ID: 1184378836

View in Genome Browser
Species Human (GRCh38)
Location 22:44132294-44132316
Sequence CTCGTGGGTGGCTGGGTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184378822_1184378836 26 Left 1184378822 22:44132245-44132267 CCTTGCACCCGGTTTCTTGGTAT No data
Right 1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG 0: 1
1: 0
2: 2
3: 17
4: 230
1184378823_1184378836 19 Left 1184378823 22:44132252-44132274 CCCGGTTTCTTGGTATCGAGACC 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG 0: 1
1: 0
2: 2
3: 17
4: 230
1184378828_1184378836 -2 Left 1184378828 22:44132273-44132295 CCTTGGGCAGACCCAGGCTGTCT No data
Right 1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG 0: 1
1: 0
2: 2
3: 17
4: 230
1184378824_1184378836 18 Left 1184378824 22:44132253-44132275 CCGGTTTCTTGGTATCGAGACCT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG 0: 1
1: 0
2: 2
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184378836 Original CRISPR CTCGTGGGTGGCTGGGTCCG TGG Intronic
900161421 1:1225791-1225813 CTCGTGTGTGTCTGTGTCTGTGG - Intronic
900778398 1:4601200-4601222 GTCCTGGGTGGGTGAGTCCGTGG + Intergenic
900778416 1:4601271-4601293 GTCCTGGGTGGGTGAGTCCGTGG + Intergenic
900778430 1:4601341-4601363 GTCCTGGGTGGGTGAGTCCGTGG + Intergenic
901250023 1:7771187-7771209 GTCGTGGGTGGGTGCGTCCAGGG - Intergenic
903053817 1:20621093-20621115 CTCCTGGGTAGCTGGGACCACGG - Intergenic
903221007 1:21869740-21869762 CGGGTGGCTGGCTGGGCCCGTGG - Intronic
903541627 1:24099627-24099649 CTCGGCGGTGGCAGGGTCTGGGG + Intronic
904264366 1:29309987-29310009 CTCATGGGTGGCTGTGGCCCTGG + Intronic
904449392 1:30601266-30601288 CCCCTGTGTGGCTGGGTCTGGGG - Intergenic
907320948 1:53602011-53602033 CTCGCGTGTGGCTGGGAACGTGG - Intronic
910664100 1:89705656-89705678 CTCCTGAGTGGCTGGGACCACGG - Intronic
911176676 1:94824510-94824532 CTCGGTGGTGGCTGGAGCCGCGG + Exonic
912383759 1:109261262-109261284 CTCGTGAGTGGCTGGGCACTGGG + Exonic
912407437 1:109452421-109452443 CCCCTGTGTGGCTGGGTCTGGGG + Intergenic
912488579 1:110048469-110048491 CTCCTGGGTGGCTGTGGCCCCGG + Intronic
913937278 1:125066089-125066111 CGCGTGGGTGGCTGGATCCGAGG - Intergenic
914197987 1:145460046-145460068 TTCCTGGGTCGCTGGGTCCCTGG - Intergenic
914477089 1:148033178-148033200 TTCCTGGGTCGCTGGGTCCCTGG - Intergenic
914503092 1:148264783-148264805 TTCCTGGGTCGCTGGGTCCCTGG + Intergenic
915273983 1:154775566-154775588 CTCATGGGTGGGTGGGTGGGGGG - Intronic
915645773 1:157270922-157270944 CTGCTGGGTGCCTGGGTCCTGGG - Intergenic
916147164 1:161750143-161750165 CTGGTGAGTGGCCGGGTCAGTGG + Exonic
