93564572 TTATAGAGGGTGAAGGATGCTGG + Exonic
1057683772 9:97215631-97215653 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1058060225 9:100487462-100487484 CTTTAGAGAGAGAAGGAGGCTGG - Intronic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1058986385 9:110212049-110212071 GTGTAAAAGGTGAAGGAGAAAGG - Intergenic
1059353858 9:113684888-113684910 CTCAAGAGGGTGAAGTGGGAGGG - Intergenic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1060027302 9:120183960-120183982 CTCCAGAGGGTGGAGGAGGGGGG + Intergenic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060102825 9:120855882-120855904 CTGGAGAGGGAAAAGGAGGGAGG - Exonic
1060227630 9:121804086-121804108 GTGTTGAGGGTGAGGGTGGACGG - Intergenic
1060227804 9:121806080-121806102 GTGTTGAGGGTGAGGGTGGACGG + Intergenic
1060506664 9:124202925-124202947 CTGGAAGGGGTGAGGGAGGAAGG + Intergenic
1061099894 9:128484616-128484638 AAGCAGAGGGTGAAGGAGAAAGG - Intronic
1061246190 9:129402233-129402255 GGGAAGAGGGTGAAGGAGGGAGG - Intergenic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1062011587 9:134269984-134270006 CCGTGAAGGGTGAAGGATGAAGG - Intergenic
1062453707 9:136626197-136626219 CTGGAGCGGGTGCAGGAGGGAGG + Intergenic
1062460094 9:136659400-136659422 CTGCAGGAGGTGCAGGAGGAGGG - Exonic
1203749270 Un_GL000218v1:63375-63397 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1203543349 Un_KI270743v1:110087-110109 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1203631871 Un_KI270750v1:78398-78420 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1185960862 X:4545041-4545063 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1186125071 X:6404601-6404623 GTGTAGAGGGTGACGAAGGGTGG - Intergenic
1186343502 X:8667401-8667423 CTCTGGAGGCTGAAGCAGGAGGG - Intronic
1186806342 X:13143772-13143794 CTGTACAGGGAGAATGATGAGGG + Intergenic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187467992 X:19543216-19543238 ATGCAGAGGGTGGAGGAGGAAGG + Intronic
1187493764 X:19777059-19777081 CTGGAGAGGGTTAAGGGAGATGG - Intronic
1188224425 X:27579401-27579423 CTGTTGGGGGTGTAGGGGGAGGG + Intergenic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189765954 X:44372427-44372449 CTGAAGGGGATAAAGGAGGAAGG - Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189981442 X:46514736-46514758 GTGTAGTGGGTGAGGAAGGAAGG - Intronic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1190074876 X:47309657-47309679 CTCAAGAGGCTGAAGAAGGAGGG - Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191724301 X:64262870-64262892 TTTTAGAGAGTGAAGGATGACGG - Intergenic
1192162186 X:68796747-68796769 GTGGAGAGGGTGAAGGAGTAAGG - Intergenic
1192481479 X:71490039-71490061 GTGGAGGGGGTGGAGGAGGAGGG - Intronic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1192928275 X:75778935-75778957 CTGTAGAGGCTGCAGGAAAATGG - Intergenic
1193729512 X:85086194-85086216 GTGAAGAGATTGAAGGAGGAAGG - Intronic
1193941275 X:87682808-87682830 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1194186440 X:90778011-90778033 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1194234133 X:91361252-91361274 CCGAAGATGGTGAAGGGGGAAGG + Intergenic
1194351037 X:92825313-92825335 CTGCTAAGGGTGAAGGAGCAAGG - Intergenic
1194809633 X:98374879-98374901 CTTTGAAGGGTGAAGGAGAATGG + Intergenic
1195307342 X:103597046-103597068 GTGTAGAGGGTGATGGAGCTAGG + Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195698342 X:107683268-107683290 ATTTAGTGGGGGAAGGAGGAGGG - Intergenic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196525735 X:116725843-116725865 CTGTTAAGGGTGAAGGACCAAGG + Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196572254 X:117280011-117280033 CTGCAAAGGGTGAAGGACCAAGG - Intergenic
1196774061 X:119322462-119322484 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1196977240 X:121173254-121173276 CTGTAGAGGTTGGAGGAAAAAGG - Intergenic
1197352260 X:125393545-125393567 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1198599606 X:138269056-138269078 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1198758669 X:140008160-140008182 CACTAGAGGGTGAGGGAGAAGGG - Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199514984 X:148665965-148665987 GTGGGGAGGGTGAAGCAGGATGG + Intronic
1199576248 X:149316590-149316612 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1200576670 Y:4896447-4896469 GTGTAGAGTGAGAAGAAGGAGGG - Intergenic
1200659417 Y:5942184-5942206 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1201162630 Y:11178386-11178408 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1201856297 Y:18548075-18548097 AGGTTGAAGGTGAAGGAGGAGGG - Exonic
1201877024 Y:18772309-18772331 AGGTTGAAGGTGAAGGAGGAGGG + Exonic
1202127448 Y:21581041-21581063 CTGTAGAGCGTGAAGGGAAAAGG - Intergenic