ID: 1184378984

View in Genome Browser
Species Human (GRCh38)
Location 22:44133208-44133230
Sequence AGGCAGAAGCAGAGGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 697}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184378975_1184378984 30 Left 1184378975 22:44133155-44133177 CCTGGCTCCGAGATAAATGATTG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG 0: 1
1: 0
2: 8
3: 70
4: 697
1184378978_1184378984 23 Left 1184378978 22:44133162-44133184 CCGAGATAAATGATTGGAACGGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG 0: 1
1: 0
2: 8
3: 70
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184378984 Original CRISPR AGGCAGAAGCAGAGGCATGA GGG Intronic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900864690 1:5260067-5260089 AGGCAAGGGCAGAGGCATGGAGG - Intergenic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
901826144 1:11862821-11862843 ATGCACAAGCAGAGGCTAGAAGG + Intergenic
902359772 1:15936005-15936027 GGGCAGGAGCAGGGGCAGGAAGG - Exonic
902449636 1:16488701-16488723 AGGCATGAGCAAAGGCATGGAGG - Intergenic
902504846 1:16932641-16932663 AGGCATGAGCAAAGGCATGGAGG + Intronic
902818834 1:18931250-18931272 AGACAGAAGCAGTGGGAGGAGGG - Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903479335 1:23641704-23641726 AGACAGAAGCAGAGACTGGAGGG - Intergenic
904030258 1:27529019-27529041 AGGCAGAGACAGAGACATGGAGG + Intergenic
904203204 1:28835230-28835252 AGCCAGAAGCAGAGCCAGGGTGG + Intronic
904350857 1:29905360-29905382 GGGCTGCAGCAGTGGCATGAGGG - Intergenic
905878887 1:41450778-41450800 AGGCAGAAGGACTGGCCTGAGGG + Intergenic
906094940 1:43216515-43216537 AGGCTGAACCAAAGGCCTGAAGG + Intronic
906108870 1:43310250-43310272 AGGCGGAAGGTGAGGCTTGATGG - Intronic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906824597 1:48965484-48965506 AGGAAGGAGCAGAGGAATCAAGG + Intronic
906918830 1:50041450-50041472 TGGCATAAGCAAAGGCATGAAGG + Intergenic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907467653 1:54650000-54650022 AGGCAGATGCAGAGCTATGCAGG + Intronic
907484657 1:54768860-54768882 AGGCAGCAGCAGTAGGATGAGGG - Intergenic
907513583 1:54979835-54979857 AGGCAGAAGGAGCAGCATGTAGG - Intergenic
907555054 1:55336156-55336178 AGGCAGAAGAAGGGGCAGGAGGG + Intergenic
907731480 1:57070777-57070799 GGGCCGAGGCAGAGGCAAGAAGG + Intronic
908119109 1:60968916-60968938 AGGCAAGAGCAGCAGCATGAAGG - Intronic
908800498 1:67875270-67875292 AGGCAGAGGCACAGGCTTGCTGG + Intergenic
909325413 1:74345745-74345767 TAGCAAAAGCAGAGGTATGAGGG + Intronic
910263793 1:85316834-85316856 CCGCAGAAGCAAAGGCATGGAGG - Intergenic
910344912 1:86225490-86225512 AGGCAGCTCCAGAGGCAAGAGGG + Intergenic
911054423 1:93698121-93698143 AGGCAGCAGCGGAAGCAGGATGG + Intronic
911406355 1:97445283-97445305 AAGGTGAAGCAGAGACATGAAGG - Intronic
911506513 1:98759102-98759124 AGGCAGAAGAAGTGACATGGAGG + Intronic
911534776 1:99087697-99087719 AGGCTGAACAAGAAGCATGATGG - Intergenic
911910191 1:103624361-103624383 GGGCAGAAGCAAAAGGATGATGG + Intronic
911917609 1:103718486-103718508 GGGCAGAAGCAAAAGGATGATGG + Intronic
912185991 1:107276411-107276433 TGGCATAAGCAAAGGCAGGAGGG - Intronic
912498622 1:110107257-110107279 TGGGAGAAGCAGGAGCATGAAGG - Intergenic
912606492 1:110995198-110995220 AGGCAGAACCAGATGGTTGAGGG - Intergenic
912744874 1:112237790-112237812 TGACAGAAGGAGAGGCATCAAGG - Intergenic
914964025 1:152237076-152237098 AGGTAGAAGAAAAGGCAGGAAGG - Intergenic
915300020 1:154946489-154946511 AGGCTGAGGCACAGGCATTAAGG - Exonic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915602969 1:156933870-156933892 AGGCAGAGGCAGTGGGATGAGGG - Intergenic
915956409 1:160224020-160224042 AGGCAGAAGAGGAGGAATGGTGG - Intronic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916741447 1:167650348-167650370 AGGAGGAAGCAGAGGCCAGAGGG - Intronic
916822773 1:168415951-168415973 AAGGAAGAGCAGAGGCATGATGG - Intergenic
917241036 1:172949079-172949101 AGGCAGAAGCAATGCCATGCTGG + Intergenic
917471648 1:175330877-175330899 AGGAAGAAGCAGATGAATGAGGG - Intronic
917716304 1:177741309-177741331 TGGCAGAAGGAGAGGCAGGGTGG - Intergenic
917906767 1:179592469-179592491 AGGCAGAAGTAGTAGTATGAGGG - Intronic
918183011 1:182101437-182101459 GGGAAGGAGCTGAGGCATGAGGG + Intergenic
918290184 1:183099896-183099918 AGGCAGGCGCAGGGGCAGGATGG - Intronic
919018128 1:192067546-192067568 AGGCTTCAGCAGACGCATGAAGG - Intergenic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920114465 1:203610174-203610196 ATGAAGAAGCAGAGGCCAGAGGG + Intergenic
920273031 1:204781310-204781332 AGTCAGATGTAGAGTCATGAAGG + Intergenic
920366750 1:205452000-205452022 AGGCAGAACCGGAGGCAGCAGGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922691484 1:227695540-227695562 AGGCAAAGGCAGAGTCATGGAGG - Intergenic
923456563 1:234170086-234170108 GGGCTGGAGAAGAGGCATGAAGG - Intronic
923519912 1:234727451-234727473 AGGCAGCAGCAGTGGCGTGGAGG - Intergenic
923522961 1:234750296-234750318 AGAAAGGAGCAGAGACATGAAGG - Intergenic
923732351 1:236564519-236564541 AGACAGGAGCTGAGACATGAAGG + Exonic
924099059 1:240584911-240584933 TGACAGAAGCTGAGGGATGACGG + Intronic
1062905730 10:1178400-1178422 AGGCAGGAGCAGAGGCCACAGGG - Exonic
1063313391 10:4978174-4978196 AGGAAGAAGCACACGCAGGATGG + Exonic
1063314561 10:4989543-4989565 AGGAAGAAGCACACGCAGGATGG - Exonic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1064752801 10:18548865-18548887 AGTCAGAAAAAGAGGCATAAAGG - Intronic
1064814106 10:19236545-19236567 AGTGAGAGGCAGAGGAATGAGGG - Intronic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1064934819 10:20668007-20668029 AGGCAGAAGGAGTGGTATGCGGG + Intergenic
1065968844 10:30790050-30790072 ATGCTGAAGCAGAGCCCTGAGGG + Intergenic
1066467050 10:35661416-35661438 AGGAAGAAGCAGAGGAGAGACGG - Intergenic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1067800496 10:49355082-49355104 TGGAAGAAGCAGAGGCTTAAAGG - Intergenic
1068652939 10:59542505-59542527 AGGCAAAATGAGAGGCAAGAAGG - Intergenic
1069095167 10:64250230-64250252 AAGGAGGAGCAAAGGCATGAAGG + Intergenic
1069836463 10:71311620-71311642 AGGAAGAAGCAAATGCAGGAAGG + Intergenic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1069915367 10:71783762-71783784 AGGCAGAAGGGGACGGATGAGGG - Intronic
1070159372 10:73856596-73856618 AGGCAGGAGCAGAGGGACTATGG + Intronic
1070430244 10:76330604-76330626 GGGCAGAGACAGAGGGATGAGGG + Intronic
1070648601 10:78219059-78219081 AGGCAGAAACAAAGGCAGCAAGG - Intergenic
1070681714 10:78453517-78453539 AGACAGAGGCAGAGGCTTCAGGG + Intergenic
