ID: 1184380580

View in Genome Browser
Species Human (GRCh38)
Location 22:44142855-44142877
Sequence CTGCGTCAGCAGAAGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 299}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184380580_1184380582 -6 Left 1184380580 22:44142855-44142877 CCTTGCTGCTTCTGCTGACGCAG 0: 1
1: 1
2: 4
3: 25
4: 299
Right 1184380582 22:44142872-44142894 ACGCAGGTTCCGAAGTCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 36
1184380580_1184380586 17 Left 1184380580 22:44142855-44142877 CCTTGCTGCTTCTGCTGACGCAG 0: 1
1: 1
2: 4
3: 25
4: 299
Right 1184380586 22:44142895-44142917 TTACCCAGCCTGGCACCCTCAGG No data
1184380580_1184380590 26 Left 1184380580 22:44142855-44142877 CCTTGCTGCTTCTGCTGACGCAG 0: 1
1: 1
2: 4
3: 25
4: 299
Right 1184380590 22:44142904-44142926 CTGGCACCCTCAGGCACAGCAGG 0: 1
1: 1
2: 1
3: 43
4: 390
1184380580_1184380591 27 Left 1184380580 22:44142855-44142877 CCTTGCTGCTTCTGCTGACGCAG 0: 1
1: 1
2: 4
3: 25
4: 299
Right 1184380591 22:44142905-44142927 TGGCACCCTCAGGCACAGCAGGG 0: 1
1: 0
2: 4
3: 16
4: 266
1184380580_1184380584 7 Left 1184380580 22:44142855-44142877 CCTTGCTGCTTCTGCTGACGCAG 0: 1
1: 1
2: 4
3: 25
4: 299
Right 1184380584 22:44142885-44142907 AGTCTCCTGGTTACCCAGCCTGG 0: 1
1: 0
2: 2
3: 37
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184380580 Original CRISPR CTGCGTCAGCAGAAGCAGCA AGG (reversed) Intronic
900373457 1:2342744-2342766 CTCCCTCAGCAGAGCCAGCATGG + Intronic
900777214 1:4594208-4594230 CTGCCTCAGTGGGAGCAGCAGGG - Intergenic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901390971 1:8945894-8945916 CAGGGACAGCAGAAGCACCAGGG - Exonic
901401038 1:9015184-9015206 CAGGGTCAGCAGCTGCAGCAGGG + Exonic
902885686 1:19403160-19403182 CTGCCTAAGCTGAAGCACCAGGG - Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904681395 1:32231920-32231942 CTGAGCCTGCAGAAGCTGCATGG - Intergenic
904966322 1:34377316-34377338 CTGCCTCACCAGAAACAGCCAGG - Intergenic
905049429 1:35037114-35037136 CAGCGTAAGCAGAAGCCCCAAGG - Intergenic
905369710 1:37476565-37476587 CTGACTCAGCTGAAGCAGCCTGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905756504 1:40514570-40514592 CAGTGTCAGCAGAAGCCTCAGGG + Exonic
906387082 1:45379276-45379298 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
906692101 1:47799308-47799330 CTCCCTCAGCAGATGAAGCAGGG + Intronic
907843383 1:58178467-58178489 TTGCTTCAGCAGATGCAGAAGGG + Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909379294 1:74979649-74979671 CATCTTCAGTAGAAGCAGCAAGG + Intergenic
910179328 1:84463973-84463995 ATGCCTCATCAGAGGCAGCATGG + Intergenic
912499531 1:110112860-110112882 CTGCCTTAGCAGCTGCAGCACGG - Exonic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
914377023 1:147080598-147080620 CTGTGCCAAGAGAAGCAGCAAGG - Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914474712 1:148013700-148013722 CTGTGCCAAGAGAAGCAGCAAGG + Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915748496 1:158182988-158183010 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915755647 1:158256896-158256918 CGGGGTGAGCAGGAGCAGCAGGG + Exonic
915762525 1:158329516-158329538 CGGGGTGAGCAGGAGCAGCAGGG - Exonic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917038578 1:170777305-170777327 TTGCTGCAGAAGAAGCAGCATGG + Intergenic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
1062884268 10:1004616-1004638 CTGCTTCAGCTCAGGCAGCAGGG + Intronic
1064322904 10:14322230-14322252 CTGAGGCAGCAGAAGCAGCATGG + Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066005130 10:31140035-31140057 CTGTCTCATGAGAAGCAGCAAGG - Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1068920527 10:62478522-62478544 CTGCTTCAGCTCAAGCAGGAAGG + Intronic
1069091470 10:64204518-64204540 TAGGGTCAGCAGCAGCAGCAGGG - Intergenic