917072644 1:171169190-171169212 CTTCAGTGTGGCTGGGTCCGGGG - Intergenic
919290942 1:195629456-195629478 CTCCTGAGTGGCTGGGACTGTGG - Intergenic
919826352 1:201506264-201506286 CTGGTGGGTGGCTGGAGCCCAGG + Intronic
920027237 1:203007669-203007691 CTGGAGGGCGGCTCGGTCCGGGG + Intronic
920094057 1:203474398-203474420 CTTGTGGGTGGCTGAGCCCAGGG + Intergenic
920387238 1:205577631-205577653 CTCCAGCCTGGCTGGGTCCGTGG + Intronic
921060664 1:211581379-211581401 CTGGTGGGTGGTTGGGGGCGGGG + Intergenic
921626915 1:217387377-217387399 CTCTTGGGTAGCTGGGACCAGGG + Intergenic
923026365 1:230207709-230207731 CTCCTGAGTAGCTGGGACCGTGG + Intronic
1062923496 10:1297538-1297560 CTCGGGGGTCTCTGGGTCAGAGG - Intronic
1067796676 10:49326348-49326370 CTTCTGGGTGGCGGGGTACGCGG - Exonic
1069010522 10:63366792-63366814 CTCCTGGGTGCCTGGGTCACTGG + Intronic
1070558741 10:77550069-77550091 CTCTTGGGTGGCTGGGCTGGGGG - Intronic
1072717496 10:97761370-97761392 GTGGTGGGTGGCTGGGTGCTGGG + Intergenic
1074976925 10:118588509-118588531 CTGGTTGGTGGCTGGGCACGGGG - Intergenic
1075126856 10:119707474-119707496 CTCGTGGCTGGGTGGGGGCGGGG + Intergenic
1075844403 10:125533982-125534004 CTGGTGGGTGACTGGGTGTGGGG + Intergenic
1076158104 10:128219324-128219346 TTGGTGGGTGGGTGGGTGCGTGG - Intergenic
1076569257 10:131421547-131421569 CCCGTGGGTGCCTGGGTCATGGG + Intergenic
1076569272 10:131421609-131421631 CCCGTGGGTGCCTGGGTCACGGG + Intergenic
1077026401 11:441835-441857 CTGGCGGGGGGCTGGGGCCGGGG + Intronic
1077158247 11:1101070-1101092 GTCGAGGGTGGCTGTGTCCAGGG + Intergenic
1077244402 11:1529153-1529175 CTCCTGTGTGGCTGTGTCCGCGG - Intergenic
1077366701 11:2164144-2164166 CTGGTGAGGGGCTGGGTCCCGGG - Exonic
1080628807 11:34053399-34053421 TTCGTTGGGGGCTGGGTCCTGGG + Intronic
1082701203 11:56433278-56433300 CTCCAGTGTGGCTGGGTCCAAGG + Intergenic
1083307946 11:61770530-61770552 GACGTGGGTGGCTGGCTCCATGG + Intronic
1083629314 11:64087619-64087641 CTGCAGGGTGGCTGGGGCCGCGG - Intronic
1088921256 11:114261134-114261156 CTCCTGGGTCCCTGGCTCCGTGG - Intronic
1089573018 11:119422672-119422694 CTCGCGGCGGGCTGGGTGCGGGG - Intronic
1091224622 11:133950097-133950119 CCAGTGGGTGGCTGAGTCCAGGG + Intronic
1091274581 11:134341944-134341966 GTGCTGGGTGGCTGAGTCCGGGG - Intronic
1092282349 12:7108072-7108094 CTGGTGGGAGGCTGTGTCCTGGG + Intronic
1093764955 12:22952483-22952505 CTCGAGGCTGGCTGAGTCTGGGG + Intergenic
1095051555 12:37559115-37559137 ATAGTGAGTGGCTGGGTCAGTGG - Intergenic
1098711761 12:73771738-73771760 CTCCTGCGTGGCTGGGTCCAGGG + Intergenic
1101606074 12:106248200-106248222 CGCGGGGGTGGCTGGGCGCGGGG + Intronic