1070819949 10:79348673-79348695 AGGCCCAGGGAGAGGCATGAGGG - Intronic
1070876451 10:79816092-79816114 AAGCTGGAACAGAGGCATGAGGG + Intergenic
1070919978 10:80178480-80178502 AGGCAGGACCAGAGGCCAGAAGG - Intronic
1071347928 10:84711015-84711037 AGGAAGAAGAAGAAGAATGAGGG - Intergenic
1071789724 10:88941296-88941318 AGCCAGATCCAGACGCATGATGG + Exonic
1071860072 10:89663298-89663320 AGGCATAGGCAGAGGCTTGAAGG + Intergenic
1072165626 10:92810078-92810100 AGGCAAAGGCACAGGCATGGAGG + Intergenic
1072540604 10:96395387-96395409 AGGAAGAAACAGAGGCAAGGTGG + Intronic
1072923954 10:99599909-99599931 AGGAAGAAGCGGAGGTATGGAGG - Intergenic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073446268 10:103582352-103582374 AGGCAGAGGCAGAGGCCAGGAGG - Intronic
1073776223 10:106788919-106788941 AGGCAGGGGCAGAGGCCTCATGG - Intronic
1073776598 10:106793301-106793323 ATGCAAAAGCAGAGGAATGCGGG + Intronic
1074820270 10:117173269-117173291 AGGCAGAGGCAATGGCATGAAGG + Intergenic
1075243760 10:120801771-120801793 AGGCAGAAGCCCAGAAATGAGGG + Intergenic
1076016029 10:127028182-127028204 CGGGAGAAGCAGGGGCAGGAAGG + Intronic
1076210745 10:128642722-128642744 AGGCAGAAGGAGATACAAGAGGG + Intergenic
1076326320 10:129626271-129626293 ATGGAGAAGGAGAGGCATGCGGG - Intronic
1076994211 11:290361-290383 AGGCAGAAGCGAAGGCAGGTGGG - Intronic
1077192096 11:1259841-1259863 AGGTAACAGCAGAGGCATGTGGG + Exonic
1077391943 11:2304305-2304327 AGGCAGAACCAGAGGCCCCAGGG + Intronic
1077391962 11:2304375-2304397 AGGCAGAAACAGAGGCCCCAGGG + Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077996525 11:7457152-7457174 AAGCAGAAGCAAGGGCATGGGGG - Intronic
1078106774 11:8362831-8362853 AGGCAGAAAGAGAGGGATGGAGG - Intergenic
1078481824 11:11683378-11683400 AAGGAGAAGCAAAGGCATGGTGG - Intergenic
1079089177 11:17468874-17468896 AGGCAGAAGCAACAGGATGATGG - Intronic
1080126165 11:28736471-28736493 AAACAGAGGCAGAGTCATGAAGG + Intergenic
1080396853 11:31898212-31898234 AGTCAGAGTCAGTGGCATGAAGG - Intronic
1080397610 11:31904297-31904319 AGACAGGAGCACAGGCATGCAGG - Intronic
1080645562 11:34185198-34185220 AGGAAGAAGCAGTGGCGTGAGGG + Intronic
1081205288 11:40267951-40267973 AGGCACAAGGAGAGCAATGAAGG - Intronic
1081374300 11:42340539-42340561 AAACAGAAGCAGAGGTCTGAAGG - Intergenic
1081668908 11:44932594-44932616 AGGCAGTGGCAGAGGGGTGAGGG - Exonic
1082162663 11:48901344-48901366 AGACAGACACAGAGGCATCACGG - Intergenic
1082809197 11:57468344-57468366 AGGCAGAGGCAGAGAGGTGAAGG - Intronic
1082834446 11:57641186-57641208 GGCCAGCAGCAGAGGCATGCCGG - Intergenic
1083006985 11:59355968-59355990 TGGCAGAACCTGAGGGATGAAGG + Intergenic
1083268633 11:61559316-61559338 AGGCAGAGGGAAAGGCATGGAGG + Intronic
1083659353 11:64245113-64245135 AGGCAGGAGCTGGGGCTTGAGGG + Intronic
1084199121 11:67543592-67543614 AGGCAGGAGGAGAGGCAGGGAGG - Intergenic
1084964351 11:72736664-72736686 AGAGAGAAGGAGAGGCAGGATGG - Intronic
1085012844 11:73153184-73153206 AGGCAGTGGCAGAGGATTGAGGG - Intergenic
1085027265 11:73243512-73243534 ATCCAGAAGCAGAGGTAAGATGG + Intergenic
1085349233 11:75787941-75787963 ATGGAGAAGAAGAGGCCTGATGG - Intronic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085873221 11:80375203-80375225 AGACAGAAGCAGAGGCTATAAGG + Intergenic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086587931 11:88477604-88477626 AGGCGGAGGCAGAGGCAGAAAGG + Intergenic
1086926287 11:92644056-92644078 AGGCAGCAGCAGAGGCACCCAGG - Intronic
1087185122 11:95182845-95182867 AGGCCCAAGCAAAGGCACGATGG - Intronic
1087274881 11:96151189-96151211 AGGCAGGAGCTGAGGAAGGATGG - Intronic
1087331264 11:96783483-96783505 AGGCAGAAGCACAGGCCAGATGG + Intergenic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1089641200 11:119848264-119848286 GGGAAGAGGCAGAGGCGTGAGGG + Intergenic
1089643766 11:119864662-119864684 AGGGGGAAGCCGAGGCATGAGGG - Intergenic
1090385402 11:126355443-126355465 AGGCGGAAGAGGAGGCCTGATGG - Intergenic
1091218070 11:133915776-133915798 AGGCTGAAGCAGTGGCTTGATGG + Intronic
1091240302 11:134047552-134047574 GGGGACAAGCAGAGGTATGATGG - Intergenic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091863266 12:3806063-3806085 AGGCATAAGCAAAGGCATGGGGG + Intronic
1091981343 12:4866605-4866627 AGGCAGTAGCACAAGCATGGAGG - Intergenic
1092424263 12:8361332-8361354 AGGCAGAAATGGAGCCATGAGGG + Intergenic
1093690184 12:22101556-22101578 AGGCAGAAGCAGTGGCAGAGAGG - Intronic
1093743720 12:22716067-22716089 AGGAAGGAGCAGAGGGATGAAGG + Intergenic
1093945407 12:25102567-25102589 AGGCAGAAGCCAAGGGCTGAGGG - Intronic
1094200989 12:27794322-27794344 AGACAGAGGCAGGGGCATCATGG - Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095380135 12:41581171-41581193 AGGCAGAAGCCAGGTCATGAAGG + Intergenic
1095477040 12:42596173-42596195 GGGCAGAGGCTGAGGCATGTAGG + Intergenic
1095998490 12:48109784-48109806 AGGCAGAAGAGGAGGAATGGAGG - Intronic
1097416510 12:59322791-59322813 AGGCAGAAGAGGAGGCAAAATGG + Intergenic
1098010774 12:66048810-66048832 AGGCAAAAGGAGAGGCAAAATGG + Intergenic
1098329394 12:69336868-69336890 AGGCAGAAGCAAAGGTTTAAAGG + Intergenic
1098430133 12:70410030-70410052 AGACAGGAGCAAAGGCATCAAGG - Intronic
1098878665 12:75893237-75893259 AGCCAGCAGCAGAGGCCTGTGGG - Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1100132700 12:91516216-91516238 AGGCAGAAGCTGAGGCTTAGGGG + Intergenic
1100308878 12:93376707-93376729 AGGCAGGAGCTGAGGGCTGAAGG - Intergenic
1100641432 12:96485300-96485322 AGGCAGAAGATGAGGCAGAAAGG - Intergenic
1100777880 12:97992220-97992242 AGGCAGAGACAGAGGCAGAATGG - Intergenic
1101568963 12:105935695-105935717 AGAGAGGAGAAGAGGCATGATGG - Intergenic
1101687391 12:107038539-107038561 AGACAGAAGCAAGGGCATGTGGG + Intronic
1101754255 12:107608423-107608445 AGGCAGAAGCTGAGGTAAGCAGG - Intronic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102468243 12:113142949-113142971 AGGTAGGGGCAGAGGCATGAAGG + Intergenic
1102556420 12:113729679-113729701 AGGCACATGGAGGGGCATGAGGG - Intergenic
1102783824 12:115587770-115587792 AGGCTGAATGAGAAGCATGACGG - Intergenic
1102787102 12:115613885-115613907 GGCCACAAGCAGAGGCATGCAGG + Intergenic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103843360 12:123883549-123883571 AGGCAAAAACAGAGGCATTTTGG - Intronic
1104426584 12:128682975-128682997 AGGCAGACGCACAGGGAGGACGG - Intronic
1104533103 12:129591138-129591160 AGGCAGAAGGACTGGAATGAAGG + Intronic
1104747694 12:131220347-131220369 AGGAAGAAACAGAGACATTAAGG - Intergenic
1105457321 13:20553596-20553618 AGGCACAAGCAGGGTCATGTGGG + Intergenic