1069893983 10:71669137-71669159 CTCCCTCAGCAGAACCATCAGGG - Intronic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1073207692 10:101777235-101777257 CTGCTCCCACAGAAGCAGCATGG - Intronic
1073560628 10:104493481-104493503 CTAGGACAGCAGTAGCAGCAGGG + Intergenic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075200254 10:120396384-120396406 CTTCACCAGCAGCAGCAGCATGG - Intergenic
1076070627 10:127485431-127485453 CAGCGTGAGCAAGAGCAGCAGGG - Intergenic
1076618094 10:131770210-131770232 CTGCGTCAGCAATAACAGAAGGG - Intergenic
1076895882 10:133311718-133311740 CAGCCTCAGCAGAAGCCCCAGGG + Exonic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077359114 11:2132857-2132879 CTGGGTCAGGAGAAGCCCCAGGG + Exonic
1078058028 11:8023180-8023202 GTGAGACAGCAGAAGCTGCAGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1079196592 11:18333117-18333139 GTGCGTCAAAAGAAGCAGGATGG + Exonic
1079250458 11:18783226-18783248 CTGCCTCATGATAAGCAGCAAGG + Intronic
1081023968 11:37985034-37985056 CTGTGTCAGAAGATGCAACATGG - Intergenic
1082067100 11:47909901-47909923 CTGAGTAAGCAGAAGCCACAAGG - Intergenic
1085139841 11:74129973-74129995 CTGAGGCAGGAGAATCAGCAGGG + Intronic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1088172837 11:107017848-107017870 CGGCGGCGGCAGAAGCAGCCGGG + Exonic
1090171943 11:124613060-124613082 CTGCTTCACCATAAGCAGGACGG + Exonic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092197085 12:6555977-6555999 CTCCTGCAGCAGGAGCAGCAGGG - Exonic
1093138250 12:15477595-15477617 CTGGGTTAGCTGTAGCAGCAAGG + Intronic
1093329144 12:17813840-17813862 CTGCGTTTGCGGAACCAGCAGGG + Intergenic
1094166252 12:27446870-27446892 CAGCATCAGCAAAAGCATCAGGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097422928 12:59403190-59403212 CAACGTCAGCAAAAGCAGAAAGG - Intergenic
1097523795 12:60704202-60704224 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
1098127515 12:67315336-67315358 CTGCCTCAGCTGTAGCAGCTAGG - Exonic
1102322367 12:111948217-111948239 CTCCCTCAACAGGAGCAGCAAGG - Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1102485648 12:113253785-113253807 CTGTGTGTGGAGAAGCAGCAAGG + Intronic
1103606040 12:122086908-122086930 CGGCGGCAGCACAAGAAGCAGGG - Intronic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107596573 13:41969223-41969245 CTGCCCCAGCTGAAGCAGCCAGG + Intergenic
1108057004 13:46495072-46495094 CTGCCCCAGCAGAAGTAGCAAGG - Intergenic
1109274628 13:60290254-60290276 CAGCGTCAGCAGCAGCAACCAGG - Intergenic
1109837360 13:67877388-67877410 CTGAGTCTGCAGCAGCAGCTGGG - Intergenic
1114664886 14:24371797-24371819 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1118315692 14:64724693-64724715 TTGCTTCAGCATAAGCTGCAGGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119459244 14:74785430-74785452 CTGAGTGAGCAAAAGCAGCAGGG - Intronic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122608774 14:102966746-102966768 AAGCGGCTGCAGAAGCAGCAGGG - Intronic
1123490483 15:20775957-20775979 CTGCGCCAGCAGGGCCAGCATGG + Intergenic
1123546984 15:21345044-21345066 CTGCGCCAGCAGGGCCAGCATGG + Intergenic
1124016481 15:25880701-25880723 CTGCCTCACCAGAAACAGAATGG + Intergenic
1124464107 15:29920711-29920733 CTTGCTCAGCAGGAGCAGCAGGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126112016 15:45180972-45180994 CTGTGTCACCAGAAGCTGCTTGG + Intronic
1126317141 15:47382392-47382414 CTGCCTCAGCAGCAGTAGCTGGG - Intronic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1129395751 15:75245090-75245112 CTGGATCATCAGCAGCAGCACGG + Intergenic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1131250167 15:90825277-90825299 CTGCGTCATCACAGACAGCAAGG + Intergenic
1131862669 15:96670717-96670739 CGGCGTTAGCAGAAACAGGAAGG - Intergenic
1132223007 15:100118823-100118845 GTGAGGCAGCAGATGCAGCATGG + Intronic
1132332296 15:101021204-101021226 CTGGGCCAGCAGAGCCAGCACGG - Intronic
1202955315 15_KI270727v1_random:72260-72282 CTGCGCCAGCAGGGCCAGCATGG + Intergenic
