ID: 1184384250

View in Genome Browser
Species Human (GRCh38)
Location 22:44165341-44165363
Sequence CATTCTCAGCACCGGCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184384250_1184384257 9 Left 1184384250 22:44165341-44165363 CCTGCATGCCGGTGCTGAGAATG 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1184384257 22:44165373-44165395 CTGGAAACTGCTCGACAGCACGG 0: 1
1: 0
2: 1
3: 15
4: 228
1184384250_1184384254 -10 Left 1184384250 22:44165341-44165363 CCTGCATGCCGGTGCTGAGAATG 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1184384254 22:44165354-44165376 GCTGAGAATGGTGCCTGGCCTGG 0: 1
1: 1
2: 6
3: 42
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184384250 Original CRISPR CATTCTCAGCACCGGCATGC AGG (reversed) Intronic
900410650 1:2511031-2511053 CAGTCTCAGCCCCTGCAGGCTGG - Intronic
900544963 1:3223468-3223490 CACGCTCACCCCCGGCATGCAGG + Intronic
902556358 1:17249133-17249155 GATTCTCTGCAGCGACATGCTGG - Exonic
907305225 1:53509456-53509478 CATTCTCAGCTCCGCCCTGCAGG + Intronic
908119200 1:60969884-60969906 CATTCCCACCAACAGCATGCAGG + Intronic
910800257 1:91138079-91138101 CATGCACACCACCAGCATGCGGG - Intergenic
917319738 1:173767494-173767516 CATTCTCATCAATGGTATGCAGG + Intronic
920248457 1:204605945-204605967 GACCCTCAGCACCGGCCTGCTGG + Intergenic
920826919 1:209431141-209431163 TGTTCTCAGCACCAACATGCAGG - Intergenic
1067172731 10:43921576-43921598 CATTGGCAGCACCTGCATTCTGG + Intergenic
1072685052 10:97531717-97531739 CTTTCTGAGCACCAGCATCCTGG + Intronic
1078152511 11:8771372-8771394 CACTCACAGCCCCTGCATGCTGG - Intronic
1079535580 11:21511406-21511428 CATTCTCACCAACGGCAATCTGG + Intronic
1082978755 11:59101503-59101525 CATGCTGAGCACCGGAATTCTGG + Intergenic
1085405474 11:76259171-76259193 CATTTTCAGCACCAACATGCTGG + Intergenic
1087767751 11:102174865-102174887 CATTCTATGCACCAGCATACTGG - Intronic
1092930253 12:13308991-13309013 CATTAGCAGCACTGGCAAGCAGG - Intergenic
1095788386 12:46136478-46136500 CATTCTCTGCTCCAACATGCAGG - Intergenic
1096350634 12:50897165-50897187 CATTCTCAGGCCGGGCATGGTGG + Intergenic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1098156947 12:67609098-67609120 CATTCTCAGCACCAGAAACCAGG + Intergenic
1099259649 12:80361589-80361611 CATTCCCACCAACAGCATGCAGG + Intronic
1102780700 12:115562167-115562189 CAATGTCAGCACAGGCAGGCAGG + Intergenic
1103361467 12:120356902-120356924 CATGCTGGGCATCGGCATGCTGG - Exonic
1104699641 12:130892248-130892270 CATTTTCAGCACCAGCATCTTGG - Intergenic
1104901400 12:132191205-132191227 CATTCACAGGCCCGGCAGGCTGG + Intergenic
1105796861 13:23863373-23863395 CTTTCTCAGCACTGACATGATGG + Intronic
1106132598 13:26952411-26952433 GGTTGTCAGCACCGCCATGCAGG + Intergenic
1107758684 13:43652801-43652823 AATGCTCATCACCGGCATTCCGG - Intronic
1112915384 13:104542978-104543000 CATTATCATCAACGGCATACAGG - Intergenic
1114578218 14:23732298-23732320 CACACTTAGCACTGGCATGCAGG - Intergenic
1122016792 14:98803298-98803320 CCTTCTCATCTCCAGCATGCTGG + Intergenic
1122609819 14:102974339-102974361 CCTGTTCAGCACAGGCATGCAGG - Intronic