1105830988 13:24162537-24162559 AGTCAGAAGCAGTGGCAGAAGGG - Intronic
1105947693 13:25203494-25203516 AGGCAGGAGCAGAGCCCTGGAGG + Intergenic
1106138956 13:26994799-26994821 CGGCAGAAGCAGAGGCACTGGGG + Intergenic
1106368956 13:29112762-29112784 AGACAGAAACAAAGGCATAAGGG + Intronic
1107457149 13:40565401-40565423 AGACAGAAGCTGGGGCATGGAGG - Intronic
1107986879 13:45783657-45783679 AGGAAACAGGAGAGGCATGAAGG - Exonic
1108071251 13:46630923-46630945 AGGCAGAACCAGAAGCAAGCTGG - Intronic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1110669039 13:78154619-78154641 TGGCAGAAGCAGGAGCAAGAAGG + Intergenic
1111763337 13:92494705-92494727 AGTGAGAAGCAGAGGCATACAGG - Intronic
1112191808 13:97185621-97185643 AGCCATGAGCAGAGGCATGTGGG + Intergenic
1112324403 13:98433822-98433844 AGGCACAAGCTGAGGCTTAAAGG - Intronic
1112409106 13:99146782-99146804 AGACAGACGCAGAGGCGGGAGGG - Intergenic
1112714708 13:102170315-102170337 AGGGAGAAGAAGAGGCAAAAAGG - Intronic
1112903721 13:104391414-104391436 AGACAGCAGGAGTGGCATGAAGG + Intergenic
1113245884 13:108394922-108394944 AGCCAGACTCAGAGGCATTATGG + Intergenic
1113341531 13:109430768-109430790 AGACAGAAGCAGAGGCTGAATGG - Intergenic
1113679011 13:112229372-112229394 AGGCAGAAGCCCAGGCCTGGTGG - Intergenic
1113777304 13:112955132-112955154 AGGCAGCAGGAGAGGAGTGAGGG + Intronic
1114184259 14:20388233-20388255 ATGCAGAACCACAGGAATGAAGG + Intronic
1114404182 14:22439695-22439717 AGGGAGTAGCAGTGGCATGAAGG + Intergenic
1114483845 14:23051796-23051818 AGGCATAAGCAGGGGTATAAGGG + Intronic
1114527735 14:23377030-23377052 AGGCAGCAGCAGAGGCACTCTGG + Exonic
1115565501 14:34621790-34621812 AGGCAGTGGAAGAGGGATGAAGG - Intronic
1117496178 14:56307519-56307541 TGGCAGAAGCAGAAGTATGCGGG - Intergenic
1117880726 14:60310788-60310810 AGAGAGAAACAGAGGCAAGAAGG - Intergenic
1118588150 14:67376600-67376622 AGGTAGAAGGAGAGTCAAGAAGG - Intronic
1118896100 14:69946905-69946927 TGGCAAAAGCAGAAGCAAGAGGG - Intronic
1119187087 14:72650688-72650710 AGGCAGATGGAGAGGCAGCATGG - Intronic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1119829263 14:77686494-77686516 AGGCACTAGCAGAAGGATGATGG + Intronic
1120089663 14:80316723-80316745 AGGCAGAAGCAGAGACATCTGGG + Intronic
1120388519 14:83876299-83876321 TGGCAGAAGCAGAAGCAAGGTGG - Intergenic
1120520183 14:85518468-85518490 AGGTAGAAGAAGAGACATTAGGG + Intergenic
1120814604 14:88842050-88842072 AGGCAGAAGGAGAGGGAGAAAGG + Intronic
1121017448 14:90557124-90557146 AGGTAGAAGCAGAGGGCAGATGG - Intronic
1121077090 14:91077837-91077859 AGGAAGAAAGAGAGGAATGAAGG + Intronic
1121697842 14:95927940-95927962 AGGGAGAAGGAGAGGGATGGAGG - Intergenic
1121930561 14:97968167-97968189 ATGAAGAAGCTAAGGCATGAGGG + Intronic
1121961256 14:98262367-98262389 TGGCAAAAGCAGAAGCAAGAGGG + Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122270136 14:100565302-100565324 GGGCAAAGGCAGGGGCATGAAGG + Intronic
1122379431 14:101291123-101291145 AGGTGGAAGAAAAGGCATGAGGG + Intergenic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122714944 14:103690562-103690584 AGGCTGAGGCACAGGCTTGAGGG - Intergenic
1122881887 14:104693958-104693980 AGGTGGAAGCAGAGGCAGGTGGG - Intronic
1122983357 14:105201421-105201443 AGGCTGGAGCAGAGCCATGGGGG + Intergenic
1123004154 14:105313573-105313595 CGGAGGAAGCAGCGGCATGAGGG + Exonic
1124370823 15:29103792-29103814 AGACAGAAGCAGAGGCCTGGGGG + Intronic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1125003139 15:34792475-34792497 AGCCAGATCCAGACGCATGATGG + Exonic
1125261033 15:37824948-37824970 AAGTAGAAGCTGAGTCATGAGGG - Intergenic
1126300770 15:47193764-47193786 AGGCAGAGCTAGAGACATGAAGG - Intronic
1126355959 15:47796220-47796242 AGTCAGAAGAAGAGGGAGGAAGG - Intergenic
1126795806 15:52259861-52259883 AGGCAGCAGCAGGGCCGTGAAGG + Intronic
1126847613 15:52775865-52775887 AGACAGAAGCACAGACATGTAGG - Intronic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1127318585 15:57819978-57820000 AGGCGGAAGCAGAGGCAGGTAGG - Intergenic
1127447195 15:59076076-59076098 GGGCAGCAGCAGCGGCCTGATGG - Exonic
1127997599 15:64162756-64162778 AGACAGAAGCCGAGGGAGGAGGG + Intronic
1128102569 15:65015201-65015223 AGGAAGTAGCAGAGTCAAGATGG + Intronic
1128290799 15:66476929-66476951 TGGCAGGAGCAGGGGCAAGAGGG + Intronic
1128314774 15:66653664-66653686 AGGGTGAAGCAGAGGCCAGATGG + Intronic
1128390244 15:67177832-67177854 AGGAAGCAGCTGAGGCATGGTGG + Intronic
1128457409 15:67839672-67839694 AGAGGGAAGCAGAGGCAAGATGG + Intergenic
1128609496 15:69062602-69062624 ATGCAGAAGCAAAGGCTTGGAGG - Intronic
1129395263 15:75240994-75241016 AGTCAGAAGCAAAAGCATGGAGG - Intergenic
1129831851 15:78675851-78675873 AGGCAGGAGCAGCTGCTTGAGGG + Intronic
1130533556 15:84766558-84766580 AGGGAGGAAGAGAGGCATGAGGG + Intronic
1130706421 15:86237155-86237177 AGGCAGATACAGAGGAAAGAGGG - Intronic
1130740430 15:86593152-86593174 AGGAAAAAGCAGCAGCATGAAGG - Intronic
1131178240 15:90223507-90223529 AGGCACATGCTGAGCCATGACGG - Intronic
1131234126 15:90681661-90681683 AGGCAGAATCAGAGCCAAGGAGG + Intergenic
1131714430 15:95092896-95092918 AGGCAGAAACAAAAGGATGATGG + Intergenic
1131801612 15:96075054-96075076 AGTCAGAAGCAGATGAATGGTGG - Intergenic
1131823898 15:96301006-96301028 GGGCAGGAGGAGAGGCATGAAGG - Intergenic
1131871616 15:96769905-96769927 AGGAAGAAGCACAGACATGAAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1133392928 16:5423626-5423648 AGACAGCAGCACAGGCAGGATGG - Intergenic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1134867331 16:17620066-17620088 AGGCAGCAGCAGATGCGTGTGGG - Intergenic
1135547947 16:23378383-23378405 AGGCAGAGGCTGAGCCATCATGG + Intronic
1135632420 16:24046605-24046627 CGGCAGAGGCAGAGGCCAGAGGG + Intronic
1135873014 16:26169697-26169719 AGGCAACAGCATAGGCATAATGG + Intergenic
1135935862 16:26779442-26779464 AGGCAGAAGTAGAGGAAAGAAGG - Intergenic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1136050411 16:27646218-27646240 AGGATGAAGCAGAGTCCTGATGG - Intronic
1136080475 16:27849268-27849290 AGGCAGGAGCAGGGCCATGCAGG + Intronic
1137036508 16:35574002-35574024 AGGGAGGGGCAGAGGCGTGAAGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137398791 16:48136255-48136277 AGGGAGGAGCAGAGGCCTGGAGG - Intronic
1137440879 16:48497764-48497786 AGGAAGAAGCAGCAGCATGCAGG + Intergenic
1137462928 16:48682128-48682150 ATGCAGAAGTGGAGCCATGATGG - Intergenic
1137494461 16:48959064-48959086 AGGCAGTGGCAGAGGAATGGTGG + Intergenic