1102465763 12:113130122-113130144 CTGGTGGGTGGCTGAGGCCTTGG - Intronic
1103536526 12:121637448-121637470 CTCGGGGGTGGCTGGGGCACAGG + Intronic
1103918315 12:124387234-124387256 CACGTGGGTGGGTGGGTGGGTGG - Intronic
1103989822 12:124791340-124791362 CTCGTAAGTGGCTGTGTCAGGGG - Intronic
1104162229 12:126191631-126191653 CTCGCGGGACGCTGGGTCGGAGG + Intergenic
1104720835 12:131044364-131044386 CTCGTGGGTGGACGGGTTCCTGG - Intronic
1108418767 13:50227813-50227835 CTGGTGGGTGGGTGGGTAGGTGG + Intronic
1109442559 13:62394482-62394504 CTCCTGTGTGGCTGAGTCTGGGG - Intergenic
1109572188 13:64207140-64207162 CTTGTGTGTGGCTGCGTCTGGGG + Intergenic
1109892176 13:68630026-68630048 CTCCTGTGTGGCTGGGTCCGGGG + Intergenic
1116003873 14:39271933-39271955 CCCCTGTGTGGCTGGGTCTGCGG + Intronic
1117652681 14:57923386-57923408 CACCTGGGTGGCTGAGTGCGTGG - Intronic
1119348442 14:73944805-73944827 CCTGAGGGTGGCTGGGTCTGAGG + Exonic
1120949445 14:90027461-90027483 CTTGTGGGTGGCTGGAGCCTGGG - Intronic
1121931681 14:97978048-97978070 CTCCGGGGTGGCTGGGTCCCAGG + Exonic
1122416215 14:101550753-101550775 CTGGTGGGTGGGTGGGTAAGTGG + Intergenic
1122829904 14:104390784-104390806 CTCGTGGCTGGATTGGTCTGGGG + Intergenic
1122967758 14:105139208-105139230 CTTGTGGGTGGGTGGGTGGGTGG - Intergenic
1122989309 14:105229535-105229557 CTGGTGGGTGGATGTGGCCGTGG - Intronic
1123066957 14:105623676-105623698 CTCGTGGGGGCCTGTGTCTGAGG + Intergenic
1123070978 14:105642403-105642425 CTCGTGGGGGCCTGTGTCTGAGG + Intergenic
1123090642 14:105740673-105740695 CTCGTGGGGGCCTGTGTCCGAGG + Intergenic
1123096274 14:105768437-105768459 CTCGTGGGGGCCTGTGTCCGAGG + Intergenic
1124069885 15:26381374-26381396 GGCGTGGGTTGCTGGGTCTGGGG + Intergenic
1125477754 15:40058880-40058902 TTCGTGGTTGGCTGGGGCTGGGG + Intergenic
1128241024 15:66101008-66101030 CACGTGGGTGGGTGGGTGAGCGG + Intronic
1130097274 15:80865302-80865324 CTCCTGGGTAGCTGGGTCTACGG + Intronic
1130856690 15:87845523-87845545 CCTGTGGGTGGCTGGGTCTAGGG + Intergenic
1131133136 15:89912746-89912768 CTGGTGGGCGGCGGGGTCCCAGG + Exonic
1131243967 15:90773981-90774003 CTCTTGGGTTGCTGGGTCTGTGG + Intronic
1131462635 15:92629447-92629469 GACGTGGGTGGCTGGGTGGGTGG - Intronic
1132640187 16:974655-974677 CTTGTGTGTGCCTGGGTCCTGGG - Intronic
1132666391 16:1083054-1083076 CCTGTGGGTGGCAGGGGCCGCGG + Intergenic
1132673830 16:1113670-1113692 CACGGGGGTGTCTGGGTTCGAGG - Intergenic
1132700505 16:1220210-1220232 CTCCTCGTCGGCTGGGTCCGAGG - Exonic
1132739993 16:1407298-1407320 CTCCTGTCTGGATGGGTCCGGGG - Intronic
1132830210 16:1924251-1924273 CTCCTGAGTAGCTGGGACCGCGG - Intergenic
1133881596 16:9787552-9787574 CTCCTGGGGGGCTGTGTCCTGGG + Intronic