1125072508 15:35572668-35572690 GATTCTCAGCCCAGGCTTGCTGG + Intergenic
1125191794 15:37002224-37002246 CATTCCCTGCACCGTCCTGCTGG + Intronic
1125953538 15:43774250-43774272 CAGTCCCAACACGGGCATGCAGG + Exonic
1128649432 15:69399892-69399914 CCTTCTCAGCACCTGCATCTGGG - Intronic
1132228068 15:100159004-100159026 CATTCTTACCAACGCCATGCAGG - Intronic
1132561479 16:596552-596574 CGTTCTCCGCACCAGGATGCTGG - Intronic
1133277256 16:4646506-4646528 TAAACCCAGCACCGGCATGCCGG - Intronic
1135523331 16:23194240-23194262 CATTCTCAGCACCTCCATGGGGG + Exonic
1135837300 16:25838032-25838054 CGTTCTCTGCACCTTCATGCTGG - Intronic
1136233709 16:28902454-28902476 CCCTCTCAGCACCTGCATGGGGG - Intronic
1136711202 16:32238640-32238662 CCTTCTCAGCACTGCCATCCAGG + Intergenic
1136756705 16:32690767-32690789 CCTTCTCAGCACTGCCATCCAGG - Intergenic
1136811405 16:33179608-33179630 CCTTCTCAGCACTGCCATCCAGG + Intergenic
1136817881 16:33289688-33289710 CCTTCTCAGCACTGCCATCCAGG + Intronic
1136824445 16:33346217-33346239 CCTTCTCAGCACTGCCATCCAGG + Intergenic
1136829511 16:33444988-33445010 CCTTCTCAGCACTGCCATCCAGG + Intergenic
1137031490 16:35528306-35528328 CCTTCTCACCACTGCCATGCAGG - Intergenic
1141532572 16:84657026-84657048 CATGTTCACCATCGGCATGCGGG + Exonic
1202989983 16_KI270728v1_random:2577-2599 CCTTCTCAGCACTGCCATCCAGG + Intergenic
1203058854 16_KI270728v1_random:951119-951141 CCTTCTCAGCACTGCCATCCAGG - Intergenic
1147338007 17:39738601-39738623 CATTCTCAGCTGCTGCCTGCAGG - Intronic
1147981903 17:44280036-44280058 GGTTCTCTGCACCTGCATGCAGG - Intergenic
1151459592 17:74246538-74246560 CATTCTCAGGAGCTGCCTGCAGG + Intronic
1152172094 17:78758269-78758291 CACTCTCAGCAAGGACATGCAGG - Intronic
1152417060 17:80169533-80169555 CATTCTCACCACCTGCATTGTGG - Intergenic
1156949830 18:42881695-42881717 CATTCTCAGCATGGTCATGTTGG + Intronic
1160014254 18:75128371-75128393 CCTGCTCAGCACCGCCATCCAGG + Intergenic
1165403975 19:35618880-35618902 CAGTATCAGCACCTGCCTGCAGG - Exonic
1166912991 19:46174096-46174118 CTTTCTCAGCCCAGGCAGGCAGG - Intergenic
1167350052 19:48968873-48968895 CACGCTCAGGCCCGGCATGCGGG - Exonic
925711278 2:6743206-6743228 CATTCTCTGCATCCACATGCTGG - Intergenic
928025464 2:27735672-27735694 CCTTCCCAGCACCGGCCTGCTGG - Intergenic
929501800 2:42496701-42496723 CATTCCCAGCAGCAGCATCCTGG + Intronic
933166902 2:79086631-79086653 CATTCCCAGCACAGAGATGCTGG - Intronic
935160943 2:100528882-100528904 CAAACTCAGCACCTGCAGGCAGG - Intergenic
938730968 2:134146799-134146821 CATCCTCAGACCCAGCATGCAGG - Intronic
942046209 2:172100807-172100829 CAGTCTCAGCGCCGGCCTCCTGG - Exonic
944275694 2:197835025-197835047 CATTCTCAGCAAAGTAATGCAGG + Intronic
946071404 2:217037206-217037228 CACTCTCAGCACAGGCCTGTGGG - Intergenic
1175028063 20:55924009-55924031 CATTCTCAGGACAGGTATGATGG - Intergenic
1175227736 20:57454703-57454725 CCTTCTCAGCAGCGCCAGGCGGG - Intergenic
1175304551 20:57966898-57966920 AGCTCTCAGCACCGGCAAGCTGG - Intergenic
1175664640 20:60848058-60848080 CATCCTCAGCACTGGCAGGTAGG + Intergenic