1132997415 16:2830440-2830462 AAGCGTGAGCAGCAGCAGCATGG - Exonic
1133055774 16:3144809-3144831 CTTCGTCAGCAGCTGCACCAGGG - Exonic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1134030045 16:10984764-10984786 CTGAGTCAGCAGAATCAGCAGGG + Intronic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134586128 16:15412686-15412708 CTGCCTCAGCCCAAGTAGCAGGG + Intronic
1135883743 16:26284790-26284812 CTCAGTCAGTAGAAGCTGCAAGG - Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136858733 16:33681815-33681837 CAGCATCAGAAGGAGCAGCAAGG + Intergenic
1137598215 16:49738728-49738750 CGGGGTCAGCAGGACCAGCAAGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139877285 16:70156502-70156524 CTCCTGCAGCAGAAGCAGAATGG + Exonic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141462762 16:84187469-84187491 GTGCGTCAGCAGTAGCACCTGGG + Intergenic
1203120307 16_KI270728v1_random:1530308-1530330 CAGCATCAGAAGGAGCAGCAAGG + Intergenic
1142540551 17:655401-655423 CTGCTGAGGCAGAAGCAGCAGGG + Intronic
1143337038 17:6179114-6179136 CTACGTCAGCAGAAACTGGAAGG - Intergenic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1146464182 17:33073376-33073398 CTGCGAGCTCAGAAGCAGCATGG + Intronic
1147677748 17:42219416-42219438 CTGCTTCCGCAGCAGCTGCAGGG + Exonic
1147688288 17:42300155-42300177 CTGCTTCCGCAGCAGCTGCAGGG - Exonic
1148602408 17:48904384-48904406 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1151393636 17:73804526-73804548 CTGCGTCAGCAGCAGGGGCCAGG - Intergenic
1152495593 17:80669120-80669142 CTGGCTCAGCAGGAGCAGCCAGG + Intronic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1156563702 18:38159367-38159389 CTGTGGCAGCAGAATCATCAGGG - Intergenic
1157610073 18:48950528-48950550 AGGCGACAGCAGCAGCAGCAGGG + Exonic
1158745648 18:60196596-60196618 GTGCGTCAAAAGAAGCAGGATGG + Intergenic
1159120533 18:64163997-64164019 CTACATCAGCAGTAGCAGGAAGG + Intergenic
1160590685 18:79943384-79943406 CAGCTTCAGCATCAGCAGCATGG + Exonic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161552901 19:4923930-4923952 CTGGGTCAGGAAAAGCAGCATGG - Intronic
1162098414 19:8324660-8324682 CTGGGTGAGCAGCAGCCGCACGG + Exonic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164865777 19:31603113-31603135 ATCCGTCAGCAGACCCAGCATGG - Intergenic
1165487646 19:36105051-36105073 CTAAGTCCTCAGAAGCAGCAGGG - Exonic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1168110054 19:54187164-54187186 CAGCGTCAGCAGCAGCTGGACGG + Exonic
1168322609 19:55518835-55518857 CTGCGTCAGCCCCAGCAGCAGGG - Exonic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926688145 2:15714365-15714387 CTCCCTCAGCAGAGGCAGCCTGG - Intronic
928115856 2:28544800-28544822 ATGCGTCAGATGCAGCAGCAAGG + Intronic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
930739282 2:54813486-54813508 CTGTGCCAGAAGAACCAGCAAGG - Intronic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932186833 2:69704550-69704572 CTGTGTCAGCTGGAGCAACAGGG + Intronic
932486004 2:72084765-72084787 CTGCCGCACCAGGAGCAGCAAGG + Intergenic
936076480 2:109404791-109404813 CTGGGTCAGCTTCAGCAGCAGGG - Intronic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
940228145 2:151421945-151421967 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
940523508 2:154782168-154782190 ATGCGTCAGAAGAAGAATCAGGG + Intronic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942849872 2:180471918-180471940 CTGTGTCACCTGAAGCACCAGGG + Intergenic
943485939 2:188481543-188481565 GTCTGTCAGCAGAAGCAGCTTGG + Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
948199752 2:236121054-236121076 CTGCCTCAGCAGAAGCCCCAGGG - Intronic
948433164 2:237933619-237933641 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
1168906515 20:1408262-1408284 CCGCTTCATCAGAACCAGCAAGG + Intergenic
1169118586 20:3082681-3082703 CTGCACCAGCCGCAGCAGCAAGG + Exonic