1138215973 16:55205838-55205860 AGGGAGATGCAGTGGAATGAGGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1139531297 16:67543956-67543978 GGGCAGCAGCAGAGGAAGGAGGG - Intronic
1140735636 16:77895517-77895539 TGGCAGAAGCAGAGGAAGAAGGG + Intronic
1141233185 16:82190289-82190311 AGGTGGAAGCAAAGTCATGAAGG + Intergenic
1141444143 16:84047358-84047380 AGACAGCAGCAGAGGCTAGAAGG + Intergenic
1141557923 16:84848210-84848232 AGGCAGGAGCAGAGGGCTGCTGG - Intronic
1141590582 16:85066193-85066215 TGGCCGAGGCAGAGGCTTGAGGG + Intronic
1141685164 16:85565958-85565980 AGTAAGGAGCAGAGGCAGGATGG - Intergenic
1141764689 16:86050817-86050839 AGGCAGAAGCACTGCCAGGAGGG - Intergenic
1141808216 16:86356184-86356206 TGGTAGAAGCAGTGGCATGCTGG - Intergenic
1142002053 16:87669741-87669763 AGGCAGAAAAAGAGGAACGAAGG + Intronic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142885559 17:2910287-2910309 AGCCAGAAGCAGAGGAGTGGAGG - Intronic
1142907185 17:3051847-3051869 AGGCAGTAACAGAAGCATAAAGG - Intergenic
1142927383 17:3252409-3252431 AGGCAGTAACAGAAGCATAAAGG + Intergenic
1143393893 17:6576733-6576755 AGGCAGAAGGAAGGGCCTGAGGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143840495 17:9727991-9728013 AGGCAGAAGCATTAGCATGAAGG + Exonic
1144005649 17:11096693-11096715 AGACACAAGCAGAGGAATGCAGG + Intergenic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145793636 17:27643439-27643461 AGGCAGAGGCAGGGGCAAGAGGG - Intronic
1145808449 17:27750995-27751017 AGGCAGAGGCAAGGGCAAGAGGG - Intergenic
1145989926 17:29073318-29073340 AGGCAGAGGTAGTGGAATGAGGG - Intergenic
1146004882 17:29154881-29154903 AGGGAGGGGCAGGGGCATGAGGG + Intronic
1146432391 17:32810020-32810042 AAGCAAAAGCAGTGGCATGCAGG + Intronic
1147254611 17:39174486-39174508 AGGCAAAGGCTGAGGCATGGAGG + Exonic
1147456675 17:40542321-40542343 AAGCAAAAGCAGAGGCGAGAAGG - Intergenic
1147597406 17:41725780-41725802 TGGCAGAACCAGAGGCAGGTGGG + Intronic
1147749756 17:42722951-42722973 AGGAAAGAGCAGATGCATGATGG - Intronic
1147759936 17:42791028-42791050 AGGTGGAGGCAGAGGCAGGAAGG - Intronic
1148127139 17:45242687-45242709 AGGCAGAAGAAGTGGGGTGAGGG - Intronic
1149573376 17:57693412-57693434 AGGCAGAGGCAGAGGCAGGTGGG - Intergenic
1150420439 17:65029336-65029358 AGGTGGAAGCAGAGGCGTGTGGG - Intronic
1150914485 17:69422784-69422806 AGTCAGTGGCAGAGGCAGGATGG + Intronic
1151174201 17:72273795-72273817 AGCCAGGAGCAGAGGGAAGAGGG + Intergenic
1151360566 17:73586206-73586228 AGCCAGCAGGAGAGGCATGGTGG - Intronic
1151433605 17:74081028-74081050 AGCCAGGAGCAGAGGAGTGAGGG - Intergenic
1151443768 17:74150208-74150230 AGGCAGAAGCAGGGGCGTTGAGG + Intergenic
1151519534 17:74618225-74618247 AGGCAGAAGTTCAGGCATTATGG + Intronic
1151735051 17:75934489-75934511 AGGCAGAGGCAGAGCCGAGATGG + Intronic
1151757811 17:76084586-76084608 AGACAGAAAGAGAAGCATGAGGG + Intronic
1152053065 17:77997580-77997602 AGGGTGGAGCGGAGGCATGAGGG + Intergenic
1152127975 17:78458848-78458870 AGGCAGAGGCAGGGGCCAGATGG - Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152190421 17:78884468-78884490 AGACAGAAACAGGGACATGAAGG + Intronic
1152250231 17:79208653-79208675 AGGCAGAGGCAGAGGCAGAGGGG + Intronic
1152296429 17:79469778-79469800 AGTCAGAAGAACACGCATGAAGG + Intronic
1152395558 17:80030761-80030783 GGGCAGAGGCAGAGGCAGGCAGG + Intronic
1152742679 17:82025206-82025228 AGGCAGCCTCAGAGGGATGAGGG - Intronic
1153167028 18:2273816-2273838 TGGCAGAAGCAGGAGCAAGAGGG + Intergenic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155453464 18:25986762-25986784 GGGCAAAAGCAGAGGCTTTACGG + Intergenic
1155483621 18:26316809-26316831 TGGAAGAAGCAAAGGAATGAAGG - Intronic
1156111726 18:33735668-33735690 AGGCAAAAGCAGAGGGAAGAAGG - Intronic
1156315159 18:35962809-35962831 AGGGAGAAACAGAGGCACCAAGG + Intergenic
1157524897 18:48373289-48373311 AGGCACAAGCAGGAGCAAGAGGG - Intronic
1157823005 18:50787728-50787750 GGGCAGAAGCAGATCCATTAAGG + Intergenic
1158157808 18:54445050-54445072 AGGCAGGAGGAGAGGGATCAAGG - Intergenic
1158204726 18:54980133-54980155 TTACAGAAGCAGAGGCTTGAAGG - Intergenic
1158414840 18:57241022-57241044 AGGTGGAAGCAGAGGTATGCAGG + Intergenic
1158495885 18:57954854-57954876 AGGGAGAAGCTGAGCTATGAAGG + Intergenic
1159002639 18:62987646-62987668 AGGCAGAAGAAGAGGGCAGAGGG - Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159609101 18:70507021-70507043 GGGCAGAAGCACAGGACTGACGG + Intergenic
1159870677 18:73757099-73757121 AGGCAGAGGCAGAGGCAGACAGG + Intergenic
1160173174 18:76571415-76571437 ACACAAAAGTAGAGGCATGAAGG + Intergenic
1160175405 18:76590214-76590236 AGGCAGAAGCAGGAGCAAAAGGG - Intergenic
1160248414 18:77179780-77179802 AGGCAGAAGGGGAGGCCTGCTGG + Intergenic
1160490364 18:79332610-79332632 AGGTGGAAGCGGAGGCAGGAGGG + Intronic
1160636731 19:80820-80842 AGGCAGCAGGGGAGGGATGAAGG - Intergenic
1161514455 19:4688989-4689011 AGGCAGGGGCAGAGGGATGGGGG - Intronic
1161638986 19:5407825-5407847 AGCCAGAAGCAGAGGTCAGAGGG - Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161814201 19:6489368-6489390 AGGAGTAAGGAGAGGCATGAGGG - Intergenic
1162032193 19:7922367-7922389 GGGCAGGAGCAGAGGGATCAAGG + Intronic
1162529489 19:11227689-11227711 AGGTAGAAGCTGGGGCCTGAGGG + Intronic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163148789 19:15399267-15399289 AGGCAGAGGCAGAGGGGTGGAGG + Intronic
1163150030 19:15405963-15405985 AGGCAAAAGCAGATCCATCAGGG + Intronic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1163751076 19:19078205-19078227 GGGCAGAAGCAGAGGTCTGGAGG + Intronic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1164608886 19:29618807-29618829 AGGCAGGAGGAGAGGCCGGAAGG + Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164757773 19:30703079-30703101 AGGCAGAGGCAGCTGCATGGAGG + Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165169413 19:33880967-33880989 AGACAGTAGCAGAGGCCTGAAGG - Intergenic
1165936750 19:39393917-39393939 AGGCACAGGCAGAGGGATCAGGG + Intronic
1165950349 19:39470827-39470849 AGGAAGGAGCAAAGGCAGGAGGG - Intronic
1166065476 19:40356011-40356033 AGGCATAGGCAGAGGGATCAGGG + Intronic
1166161902 19:40960448-40960470 AGCCAGAAGGAGAGGTATGTGGG - Intergenic
1166203712 19:41255044-41255066 GGGAAGACGAAGAGGCATGAAGG - Intronic
1166222558 19:41375131-41375153 AGGAGGAAGCAGAGGCAGGTGGG - Intronic
1166326053 19:42051835-42051857 AGGCAGCAGGAGCGGCAGGAGGG - Intronic
1166338144 19:42121574-42121596 AGGCAGGTCCAGAGGCTTGAAGG - Intronic
1166712884 19:44948605-44948627 GGGCAGAGGCAGAGGTAAGAAGG - Intronic
1167090319 19:47339616-47339638 AGGCAATAGCAGAGTCATCAGGG - Intronic