1135198087 16:20411236-20411258 CTTGTGGGTATCTGGGTCTGAGG - Intronic
1135220144 16:20607344-20607366 CTTGTGGGTCTCTGGGTCTGAGG + Intergenic
1136567448 16:31078838-31078860 CTGGTGGGTGGCAGGGCCTGTGG - Exonic
1137245205 16:46697225-46697247 CTCTTGAGTAGCTGGGACCGTGG - Intronic
1139683036 16:68580419-68580441 CTGTTGGGTTGCTGGGTCCTTGG - Intergenic
1142252302 16:88997568-88997590 CTGGTGGGAGGCTGGGCCTGGGG + Intergenic
1142400077 16:89854016-89854038 CTCGGGGGTGGCAGGGTGCATGG + Intronic
1143031250 17:3968512-3968534 CTCCTGAGTGGCTGGGACCATGG + Intergenic
1143762659 17:9116300-9116322 CTGGTGGGTGGGTGGGTGGGTGG - Intronic
1144666298 17:17104685-17104707 CTCGTGGGTGGCTGAGGGGGAGG - Intronic
1144763984 17:17723086-17723108 CTGGTGGGTGTGTGGGGCCGTGG - Intronic
1144865015 17:18329982-18330004 CTCCTGAGTAGCTGGGACCGTGG + Intronic
1145253171 17:21307523-21307545 TGCCTGGGTGGCTGGGTCAGAGG + Intronic
1145946205 17:28776577-28776599 CTCGTGTGTAGCTGGGACCAGGG + Intronic
1146185204 17:30720094-30720116 CTCATGGGCGGCTGGGTTTGGGG + Intergenic
1146603599 17:34239040-34239062 CTCGTGGGTGGCTGGGGCTCAGG - Intergenic
1147559249 17:41498945-41498967 CAAGTGGGTGGCGGGGTCTGGGG + Intergenic
1148560274 17:48602170-48602192 CTCCTTGGTTGGTGGGTCCGTGG - Intronic
1149561579 17:57611401-57611423 CTTTTGGCTGGCTGGGTCCTTGG - Intronic
1149724597 17:58880744-58880766 CTCCTGGGTAGCTGGGACCATGG + Intronic
1151966524 17:77434376-77434398 CTGGTGGGTGGCTGAGGCTGCGG + Intronic
1152088584 17:78234640-78234662 CTCGTGTGTGGCTGGATCTGCGG + Exonic
1152189947 17:78882325-78882347 CTTGTGGGTGGCTGGGGCAGAGG - Intronic
1152242685 17:79168526-79168548 CTCCTGGCTGGCAGGGTCAGGGG - Intronic
1152685490 17:81691729-81691751 CTAGTGTGGGGCAGGGTCCGAGG - Intronic
1153831180 18:8924334-8924356 CTCCTGAGTGGCTGGGACTGCGG + Intergenic
1160168299 18:76532098-76532120 GTCCTGGGTGGGTGGGTCCTGGG + Intergenic
1160168360 18:76532295-76532317 GTCCTGGGTGGGTGGGTCCTGGG + Intergenic
1160726377 19:619497-619519 CTGCTGGGAGGCTGGGTCGGGGG + Intronic
1160734017 19:653605-653627 CTCATGGATGGCTGGGCCCCTGG + Intronic
1161087784 19:2343141-2343163 CTCGTGGGAGGCGGCGTCCTGGG + Intronic
1161088143 19:2344399-2344421 CTCACGGGTGGCTGAGTCCGAGG - Exonic
1161340453 19:3739036-3739058 CTCGTGCGTGGCTCTGCCCGGGG - Exonic
1161957740 19:7505970-7505992 CGGCTGGGTGGCTGGGTCGGGGG - Exonic
1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG + Intronic
1162386179 19:10361828-10361850 CTCGTGCCTGGCAGGGACCGTGG - Exonic
1162973576 19:14195595-14195617 CTCATGGGCGGCTGGGTTTGGGG - Intronic