1171343793 20:24450768-24450790 TTGCTTCAGCAGAAGCTACATGG - Intergenic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1173033910 20:39390374-39390396 CTGCCTAAGCAGAAGCAGATTGG - Intergenic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175518519 20:59584721-59584743 TTCCGTCAGAAGGAGCAGCACGG - Intronic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177590262 21:23154857-23154879 CTGAATCAGAAGAGGCAGCAGGG + Intergenic
1178319994 21:31597904-31597926 CGGCGGCAGCAGCAGCTGCAAGG + Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1180008456 21:45034152-45034174 TGGCATCAGCAGAACCAGCATGG - Intergenic
1180195737 21:46192403-46192425 CTGCTTGAGCAGGAGCAGCAGGG - Intronic
1180601694 22:17024055-17024077 CTGCGTCTGCACCATCAGCATGG + Intergenic
1180614844 22:17120495-17120517 CTGCGCCAGCAGCAGCACCACGG + Exonic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1183062567 22:35345231-35345253 CTGCGTCTGCAGAGACACCAGGG + Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184102330 22:42347407-42347429 CTGCTCCAGCAGATGCAGCCTGG + Intergenic
1184198488 22:42948078-42948100 ATTCTTCAGCAGGAGCAGCAAGG + Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
1184595029 22:45508682-45508704 CTGCCTCTGCAGAGGCTGCATGG + Intronic
1184726149 22:46347805-46347827 CTGACCCAGCAGAAGCAGCAGGG - Intronic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
1185323991 22:50216699-50216721 CTGCGCCAGCATCAGCATCATGG - Exonic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
952122769 3:30264363-30264385 CTGCTCCAGTAGAGGCAGCAGGG - Intergenic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
953392980 3:42544638-42544660 CTGCCTCTGCAGAAGCAGCCTGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
955343482 3:58143619-58143641 CTGAGTCAGCAGGCCCAGCAGGG + Intronic
958636492 3:96753303-96753325 CTGCAACAGCAGCAGCGGCAAGG + Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
960618271 3:119615696-119615718 CTGCCTCAGCAGGAGTAGCTGGG - Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961980800 3:131075962-131075984 ATGTGTCATCAGAAACAGCATGG - Intronic
962266678 3:133948942-133948964 CTGCCACAGCAGATGAAGCAAGG - Exonic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964051872 3:152403740-152403762 CTGCAACAGCATAAGCAGTAAGG - Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
968111831 3:196054607-196054629 CTGCCTCAGCAGAAGTAGCTGGG + Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
969310079 4:6347903-6347925 CTTCGTCTACAGCAGCAGCAAGG - Exonic
969364575 4:6686678-6686700 CTGGGTCAGCACATGCAGGAAGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
972025686 4:34373857-34373879 CTGTATCTGCAAAAGCAGCATGG - Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
979267900 4:118724939-118724961 CTGCTTCACCAGCTGCAGCAGGG + Intronic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980768511 4:137340105-137340127 CTGAGTCAGCCAAAGCTGCAAGG + Intergenic
980915965 4:139033557-139033579 CTGCCTCAGCCTAAGCAGCTGGG - Intronic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981641362 4:146946945-146946967 CTAAGTCAGAAAAAGCAGCAAGG - Intergenic
981796484 4:148600890-148600912 CTGCTCCAGCAGAGGCAGTAGGG + Intergenic
985077399 4:186229823-186229845 CTGGTTCAGCAGAAGAATCAGGG - Intronic
987809719 5:22819160-22819182 CTGCGTCAGCAATAGCAGCAGGG - Intronic
991073307 5:62510846-62510868 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997801374 5:136865951-136865973 CTCCATCACCAGAATCAGCATGG - Intergenic
999141886 5:149367821-149367843 ATGCGGCTGCAGAAGAAGCAAGG - Intronic
1000004559 5:157170962-157170984 CTCAGTCAGAGGAAGCAGCAAGG + Intronic
1002104976 5:176875537-176875559 CCGTGTCAGGAGAGGCAGCAAGG - Intronic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1006899009 6:37488140-37488162 CTGCTTCAGCAAATGCTGCAGGG - Intronic
1007409385 6:41653216-41653238 CTGCGGCAGCGGCAGCAGCAGGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007836320 6:44676691-44676713 CTGAGTCTGCAGAGGCAGGAGGG + Intergenic