1167517775 19:49933138-49933160 AGGTAGAGGCAGGGGGATGAAGG - Exonic
1167674494 19:50875948-50875970 GGGGAGGAGGAGAGGCATGAGGG - Intronic
1167694409 19:51006399-51006421 AGGCAGAGACAGAGGGGTGAGGG + Intronic
1168238008 19:55075816-55075838 AGGCGGAGGCGGAGGCAGGACGG + Intronic
1168430298 19:56273694-56273716 AGGCAGAAGGAGGGGCATGGTGG + Intronic
1168670066 19:58234277-58234299 AGGCAGAAGCTGAGGCAGATTGG - Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
926332681 2:11838235-11838257 AGGCAGTGACACAGGCATGAAGG + Intergenic
926686007 2:15698073-15698095 AGGCAGAGGCAGAGGCAGAATGG + Intronic
926837269 2:17037048-17037070 AGGGAGAAAGAGAGGAATGAAGG - Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
927193599 2:20533237-20533259 TGGGAGAAACAGATGCATGAGGG - Intergenic
928405450 2:31011048-31011070 AGACAGAAGCACAGGAAGGAGGG + Intronic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929646835 2:43637042-43637064 AGGCAGACGGAGTGGAATGAAGG + Intergenic
929906355 2:46049747-46049769 GGGCAGAAGGAAACGCATGATGG - Intronic
931333371 2:61312728-61312750 AGGCAGAAGAATAGGGGTGAAGG + Intronic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931683255 2:64770051-64770073 AGGCAGAAGAGGTGGCAGGATGG - Intergenic
932340324 2:70959322-70959344 AGCCAAAGGCAGGGGCATGATGG - Intronic
932424267 2:71619349-71619371 AGCCAGAAGCATACGCAGGAGGG - Intronic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932487086 2:72090777-72090799 AGGCAGAGGAAGGGGCAGGAGGG - Intergenic
932530388 2:72524007-72524029 AGGCAGAAGCGGAAGAATAATGG - Intronic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
933496240 2:83053597-83053619 AGGAAGAAGAAGAGGCAGAAGGG + Intergenic
934103728 2:88677502-88677524 ATGCAGAAGGAGAAGCATGTTGG + Intergenic
934128198 2:88919889-88919911 AGGCAGAGGCAGAGGCAGTGAGG - Intergenic
935125923 2:100222896-100222918 AGGGATAAGCACAGGAATGATGG - Intergenic
935276451 2:101479890-101479912 AGGAACAAGCAGAGGCAGGTGGG - Intergenic
935489542 2:103699363-103699385 AGGCAGAAGAAGAGGCAAAAAGG + Intergenic
935803687 2:106726156-106726178 AGGCTGAAGCTGAGGCCTCACGG + Intergenic
936140608 2:109936909-109936931 AGCAGGAAGTAGAGGCATGAAGG - Intergenic
936177299 2:110234854-110234876 AGCAGGAAGTAGAGGCATGAAGG - Intergenic
936204086 2:110434577-110434599 AGCAGGAAGTAGAGGCATGAAGG + Exonic
936564747 2:113574221-113574243 AGGCAGCAGGGGAGGGATGAAGG + Intergenic
937487821 2:122334285-122334307 AGGCAGAAGCTGTGGGATGGAGG - Intergenic
937717658 2:125052844-125052866 AGGAAGATGCAAAGGCTTGAAGG + Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938380058 2:130831584-130831606 AGGCAGGGGAAGAGGCAGGAGGG - Intergenic
938465101 2:131520071-131520093 AAGCACAGACAGAGGCATGAGGG - Intergenic
938467439 2:131532836-131532858 AGGCAGGGGCAGGGGCATGGTGG - Intronic
938968898 2:136414504-136414526 AGTCAGAACCAGAAGCAAGAGGG - Intergenic
940118643 2:150238511-150238533 AGGCAGAGGCAAAGGCTGGATGG + Intergenic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
941000246 2:160195147-160195169 AGGCAAATGCAGAGGCCTCAAGG + Intronic
941167728 2:162101366-162101388 AGGTAGAAGAAAAGGCAGGAAGG + Intergenic
941246604 2:163105895-163105917 ATGCAGAACCTGAGGTATGAAGG - Intergenic
942095996 2:172537156-172537178 AGGCAGAGGCAGAGGCAGAAAGG - Intergenic
945178352 2:207066281-207066303 AGGCTGAACCATAGGCAAGAAGG - Intergenic
946508367 2:220326137-220326159 AGGAAGAAACAGAGGCAGGGAGG - Intergenic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947585723 2:231355434-231355456 AGGATGAAGCAGATGAATGAAGG - Intronic
947703576 2:232256394-232256416 AGGAAGGGGCAGAGGCTTGAAGG - Intronic
948386123 2:237582107-237582129 AGGCAGGAGCAGAGGCAGAACGG - Intronic
949007133 2:241656096-241656118 ATGCAGAAGGAGAGGCTTCAAGG - Intronic
1168772065 20:421702-421724 TGGCTGGAGCAGAGGGATGAAGG + Intronic
1168945714 20:1755562-1755584 AGGTAAAATCAGAGTCATGATGG - Intergenic
1169068850 20:2709525-2709547 AGGCAGAAGCCAAGGAAGGAGGG - Intronic
1169217627 20:3802632-3802654 AGCCCGAAGGTGAGGCATGAGGG - Intronic
1169406986 20:5329977-5329999 AGGGTGAAACAGAGGCATGAAGG + Intergenic
1169691027 20:8332267-8332289 ATGCAGAAGCAGAGGCATCTGGG - Intronic
1169748250 20:8964736-8964758 AGGGAGAAACAGAGGAATGAAGG + Intronic
1170223565 20:13966284-13966306 AAGAAGAAGAAGAGGCAAGAAGG - Intronic
1171132750 20:22669157-22669179 AGGCAGAATCTGAGTCCTGAAGG + Intergenic
1171339062 20:24412899-24412921 TGGCAGAGGCAGAGGCAGAAGGG - Intergenic
1171880771 20:30616304-30616326 AGGCAGAGGCAGGTGCATGCTGG + Intergenic
1172162674 20:32879346-32879368 AGGCAGAAGCCAAGGCAGGGTGG - Intronic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1172643391 20:36455251-36455273 AGGGAGAAGCAGAGAACTGAGGG - Intronic
1173057373 20:39628493-39628515 AGGAAGAAGAGGAGACATGAAGG + Intergenic
1173350732 20:42243024-42243046 AGGCAGAGGCAGAGGCAGAAAGG + Intronic
1173617486 20:44412650-44412672 AGGCAGAAGCAGAGCCCAGGAGG + Intronic
1173897783 20:46563781-46563803 AGGCAGAAACAGAGACAAGCAGG + Intronic
1174258334 20:49275949-49275971 AGGCAGAAGGACTGGCTTGATGG - Intronic
1175231081 20:57473732-57473754 AGGCAGAAGCAGCTTCATAAAGG - Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175459573 20:59142214-59142236 ATGAAGGAGCAGAGCCATGAAGG + Intergenic
1175564565 20:59962825-59962847 TGAGAGAAGCAGAGGCATCAAGG + Intronic
1175613991 20:60377006-60377028 ATTCAGAAGCAGTGGCATGCTGG + Intergenic
1175691438 20:61068469-61068491 AGCCAGGAGCAGAGGCTTCATGG + Intergenic
1175741010 20:61419757-61419779 AGGCTTAAGCTGAGGCCTGAGGG - Intronic
1175783206 20:61696596-61696618 GGGCAGGAGCTGAGGCTTGAGGG + Intronic
1176073175 20:63237207-63237229 AGTCAGAAGCCGTGGCGTGAAGG + Intronic
1176263871 20:64198437-64198459 AGGCAGGTGCTGAGGCATCAGGG - Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178634860 21:34293277-34293299 AAGCATGTGCAGAGGCATGAAGG - Intergenic
1178830722 21:36054313-36054335 GAGCAGAAGCTTAGGCATGAAGG - Intronic
1179332359 21:40416180-40416202 GGGCAGGAGCAGAGCCTTGAAGG - Intronic
1179480875 21:41677806-41677828 AGGGAGACGCAGGGGCATAATGG + Intergenic
1180639268 22:17285080-17285102 AGGAAGCAGCTGAGGCTTGAAGG + Intergenic
1180742814 22:18065492-18065514 AGGCAGAGGCGGGGGCAGGAGGG + Intergenic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181890180 22:26055635-26055657 AGGCAAGAGGAGAGGCAGGAGGG + Intergenic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1182207312 22:28641764-28641786 AGACAGAAGCAGAGGAATGCAGG + Intronic
1182349604 22:29691940-29691962 AGGTGGAAGCAGAGCCATGGGGG + Intronic