1164610659 19:29629364-29629386 CTCCTGGGTGGGTTGGTCCAGGG - Intergenic
1164833247 19:31339373-31339395 CTTCTGGATGGCTGGGTGCGTGG - Intronic
1165639366 19:37371055-37371077 CTCGTGGTTCGCGGGGTCCATGG + Intronic
1166361148 19:42253580-42253602 CTCCCGGGTGGCTGGGCCCTGGG - Intronic
1166546419 19:43636776-43636798 CTCATGGGTGGGTGGGTGGGGGG + Intronic
1167369245 19:49071081-49071103 CTGGTGGGTGGCTGGAGACGTGG + Intronic
1168156133 19:54473809-54473831 CAGGTGGGAGGCTGGGTCAGCGG + Intergenic
1168163895 19:54533564-54533586 CTCTGGGGTGGCTGTGTCCCTGG + Intronic
1168281573 19:55308757-55308779 GGCGTGGGTGGCGGGGGCCGTGG + Intronic
926106349 2:10154400-10154422 CTGGTGGGTGGTTGGGTGGGGGG + Intronic
926295121 2:11563459-11563481 CTCATGGGTGGCAGAGTCAGGGG - Intronic
926473030 2:13285116-13285138 CTCCTGTGTGGCTGGGTCCAAGG + Intergenic
928096925 2:28410429-28410451 GGCCTGGGTGGCTGGGTCAGAGG - Intronic
931535593 2:63271968-63271990 TTGGTGGGTGGGTGGGTCCTTGG - Intronic
931649513 2:64454870-64454892 CGCGTGGGTGAGTGTGTCCGGGG + Intronic
932708827 2:74047461-74047483 CTGGTGGGTGTCGGGCTCCGAGG - Exonic
933769698 2:85735134-85735156 CTCCTGGGTGACTGGGTCTGAGG + Intergenic
938778250 2:134560652-134560674 CTCTTGGCTTTCTGGGTCCGGGG - Intronic
939463872 2:142532171-142532193 CCCCCGTGTGGCTGGGTCCGGGG - Intergenic
944256055 2:197624824-197624846 CTCTTGGGTAGCTGGGACCAAGG - Intronic
947841382 2:233209946-233209968 TTCGTGGGTGGCAGTGTCTGTGG - Intergenic
1169327552 20:4687258-4687280 CTCGGCGGGGGCGGGGTCCGGGG + Intronic
1172848392 20:37944039-37944061 CTCGTAGGTGCCTTCGTCCGTGG - Exonic
1174066847 20:47871869-47871891 GTCATGGGTGGCTGGGGCTGGGG - Intergenic
1174484888 20:50854993-50855015 CTCAGGGGTGGCCGGGTTCGTGG + Intronic
1176211478 20:63925073-63925095 CGCCTGTGTGGCTGGGTCTGGGG + Intronic
1177811052 21:25925359-25925381 ATCGTGGGAGGCTGGTTCCATGG + Intronic
1179903588 21:44407617-44407639 TTCGTGGGTGGCTGTGGCTGAGG - Intronic
1180227185 21:46401370-46401392 CTGGGAGGTGGCTGGGTCCTGGG + Intronic
1182004603 22:26949389-26949411 CTCCTGGGTGGCAGGCTCCCTGG - Intergenic
1183219722 22:36504834-36504856 CAGGTGGGTGGGTGGGTCCAGGG - Intronic
1183623255 22:38986922-38986944 CTGCTGGGTGGCTGGGGACGGGG + Intronic
1183957895 22:41393216-41393238 CTCCTGAGTAGCTGGGACCGCGG - Intronic
1184352683 22:43955045-43955067 CTCGGGGGTGGCCGGACCCGGGG + Intronic
1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950439886 3:13004449-13004471 CTGGTGGGAGGCTGGGGCCTGGG - Intronic
950464213 3:13143694-13143716 CTGTTGGGTGGCTGGGGCTGTGG + Intergenic
953562121 3:43999416-43999438 CTCAGGAGTGGCTGGGACCGCGG - Intergenic
954478459 3:50772301-50772323 GTAGTGGGTGGCTGGGTGAGGGG + Intronic