1008557933 6:52693443-52693465 ATGCATCACCAGTAGCAGCATGG - Intergenic
1008857770 6:56112513-56112535 CTTCCCCAGCAGAGGCAGCATGG + Intronic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015935307 6:138402661-138402683 CTGCCTCAGAAGAAGAGGCAGGG - Intergenic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1016873236 6:148839272-148839294 CTGAGTCAGCATAATCAGGAAGG + Intronic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018659509 6:166073278-166073300 CTGCGTGAGTGGGAGCAGCAGGG - Intergenic
1018809248 6:167285594-167285616 CTGAGACAGCAGCAGCTGCAGGG - Intronic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019526737 7:1483755-1483777 CAGCGTCAGCAGGATCACCATGG + Exonic
1019593948 7:1849802-1849824 CAGCGGCAGCGGAAGCAGGACGG + Exonic
1019674890 7:2305026-2305048 CGGCGTCTGCAGGAACAGCAAGG - Intronic
1020041363 7:5005125-5005147 CTGTGTCAGCTGGAGCAACAGGG + Intronic
1021367847 7:19803481-19803503 CTTAGTCAACAGAAGCACCAAGG - Intergenic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1025091297 7:56066282-56066304 GTGCATCAGCTGAAGCAGTATGG + Intronic
1025704847 7:63853906-63853928 CTGCCTCAGCAGGAGTAGCTGGG - Intergenic
1028122471 7:87071641-87071663 TTAAGTCAACAGAAGCAGCATGG + Intergenic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1031137576 7:117901595-117901617 CTGTGACAGCACAAGGAGCAAGG + Intergenic
1031192830 7:118576563-118576585 TTGCATCAGTAGTAGCAGCATGG + Intergenic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034539645 7:151748793-151748815 CTCCGTCATCAGCAGCGGCAAGG + Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035819049 8:2571928-2571950 CTGAGTCCGCAGATGCAGAAGGG - Intergenic
1036710292 8:11074200-11074222 CTGCTCCAGCAGGAGCAGAAAGG + Intronic
1038796060 8:30710602-30710624 CTGCCTCAGCACAAGTAGCTGGG - Intronic
1039373924 8:37014308-37014330 ATCCTTCAGCAGAAGGAGCATGG - Intergenic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041746331 8:61212398-61212420 ATGCCTCAGCAGATGCAGCGGGG + Intronic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1043745480 8:83869206-83869228 CTGGGTCTCCAGCAGCAGCAGGG - Intergenic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1048164779 8:132052944-132052966 ATGATTCAGCAGAGGCAGCAGGG - Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048459541 8:134610203-134610225 CTACTCCAGCAGGAGCAGCACGG + Intronic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1049194584 8:141308338-141308360 CTGCGTCAGCGGAAGCGGCGCGG - Intergenic
1049823871 8:144654704-144654726 CTGGGTCTGCAGCAGCAGCTTGG - Intergenic
1053371317 9:37564088-37564110 CTGCTGCAGCTGAAGCAGCTGGG - Intronic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1057642220 9:96835571-96835593 CTGTTTCAGCTGAAGCAGCTAGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1059875269 9:118627821-118627843 CTGAGTCAGGAGCAGCAGCTGGG - Intergenic
1060933688 9:127504179-127504201 CAGCGTCCGCAGAAGCAGGCAGG + Intergenic
1061392713 9:130326785-130326807 CTTCGTCGGCAGAAACAGCATGG - Intronic
1061667076 9:132166830-132166852 GAGCGCCAGCAGATGCAGCATGG - Exonic
1062434873 9:136542504-136542526 CTCCCTCTGCAGAAGCCGCACGG - Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1187446931 X:19368671-19368693 CTGCCCCTGCAGAAGTAGCAGGG - Intronic
1189567254 X:42255402-42255424 CTGCTTCAGTGGAGGCAGCAGGG - Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190635042 X:52425017-52425039 CTGCAGCAGCAGTAACAGCAAGG + Intergenic
1192321659 X:70095020-70095042 CTGCTTTTGCAGAAACAGCAAGG + Intergenic
1192451681 X:71248768-71248790 CTGCGGCGGCAGAAGCTGCAGGG + Exonic
1193584713 X:83306787-83306809 CTATGTCACCAGAAGCAGAATGG + Intergenic
1194195222 X:90883696-90883718 CTACACCAGCAGAAGCTGCAAGG + Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1200134394 X:153867855-153867877 CTGCGTCAGCAGGTGCAGGTCGG + Exonic
1200167264 X:154045364-154045386 CTGCCACAGGGGAAGCAGCAGGG + Intronic