1182395911 22:30035818-30035840 AGGCAGAAGAACTGGCAGGAGGG - Intergenic
1182786397 22:32911431-32911453 AGGCAGGAGAAGAGTCAAGATGG - Intronic
1183034824 22:35133698-35133720 AGGGAGAAGCAGAGGCTTCCTGG + Intergenic
1183831799 22:40422141-40422163 AGGCAGAGGCAGAGGCAGAGAGG + Intronic
1184089168 22:42283469-42283491 CGGCAGCAGCAGGGGCGTGAAGG - Intronic
1184343409 22:43898528-43898550 AGGCTGTAGCAGAGGCGTCATGG + Intergenic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1185077032 22:48689095-48689117 AGGCAGGTGCAGAGGCTGGAGGG - Intronic
949875405 3:8623351-8623373 AGTAAGACGCAGAGGCAGGAAGG - Intronic
950256931 3:11513341-11513363 AGGCAGAGGCTCAGGCATGGTGG + Intronic
951055945 3:18146418-18146440 AGACATAAGCACAGCCATGAGGG - Intronic
951663669 3:25098166-25098188 AAGCTGGAGCAGAGGCCTGAAGG + Intergenic
952193663 3:31049884-31049906 AGGCAGAGGGCCAGGCATGATGG - Intergenic
952647717 3:35681777-35681799 AGGCAATAGCAGAGGAAGGAGGG + Exonic
952708873 3:36408648-36408670 ATTCAGAAGCAGAAGAATGATGG - Intronic
953472657 3:43180169-43180191 AGGGAGAGGAAGAGGAATGAAGG + Intergenic
953792500 3:45959009-45959031 AGGCAGTGCCAGGGGCATGAAGG - Intronic
954731199 3:52663821-52663843 AGGCTGAAGCAGGGGGATCATGG + Intronic
954948211 3:54445190-54445212 TGGCTGAAGCAGAGCCATGGTGG - Intronic
955801659 3:62693139-62693161 GGACTGAAGCAGAGGCCTGAAGG - Intronic
955846486 3:63168709-63168731 TGGTAGAAGCAAAGGCATAAAGG + Intergenic
957577230 3:82024796-82024818 AAGCAGTACCATAGGCATGATGG - Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959690100 3:109189357-109189379 AGGCAAATGCAGAGGAATGGAGG - Intergenic
959729659 3:109586342-109586364 AGGAAGAAGGAGGGGAATGAAGG - Intergenic
961580341 3:127875697-127875719 AGGCTGAAGCACAGGGGTGAGGG - Intergenic
961725642 3:128927311-128927333 AGGCAGAAGGAAAGGAAGGAAGG + Intronic
961872131 3:129996292-129996314 AGCCACAAGGAGAGGCATGAGGG + Intergenic
962343945 3:134606399-134606421 AGGAGGAACCTGAGGCATGAAGG - Intronic
962471616 3:135714041-135714063 AGGCCAAAACAGAGGCCTGAAGG - Intergenic
964225016 3:154388636-154388658 AGGCAGGAACAGAGGCAGGCAGG + Intronic
964296497 3:155239817-155239839 TGGCAGCAGCAGTGGCATGCTGG + Intergenic
965056314 3:163721675-163721697 AGCCAGGTGCAGAGGAATGAGGG + Intergenic
965117362 3:164508454-164508476 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965521019 3:169668400-169668422 AGGCAGCAGCGGCTGCATGAAGG + Intergenic
966268106 3:178071097-178071119 AGACAGAAGCAGAGGTTAGAGGG - Intergenic
966344915 3:178968522-178968544 AGGCAGGGGCAGAGGGATGATGG + Intergenic
966441439 3:179949650-179949672 AGGCAGCAGCTGGGGCAAGAAGG - Intronic
966867159 3:184264868-184264890 ATGCCAAAGAAGAGGCATGAGGG + Intronic
966874053 3:184311635-184311657 AGGGAGTAGCAAAGGCAAGAAGG + Intronic
967170578 3:186820203-186820225 AGGCAGCAGCAGTAGCATGGTGG + Intergenic
968432981 4:569695-569717 AGGCAGAGGCAGCGGCCTGATGG - Intergenic
968555160 4:1243260-1243282 AGGAAGAAGCAGATGTGTGAAGG + Intronic
968623327 4:1614430-1614452 AGGGGGATGCAGAGACATGAGGG + Intergenic
969461388 4:7331039-7331061 TGGCAGAAGCAGAGGCCTGAGGG + Intronic
969498659 4:7540201-7540223 AGGCAGAGGCAGGGGCAGGGAGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969570806 4:8006957-8006979 AGGCGGGGGCAGAGGCCTGAGGG + Intronic
969700250 4:8764061-8764083 AGGTGGAAGCTGAGGCAAGAGGG + Intergenic
969705544 4:8789330-8789352 AGGGAGAGGCAGAGGCCTGCAGG + Intergenic
970297296 4:14643962-14643984 AGGCTGAGCCAGAGGAATGATGG + Intergenic
970852632 4:20619302-20619324 AAGCAGAAGCACATGCACGAGGG + Exonic
971177072 4:24292447-24292469 AGGCAGAAAGGCAGGCATGAGGG - Intergenic
971228904 4:24781597-24781619 ATGCAGATGCAGAGCCATCAGGG + Intergenic
971420479 4:26469633-26469655 AGGCAAAAGCAGGAGCAAGAGGG + Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
971661028 4:29415888-29415910 AGGCAAAACCAAAAGCATGAGGG + Intergenic
972371060 4:38423896-38423918 AAGCAGAAGGAGAGGCATTAGGG + Intergenic
973754900 4:54064769-54064791 GGGTAGAAGCAGAGGAAAGACGG - Intronic
973795024 4:54416386-54416408 TATCAGCAGCAGAGGCATGAGGG - Intergenic
973823559 4:54684098-54684120 ACTCAGTAGCAGAGGCAGGAAGG + Intronic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974211632 4:58784109-58784131 AGGAAGAGGCAGAGGACTGAAGG - Intergenic
975480103 4:74868800-74868822 AGCCAGAAGCAGAAACATAAAGG + Intergenic
975640025 4:76491126-76491148 AGTCAAAAGGAGAGGCAAGATGG + Intronic
975793875 4:77984790-77984812 AGGCAGAGGCAGAGGCAGAGGGG + Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
976614125 4:87058846-87058868 CGGCAGAGGCAGTGGCGTGAAGG - Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
978369698 4:108017955-108017977 AGGCAGAAGCAGAGGTCTGCTGG + Intronic
978445167 4:108773221-108773243 ATGCATAAGGAGAGGTATGAGGG - Intergenic
979441958 4:120760637-120760659 AGGAACAAACAGAAGCATGATGG + Intronic
979662282 4:123270998-123271020 ATGAAGAAGCAAAGCCATGAAGG + Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
981561048 4:146048760-146048782 AGCCACAAGCAGAGGAATGCAGG - Intergenic
981625307 4:146748005-146748027 AGGCAGATGCAGAAGCAGCAAGG - Intronic
981675421 4:147338157-147338179 AAGCAGAACCAGAGACATGCAGG + Intergenic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
982141720 4:152327763-152327785 AGGCAAAAGCTGAGGCCTGTGGG - Intronic
982750702 4:159157885-159157907 TGGCAGTGGCAGTGGCATGAAGG + Intronic
982777153 4:159453568-159453590 AGGTTGAAGAAGAGGCAGGAAGG - Intergenic
982991858 4:162286424-162286446 TGGAGGAAGCAGAGGAATGAAGG - Intergenic
983432444 4:167668781-167668803 AGGAAGGATCAGAGGCAGGATGG + Intergenic
983519069 4:168688037-168688059 AGGGAAAAGCAGATGCATCAAGG - Intronic
983579400 4:169292617-169292639 AGGCAGAAGGAAGGGCATGCAGG - Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
985750682 5:1672536-1672558 AGGCAGATGCAGATGCAAGCTGG - Intergenic
986211761 5:5680048-5680070 AGGCAGCATCAGAAGCATGAAGG - Intergenic
986438516 5:7758701-7758723 AGGCAGCAACAGAGGCATGAGGG + Intronic
986729555 5:10625070-10625092 AGACAGACACAGAGGCATCACGG + Intronic
987492090 5:18594170-18594192 CTGCAGAAGCAGAGGCCTCATGG - Intergenic
987795891 5:22626179-22626201 AGGCATAAGCATGTGCATGAAGG + Intronic
988309035 5:29533455-29533477 AGGCATAATCAGAAGAATGAAGG - Intergenic
990529277 5:56657696-56657718 AGGCAGAAGCAGGAGCAAGGAGG + Intergenic
990698262 5:58446689-58446711 AGGCACCAGCAGAGGCTTGCAGG - Intergenic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
991044230 5:62206322-62206344 AGGCAGCAGCAGTGGGTTGAGGG - Intergenic
