ID: 1184381052

View in Genome Browser
Species Human (GRCh38)
Location 22:44145179-44145201
Sequence TTAGTTCCACACCAAGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184381046_1184381052 7 Left 1184381046 22:44145149-44145171 CCATGCTCCTGCCTCTACTCACT 0: 1
1: 1
2: 5
3: 46
4: 600
Right 1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1184381043_1184381052 29 Left 1184381043 22:44145127-44145149 CCGACAATGCTCCTGCCAGGCTC 0: 1
1: 0
2: 2
3: 27
4: 194
Right 1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1184381044_1184381052 18 Left 1184381044 22:44145138-44145160 CCTGCCAGGCTCCATGCTCCTGC No data
Right 1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1184381045_1184381052 14 Left 1184381045 22:44145142-44145164 CCAGGCTCCATGCTCCTGCCTCT 0: 1
1: 1
2: 3
3: 97
4: 869
Right 1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1184381048_1184381052 -4 Left 1184381048 22:44145160-44145182 CCTCTACTCACTGCCCCACTTAG 0: 1
1: 0
2: 1
3: 19
4: 358
Right 1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1184381047_1184381052 0 Left 1184381047 22:44145156-44145178 CCTGCCTCTACTCACTGCCCCAC 0: 1
1: 0
2: 3
3: 50
4: 498
Right 1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184381052 Original CRISPR TTAGTTCCACACCAAGAGCG AGG Intronic
902265032 1:15257236-15257258 TCAGTTCCCCACCAACAGTGAGG + Intronic
903030689 1:20462278-20462300 TTAGTTCCCCACCCAAAGCTGGG - Intergenic
904094894 1:27968950-27968972 TTAGTTCCAGGCCAACAGAGTGG - Intergenic
910898563 1:92094818-92094840 TTAGTTTAACATCAAGAGCTGGG + Intronic
917310570 1:173673863-173673885 TTAGTTACACACCAGGGGAGTGG - Intergenic
919482735 1:198109380-198109402 TTAGAACCACACCAACAGCAAGG - Intergenic
923624870 1:235605836-235605858 TGAGTGCCACACTAAGAGTGTGG + Intronic
1066319834 10:34291063-34291085 TTAGTTCTGCACCAAGAATGTGG - Intronic
1066716757 10:38295028-38295050 TTATTTCCAAACAAAGAGCCAGG - Intergenic
1072757930 10:98032727-98032749 TTATTTCCACATTAAGAGGGTGG - Intergenic
1074764713 10:116692127-116692149 TCAGTCCCACAACAAGAGCTGGG - Intronic
1086641264 11:89159568-89159590 TTCGTTCCTCTCCAAGAGTGCGG + Intergenic
1087445745 11:98250374-98250396 TTAGTTACATACAAAGAGCAGGG - Intergenic
1087866993 11:103241991-103242013 TCAGTGGCACACCAAGAGGGAGG - Intronic
1090188521 11:124753365-124753387 TTAGCTACTCACCAAGAGTGAGG - Exonic
1094142355 12:27194197-27194219 TTAGCTCCATACCAGGAGCCAGG - Intergenic
1097494268 12:60310432-60310454 TTAGTTGCACACTGAGAGTGTGG - Intergenic
1098862150 12:75722222-75722244 TTAGGTCCACAGCAATATCGAGG + Intergenic
1106966444 13:35076630-35076652 TTTTTTCCACAGCAAGAGAGAGG - Intronic
1117495103 14:56294817-56294839 TAAGTTCAACAGCAAGAGCCAGG - Intronic
1118039269 14:61899905-61899927 TTAGATCAACACCAAGAAAGGGG - Intergenic
1119218749 14:72889621-72889643 TGAGTGCCACAGCAAGAGTGAGG + Intronic
1122172543 14:99889070-99889092 TTAGTTCCAGGCCCTGAGCGTGG - Intronic
1125543509 15:40486531-40486553 TGAGCCCCACACCAAGCGCGGGG + Intergenic
1130843900 15:87726382-87726404 AAATTTCCACACCAAGAGCCTGG + Intergenic
1136770735 16:32838299-32838321 ATACTTCCAATCCAAGAGCGTGG + Intergenic
1139832297 16:69809937-69809959 ATTGTTCCACACCAAGAGCAAGG - Intronic
1203073156 16_KI270728v1_random:1100408-1100430 ATACTTCCAACCCAAGAGCGTGG + Intergenic
1165805915 19:38580441-38580463 CAAGTTCTACAACAAGAGCGAGG + Exonic
1166861983 19:45816272-45816294 TGAGTTCTTCACCAAGAGCATGG + Intronic
927600465 2:24435973-24435995 TTAGCTCCACTCCCAGAGCCCGG + Intergenic
937488894 2:122344969-122344991 ATATGTCCACACCAAGAGCTAGG - Intergenic
938369580 2:130760887-130760909 TTGGATCTACACCAACAGCGTGG - Intronic
942635458 2:177999352-177999374 TTATTTCCAAACCCAGAGTGAGG - Intronic
945165353 2:206937464-206937486 TCAGTTCCACAGAAAGAGAGGGG - Intergenic
946763597 2:223019913-223019935 TCTGTTCCTCACCAAGAGTGTGG + Intergenic
949030748 2:241796105-241796127 TTTCTTCCACACCAAGGGTGTGG - Intronic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1179551798 21:42147995-42148017 TTTGTTCAACACAAAGAGCCTGG - Intergenic
1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG + Intronic
1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
958504069 3:94950750-94950772 TTAGTTCCACCCCAAAAGACAGG + Intergenic
964824665 3:160811947-160811969 TCAGTGCCACACCAAGTGCCTGG - Intronic
981167355 4:141576994-141577016 GTTGTTCCACACAAAGAGCAAGG - Intergenic
981360109 4:143836410-143836432 TTTGTTCCACACCAACATCTGGG - Intergenic
981370881 4:143957478-143957500 TTTGTTCCACACCAACATCTGGG - Intergenic
983614800 4:169690916-169690938 TTAGTTAAACATCAAGAGCCTGG + Intronic
984944167 4:184958265-184958287 TTAGCCCCACACCAACAGCGCGG - Intergenic
986826442 5:11527649-11527671 ATAGTTTCTCACCAAGAGCTTGG + Intronic
1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG + Intronic
1035843067 8:2833323-2833345 TTAGATCCACAGCAAGACCAAGG + Intergenic
1039591410 8:38752978-38753000 TTAGAACCACACCAAGGGAGAGG + Intronic
1059579252 9:115525899-115525921 TTGGTACCACACCATGAGAGGGG - Intergenic