954611065 3:51944827-51944849 CTTCTGCGTGGCTGGGTCCAGGG - Exonic
955392783 3:58533497-58533519 CTCCTGGGTGGCTGCGTCATAGG + Exonic
957100584 3:75822323-75822345 CTCATGGGTAGCTGGGACCACGG + Intergenic
961717813 3:128870654-128870676 CTGTTGGGTGGCTGGGGCTGTGG + Intergenic
963251036 3:143103850-143103872 CCCCAGTGTGGCTGGGTCCGGGG - Intergenic
967194317 3:187013487-187013509 CTCGTGGGAGGCAGGGTCAAGGG - Intronic
967584525 3:191195931-191195953 CTCCTGAGTAGCTGGGTCTGAGG - Intergenic
968319703 3:197754785-197754807 CTCCTGGGTAGCTGGGACCACGG + Intronic
968938724 4:3626971-3626993 TTCGTGGGTGGCTGGATATGTGG + Intergenic
972286306 4:37651760-37651782 CTCCTGTGTGGCTGGGTCTGGGG - Intronic
973917839 4:55654581-55654603 CCCTTGTGTGGCTGGGTCTGGGG + Intergenic
977192705 4:94020855-94020877 CTCCTGGGTAGCTGGGACCCAGG - Intergenic
979268544 4:118732242-118732264 CTCGTGGGGGGCTGAGGCAGGGG - Intronic
983577183 4:169271511-169271533 CGCGGGAGGGGCTGGGTCCGCGG + Intergenic
983583780 4:169334862-169334884 CAGGTGGGTGGCAGGGTCTGTGG + Intergenic
985707041 5:1407412-1407434 CTGGTGGGAGGCAGGGTCTGGGG - Intronic
989279165 5:39621778-39621800 CTCAAGGCTGGCTGAGTCCGGGG + Intergenic
990438679 5:55821851-55821873 CTGGTGGGTGGCTGTGTGCGGGG + Intergenic
991347445 5:65684673-65684695 CTCCTGAGTAGCTGGGTCTGCGG + Intronic
992716352 5:79514359-79514381 CTCGTGGGGAGCTGGGCCGGCGG + Intergenic
1000636101 5:163645391-163645413 CTCCCATGTGGCTGGGTCCGGGG - Intergenic
1001524388 5:172418384-172418406 CTGGAGGGTGGCTGGGCCCCAGG + Intronic
1002320879 5:178375240-178375262 CTCGTGGTTGGCAGGGGCTGGGG + Intronic
1003071303 6:2947493-2947515 CTCCTGGATGGCTGGGTGCAGGG + Intergenic
1003617371 6:7667821-7667843 CTCGTAGGTGGCTGGTTCAAGGG + Intergenic
1006540614 6:34737006-34737028 CCCCTGTGTGGCTGGGTCTGGGG - Intergenic
1007385422 6:41517271-41517293 CTACTGGGTGGATGGGTCCCTGG + Intergenic
1007654647 6:43444936-43444958 CTAGTGAGTGGCTGGGGCTGGGG + Exonic
1008520945 6:52362143-52362165 CCCGCGGGTGGCTGTGACCGCGG - Exonic
1009417856 6:63435512-63435534 CTTGTGGGTGGGTGGGTGAGGGG - Intergenic
1013339306 6:109197950-109197972 ATAGTGGCTGGCTGGGTGCGGGG - Intergenic
1017046255 6:150349666-150349688 CTCGTGGGTGGCAAGCTCCATGG - Intergenic
1019273520 7:163974-163996 CTCGTGGCTGCCTGGGACTGGGG - Intergenic
1019314351 7:377570-377592 CTGGGGTGTGGCTGGGTCGGAGG - Intergenic
1021698958 7:23299412-23299434 TTCCTCGGTGGCGGGGTCCGCGG + Exonic
1021881312 7:25097773-25097795 CTCGTGGGTGTCTGTGTCCAGGG - Intergenic
1022034197 7:26518563-26518585 CTAGTGGGTGGTAGGGTCCAAGG + Intergenic