991490764 5:67180634-67180656 AGTCAGCAGCATAGGCATGGTGG + Intergenic
991799209 5:70341547-70341569 AGGCAGAAGCAGAGTAACAAGGG - Intergenic
992358100 5:76006597-76006619 AGGCAGGAGATGAGGCAAGAAGG - Intergenic
992739806 5:79762350-79762372 AGACATGAGCAGAGGCATCAAGG + Intronic
992862182 5:80922247-80922269 AGTCAGAATCTGAGGCATGGAGG - Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
993537412 5:89103808-89103830 TGGCAGAGGAAGAGGAATGATGG + Intergenic
994745111 5:103668402-103668424 ACGCAGATGCAGAGGGTTGAAGG - Intergenic
996699590 5:126437007-126437029 AGGCAGAAGCAGTAGGATGGAGG + Intronic
996833290 5:127763794-127763816 AGGCAGAAGCAGAGGGAAAGGGG - Intergenic
996867619 5:128144624-128144646 AGGCTTAAGAAGAGGTATGAAGG - Intronic
997147080 5:131446946-131446968 AGGCACAAACACAGGCCTGATGG - Intronic
998507598 5:142684759-142684781 AGCCAGCAGCAGTGGCATCAGGG - Intronic
1000163892 5:158628450-158628472 AGACAGGAGTAGAAGCATGAAGG - Intergenic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000803961 5:165765510-165765532 AACCAGAAGCACAGGCAAGAAGG + Intergenic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002137045 5:177114076-177114098 AGGGAGAAGCAGAGGGCTCATGG - Intergenic
1002191126 5:177478197-177478219 AGGCAGTGGCAGAATCATGAGGG + Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002635531 5:180606179-180606201 AGTCAGAAGAAGACACATGATGG - Intronic
1002804650 6:561266-561288 AGGCAGAACCTGGGGCATGAAGG - Intronic
1003024677 6:2543583-2543605 AGGAACAGACAGAGGCATGAAGG - Intergenic
1003167827 6:3696853-3696875 AGCCAGCAGCAGAGCCCTGAAGG + Intergenic
1003355537 6:5366017-5366039 AGGCGGAAGGGGAGGCAGGAAGG + Intronic
1003369579 6:5511064-5511086 AGGGAGAAGGAGAGGCCAGATGG + Intronic
1004143985 6:13047683-13047705 AGTCAGCACCAGAGGCAGGAGGG - Intronic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1006102103 6:31691828-31691850 CTGCAGCAGCACAGGCATGAGGG + Exonic
1006191503 6:32212542-32212564 AGGCACAAGCAGTGGAAGGAGGG + Exonic
1006552106 6:34833017-34833039 TGGCAAAAGGAGAGGAATGAAGG - Intronic
1007176081 6:39898687-39898709 ATGCACAGACAGAGGCATGAAGG + Intronic
1007234363 6:40379642-40379664 AGGGAAAAGAAGAGGGATGAAGG - Intergenic
1007302074 6:40875083-40875105 AGCCAGAAAGAGAGGAATGAAGG - Intergenic
1007435008 6:41804420-41804442 AGGCAAAAAGAGAGGCATGCTGG - Intronic
1007778021 6:44234554-44234576 AGGAAGAGGCCGAGGCCTGAGGG + Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008717095 6:54301872-54301894 AGACAGAAACAAAGGCAGGAGGG + Intergenic
1010485665 6:76410430-76410452 AGGAAGAAGAAGAGGAAGGAAGG - Intergenic
1010750785 6:79614350-79614372 AGGAAGAGGCAGAGGCCTGGGGG + Intergenic
1011106919 6:83792316-83792338 AGCCAGCTGCAGAAGCATGAGGG + Intergenic
1011528144 6:88289372-88289394 AGGCAGAAGCAGAGGCACTTGGG - Intergenic
1011850726 6:91625102-91625124 AGACAGAAGCAGAGTAAAGAGGG - Intergenic
1012585574 6:100918138-100918160 AGGAAAAAGGAGAGGCATGCAGG + Intergenic
1013716390 6:112967884-112967906 CTGCAGAAGCAGAGCCCTGATGG - Intergenic
1013757657 6:113480408-113480430 AGGACGAAGTAAAGGCATGAGGG + Intergenic
1013990620 6:116251045-116251067 ATGCAGAAGCTGAGAAATGAGGG + Exonic
1014139708 6:117927226-117927248 AGGAAGAAGCACAAGAATGAAGG + Intronic
1015234903 6:130959446-130959468 AGGCAGAAGAAAAGGCATGAGGG + Intronic
1015248434 6:131101548-131101570 AGGCAGAAAGAGAGAAATGAAGG + Intergenic
1015638297 6:135302761-135302783 AGGCAGAAGCAGGGGGAAGAAGG + Intronic
1015955103 6:138590467-138590489 AGGAAGAACCAGAGGGAAGAGGG - Intronic
1017479689 6:154839737-154839759 AGGCGGAGGCAGAGGCAGAAGGG - Intronic
1017858766 6:158376003-158376025 AGGGAAGAGCAGGGGCATGAAGG + Intronic
1018122519 6:160649805-160649827 AGAGAGAAGCAAAGGCAGGAAGG - Intronic
1018533276 6:164791161-164791183 AGGCAGAAGCAGTGTCTTCATGG - Intergenic
1018675144 6:166214323-166214345 AGGAAGAAGAAGAGGAAAGAAGG + Intergenic
1018694153 6:166377382-166377404 AGGCAGAAGTGGAGGCAGGCAGG + Intronic
1019039820 6:169094467-169094489 AGGCAGACCCAGAGGGATGGAGG - Intergenic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019163865 6:170086698-170086720 AGGCAGAAGGGGCGGCAGGAGGG + Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019532086 7:1508705-1508727 AGTCAGAGGCAGAGGCTGGAGGG - Intergenic
1019895465 7:3979149-3979171 AGGCAGAAGCTGAGAAGTGAGGG - Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020415465 7:7940961-7940983 AGGTAGAAGCAGAAGACTGAAGG - Intronic
1020700419 7:11475035-11475057 AAACAGAAGCAAAGGCATGCAGG + Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021088226 7:16449528-16449550 AGTGAGAAGCAGAGGAAAGAAGG - Intergenic
1021153605 7:17181819-17181841 AGGAAGAAGAAGAGCAATGAAGG - Intergenic
1021194764 7:17662972-17662994 AGGGGGAAGCACAGGCATGATGG + Intergenic
1022388591 7:29924440-29924462 AGACAGCAGCAGAGGCTGGAGGG - Intronic
1022394158 7:29970749-29970771 AGCCAGGTGCAGAGGCATGGCGG - Intronic
1022489664 7:30806898-30806920 AGGCAGAAGCAGGGACATGGAGG - Intronic
1022664251 7:32395404-32395426 AGGCATCAGCAGAGGCACAAAGG + Intergenic
1023088075 7:36592326-36592348 AGGCTGTAGCAGAGGGAAGATGG + Intronic
1023088830 7:36599342-36599364 TGGCAGAATCAGATGAATGAGGG - Intronic
1024047530 7:45595371-45595393 AGGCAGAAGGAGAGGGAGAACGG - Intronic
1024746277 7:52410375-52410397 AGACTGGAGCAGAGGTATGATGG - Intergenic
1025969843 7:66312204-66312226 AGGCAGAAAGAGAAGGATGAGGG - Intronic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026152826 7:67802674-67802696 ATGCAGAAACAGAGCAATGAGGG - Intergenic
1026396129 7:69956114-69956136 AAGCAGCAGCTGAGGCATGTTGG - Intronic
1026458952 7:70596406-70596428 AGGCAGAGGCAGAGGCCGGCTGG + Intronic
1026760621 7:73123244-73123266 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1027036965 7:74932065-74932087 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1027086599 7:75269394-75269416 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1027261106 7:76465221-76465243 AGGGTGAAGCAGAGTCATGGGGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027827565 7:83135395-83135417 TGGCTGAAGGAGAGCCATGAAGG + Exonic
1029392899 7:100287397-100287419 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031387002 7:121163496-121163518 AGGCAGAAGCAGCAGCCTGTAGG - Intronic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1031907169 7:127473364-127473386 AGGAAGAAGAAAAGGAATGACGG + Intergenic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032566685 7:132954108-132954130 AGGCAGAGGGACAGGCAGGAGGG + Intronic
1032878455 7:136063321-136063343 ACGCAGAAGCAGAGGCTTGTAGG + Intergenic