1022237693 7:28477653-28477675 CTCGTGGGTGGTGGGGTTCAAGG + Intronic
1023939162 7:44759186-44759208 CTCATGTGTGGCAGGGTTCGGGG - Intronic
1024002404 7:45199367-45199389 CTTGTGGGTGGGTGGGTGGGTGG - Intergenic
1024521533 7:50308795-50308817 CTCCCAGGTGGCTGGGTCTGAGG + Exonic
1024965549 7:55019720-55019742 CTGGTGGGCGCCTGGGGCCGGGG + Intronic
1025284550 7:57651332-57651354 CGCGATGGTGGCTGGATCCGGGG + Intergenic
1029679503 7:102098486-102098508 CTCTTGAGTGGCTGGGACCACGG - Intronic
1031058746 7:117024721-117024743 CTAGTGGATGGCTGTGTCAGGGG + Intronic
1034714309 7:153225707-153225729 CCCGTGGGTTGGTGGGTTCGTGG - Intergenic
1035535460 8:387536-387558 CTCCAGGGAGGCTGAGTCCGAGG - Intergenic
1035629808 8:1098644-1098666 GGCGTGGGTGGCGGCGTCCGTGG - Intergenic
1038505903 8:28084862-28084884 CTCCTGGGTAGCTGGGACCATGG + Intergenic
1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG + Intergenic
1038997475 8:32940622-32940644 CTCGTGAGTGGCTGGCTGCCTGG + Intergenic
1039056149 8:33538482-33538504 CTCCTGTGTAGCTGGGTCCATGG + Intergenic
1041709340 8:60878876-60878898 CTTCTGGGTGGCTGGGTGGGTGG - Intergenic
1041983780 8:63894956-63894978 CTCTCAGGTGGCTGGGTCCAGGG + Intergenic
1049236651 8:141515512-141515534 CGGGTGGGTGGCTGGGTGAGAGG - Intronic
1050932689 9:11349673-11349695 TTCCAGTGTGGCTGGGTCCGGGG + Intergenic
1051171593 9:14322776-14322798 CTCGAGCGTGGGTGGGTGCGTGG + Intronic
1056746809 9:89310632-89310654 TTCGTGGTCGGCTGGGTCGGGGG - Intergenic
1057592379 9:96383646-96383668 CTGGCGGGCGGCGGGGTCCGCGG - Exonic
1057788141 9:98103920-98103942 CTCGTGACTGGCTGGGTGCTGGG - Intronic
1060280615 9:122213525-122213547 CACGTGGGCGGCTGAGGCCGAGG - Intronic
1061418347 9:130460251-130460273 CTGGTGGGTGGCTGTCTCCCAGG - Intronic
1062307931 9:135920169-135920191 CTCCTGGGTAGCTGGGACCAAGG - Intergenic
1062326065 9:136013160-136013182 CTCTCGGGTGGGTGGGGCCGGGG - Intronic
1062538498 9:137031336-137031358 CTCGGAGGTGGCTGAGGCCGTGG + Exonic
1185692328 X:2165707-2165729 TGCGTGTGTGGCTGGGTGCGGGG - Intergenic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic
1190716105 X:53105005-53105027 CTCCTGAGTGGCTGGGACCATGG + Intergenic
1190733271 X:53238500-53238522 CTCCTGGGTAGCTGGGACCATGG + Intronic
1191192406 X:57680475-57680497 CTCTTGGGTGGCTGGGACTGTGG - Intergenic
1192486380 X:71530533-71530555 CTGGTGGGTGGGTGGGTGGGTGG + Intronic
1196778186 X:119360091-119360113 CTCCTGGGTAGCAGGGTCCCAGG - Intergenic
1196845473 X:119893592-119893614 CTCCTGGGTAGCTGGGCCCACGG - Intergenic
1199017520 X:142836034-142836056 CTGGAGGGTGGCTAGGTGCGTGG + Intergenic
1200783393 Y:7237165-7237187 CCCCTGAGTAGCTGGGTCCGTGG - Intergenic