1033056594 7:138060554-138060576 AGGAAGAAGCAGCTGCAGGATGG - Intronic
1033156931 7:138965091-138965113 AGGCAGGAGCAGAGGAATTACGG + Intronic
1033157199 7:138967291-138967313 AAGCAGGAGCAGAGGAATTACGG + Intronic
1033399423 7:141007732-141007754 AGGTTTAAGCAGAGGCTTGAAGG - Intronic
1033597292 7:142866849-142866871 GGGCAGAAGCAGGGGCAAGAGGG + Intronic
1034315823 7:150132046-150132068 AGGAATACACAGAGGCATGAGGG + Intergenic
1034413263 7:150952252-150952274 AGGCAGCTGCAGAGGCAAGGTGG - Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1035032214 7:155868870-155868892 TGGCAGAAGGAGAGCCAGGAGGG + Intergenic
1035162065 7:156958462-156958484 AGGCGGAAGCAGGGACATGGTGG - Intronic
1035457442 7:159017930-159017952 GGACAGAAGCCGAGACATGATGG - Intergenic
1035955177 8:4069626-4069648 AGGAAGCTGCAGAGGCTTGAGGG - Intronic
1036708445 8:11061796-11061818 GGGCTGAAGAAGAGGCAGGAGGG + Intronic
1037053796 8:14410217-14410239 AGGCAGAAGGAAAGGGAGGAGGG - Intronic
1037565170 8:20112039-20112061 AGGCAAAAGCAGTGGCAGGCAGG + Intergenic
1038410395 8:27354048-27354070 AGACAGAAGCAGAGGCAGAGGGG - Intronic
1039020656 8:33201963-33201985 AAGCAGGAGGAAAGGCATGAAGG + Intergenic
1039091599 8:33835539-33835561 AGGCTGAAGGAGAGGCAGGAAGG + Intergenic
1039307563 8:36279186-36279208 AGGAACACCCAGAGGCATGAGGG + Intergenic
1039317330 8:36387888-36387910 AGGAAGAAGAAGAGGAAAGAAGG - Intergenic
1039434151 8:37548187-37548209 AGGCACCAACAGAGGCTTGATGG + Intergenic
1039706034 8:40008382-40008404 AGGCAGAAGGAGAGGTGAGAAGG - Intronic
1039744964 8:40416571-40416593 AGTGAGAATCAGAGGAATGATGG - Intergenic
1039835209 8:41250329-41250351 AGGCAGAAGGGGAGAAATGAAGG + Intergenic
1040063830 8:43128024-43128046 AGGCACCAGTAGTGGCATGAGGG + Intergenic
1041279685 8:56197726-56197748 AGACAGACACAGATGCATGAGGG - Intronic
1043423364 8:80123204-80123226 GGCCAAAAGCAGAGGCAGGAGGG + Intronic
1043637007 8:82398146-82398168 AGGCAAAAGCAGAGGCCTTGTGG - Intergenic
1044549093 8:93492531-93492553 AGGCATGATCAGAGGCATGCTGG - Intergenic
1044893421 8:96862053-96862075 TGGCATAAGCAAAGCCATGAAGG + Intronic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1046138313 8:110060110-110060132 AGGCAAAAGCAGAGGCCAGCAGG + Intergenic
1046865958 8:119150741-119150763 AAACAAAAGCAGAGGCATCAGGG - Intergenic
1046906069 8:119574341-119574363 TTGCAGAAGCAGAGGCTTGCAGG - Intronic
1047539847 8:125754184-125754206 AGCCAGAGGAAGAGGCAGGAGGG - Intergenic
1047601026 8:126426018-126426040 AGGCAGCAGGAGAGGCCTCAAGG + Intergenic
1048141414 8:131798266-131798288 AGGCAGAAGGAGATGGATGCTGG + Intergenic
1048363499 8:133718114-133718136 TGGCAGAATCAGGGCCATGAAGG + Intergenic
1048387466 8:133925793-133925815 AGGCAGGATCAGAGTCCTGAAGG - Intergenic
1049268577 8:141682407-141682429 GGGCAGGGGCAGAGGCATGCCGG - Intergenic
1049397266 8:142406805-142406827 ACGCAGAGGCAGTGTCATGAGGG + Intergenic
1049887674 9:38993-39015 AGGCAGCAGGGGAGGGATGAAGG - Intergenic
1050038534 9:1463111-1463133 GGGAAGGAGAAGAGGCATGAAGG - Intergenic
1050072877 9:1834714-1834736 ATGCAAAAGCCTAGGCATGAGGG - Intergenic
1050192847 9:3046585-3046607 AGGCAGATGCAGAGGCCAGGTGG - Intergenic
1050951762 9:11605358-11605380 AAGCAGAAGCAGAGATAAGATGG - Intergenic
1051520929 9:17987189-17987211 TGGCAGTAGCAGATGCATCAGGG + Intergenic
1051606434 9:18922096-18922118 AGGCAGAGGCATAGGCAGGCAGG + Intergenic
1051961836 9:22774998-22775020 AGGCTGAAGTAGAGGCAAAAAGG + Intergenic
1052980685 9:34446617-34446639 AGGGAGAACCAGAGCCATGGTGG - Intronic
1053297100 9:36922933-36922955 AGGCAGAATCTGAGTCAAGAAGG - Intronic
1055269741 9:74544567-74544589 AGGGAGAAGAATAGGCAAGAAGG - Intronic
1055606767 9:77978427-77978449 AGGCAGGAAAAGAGGCAGGAGGG - Intronic
1056965628 9:91161121-91161143 TGGCAGGCGCAGAGGCAGGAAGG - Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057795208 9:98151054-98151076 GGGCACAAGCAAAGGCATGGAGG - Intronic
1058088343 9:100775570-100775592 AGGCAGTACCATAGACATGAAGG - Intergenic
1058578655 9:106430971-106430993 AGGTATAAGCAGAGGCCTGGAGG + Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1060066352 9:120504503-120504525 AGGCAGAGGCAGTGGGATGCGGG - Intronic
1060437613 9:123607870-123607892 AGGCAGGAGGAGAGGCAAGCGGG + Intronic
1060724807 9:125999682-125999704 AGGCAGAAACTGAGGCCTGTGGG + Intergenic
1061144198 9:128787567-128787589 AGGCAGAAGCAGTGACATCAGGG - Intronic
1061334620 9:129923963-129923985 AGGGTGAGGCAGAGGCAGGAGGG + Exonic
1061633952 9:131893679-131893701 AGGAAAAAGCAGAAGCTTGATGG + Intronic
1061938693 9:133872564-133872586 AGCCTGGAGCAGAGGCAGGAAGG + Intronic
1062046723 9:134427769-134427791 AGGGGGAAACTGAGGCATGAGGG - Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062112436 9:134789411-134789433 AGGAAGGGGCAGAGGCAGGAAGG + Intronic
1062173634 9:135148918-135148940 GGGCAGGAGCTGAGGAATGAAGG + Intergenic
1062524471 9:136972670-136972692 AGGGAGAAGCAGAGACCTGCAGG - Intergenic
1062640398 9:137515657-137515679 CGGCAGATGCAGAGGCCTGGTGG - Intronic
1062665748 9:137670555-137670577 AGGCAGAAGCACCTGCAAGAAGG - Intronic
1185463150 X:341518-341540 AGGCAGGAGGAGGGGCAGGAGGG - Intronic
1185772190 X:2773278-2773300 AGGAAGAAGGAGAGGAATGAAGG + Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1187740551 X:22350774-22350796 AGGCAGAAGGTGAGGCACAATGG - Intergenic
1187880689 X:23844490-23844512 AGGCAGAAGAAGAGGTCAGAAGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189667224 X:43369043-43369065 AGGCAGAAGGAAAAGCATAAAGG + Intergenic
1190158863 X:48016258-48016280 AGGGAGAGGGAGAGGGATGAGGG - Intronic
1190174560 X:48138529-48138551 AGGGAGAGGGAGAGGGATGAGGG - Intergenic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1194321371 X:92450280-92450302 AGTCAGAATCAGAGGTAAGATGG + Intronic
1197798905 X:130328615-130328637 TGGCTGGAGCAGAGCCATGAAGG - Intergenic
1197974384 X:132150615-132150637 AGACAGAAGGAGAGGCGAGATGG + Intergenic
1198000824 X:132433787-132433809 TGGCTGGAGCAGAGCCATGAAGG - Intronic
1198328424 X:135597358-135597380 AAGCAGTAGGAGAGGAATGATGG - Intergenic
1198338035 X:135687697-135687719 AAGCAGAAGGAGAGGAATGATGG + Intergenic
1198421357 X:136473042-136473064 AGGAAGAAGGGGAGGAATGAAGG + Intergenic
1198880719 X:141278170-141278192 AGGAATAAGCAAAGGCCTGATGG + Intergenic
1199419610 X:147629757-147629779 AGGGAGAAACTGAGGCCTGAAGG + Intergenic
1199659648 X:150036109-150036131 AGGCAGAACAAGAGACATCAAGG + Intergenic
1200129101 X:153831245-153831267 AGGAAGGAGCAGAGGCGTGAGGG - Intergenic
1200629541 Y:5563752-5563774 AGTCAGAATCAGAGGTAAGATGG + Intronic