1178198760 21:30379125-30379147 CATTGTCATCACCGGCCTGGAGG + Intronic
1180865295 22:19115258-19115280 CTCCCTCAGCACCGGCTTGCTGG + Intronic
1183726331 22:39591936-39591958 CATTATTACCACCGGCAGGCTGG + Intronic
1184302148 22:43567867-43567889 CATTTCCAGCACCGGCTGGCAGG - Intronic
1184384250 22:44165341-44165363 CATTCTCAGCACCGGCATGCAGG - Intronic
950089751 3:10287188-10287210 CATTCTCAGCACTGGCCTGCTGG + Intronic
957380571 3:79423478-79423500 CATTATCAGGATCGGAATGCAGG - Intronic
960518326 3:118626599-118626621 CAGTCTGAGCACCCTCATGCCGG - Intergenic
961204709 3:125072747-125072769 AATTCTCAGCACCAGCTGGCAGG - Intergenic
962037683 3:131670011-131670033 CATTCTCAGCATCCACATGCTGG - Intronic
966012400 3:175096938-175096960 GATTCTCAGCACCGTCTAGCTGG - Exonic
972640575 4:40921400-40921422 GATTCTCAGAACCACCATGCAGG - Intronic
978369363 4:108015237-108015259 CATTGCCACCACCAGCATGCAGG + Intronic
979740424 4:124143269-124143291 CCTTCTCATCACAGGCATGGAGG + Intergenic
992091092 5:73317590-73317612 CACTCTCAGCAGGGGCGTGCAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995871420 5:116747516-116747538 CTTTCTCAGCACTGGAATTCAGG - Intergenic
996667354 5:126074728-126074750 CATTTTCAGCACCAGGCTGCTGG - Intergenic
999433245 5:151542086-151542108 CATTCACCTCACAGGCATGCTGG - Intronic
1002202245 5:177536468-177536490 CATCTTCAGGAGCGGCATGCTGG + Exonic
1002522713 5:179800431-179800453 GGTTCTCAGCACAGGCAGGCGGG + Intronic
1005526167 6:26652119-26652141 CATTGCCAGCACAGGCATGGTGG - Intronic
1007814175 6:44508587-44508609 CATTCACAGCAGCAGCAAGCAGG - Intergenic
1007817834 6:44537232-44537254 CATTCTCAGCTCAGCCATGCTGG + Intergenic
1007905393 6:45454824-45454846 CAGTCTCAGGCCGGGCATGCTGG + Intronic
1015357939 6:132301921-132301943 CATTCTCTGAACCAGAATGCAGG + Intronic
1015496605 6:133889666-133889688 CTTGCTCAGCACTCGCATGCGGG - Exonic
1017774436 6:157669823-157669845 CATTCCCAGGCCCGGCCTGCTGG + Intronic
1024139389 7:46446340-46446362 CAATCTCAGCAAGTGCATGCAGG + Intergenic
1026221280 7:68399784-68399806 CATTCTCAGTCACCGCATGCTGG - Intergenic
1032322096 7:130894869-130894891 CATTCTCTGCACCAGCCAGCGGG - Intergenic
1034718655 7:153267235-153267257 CATTCCCACCATCAGCATGCAGG + Intergenic
1041889682 8:62855393-62855415 CAATATCAGCAAGGGCATGCTGG - Intronic
1045727885 8:105196697-105196719 CAGTCTCAGCACATGCATTCTGG + Intronic
1046056890 8:109088876-109088898 CATTTTCAGCTTCTGCATGCTGG - Intronic
1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG + Intronic
1047246973 8:123154641-123154663 CACTCTGAGCACCTGCCTGCTGG - Intergenic
1049846928 8:144807324-144807346 CGTCCTCAGGACCGCCATGCGGG - Exonic
1052321192 9:27169539-27169561 CATGCTCAGCCCCAGGATGCTGG + Exonic
1053469196 9:38333708-38333730 CATTGTCAGCACCTGGTTGCAGG - Intergenic
1057985730 9:99711787-99711809 CATGCTCAGTACCTGCATGGGGG - Intergenic
1062402734 9:136379554-136379576 CATGCCCAACACCGGCAAGCTGG - Intronic
1203771023 EBV:50262-50284 CTATCCCAGTACCGGCATGCGGG - Intergenic
1186008022 X:5095888-5095910 CATTCTCAGGACCAGCATCCAGG + Intergenic
1187544909 X:20240406-20240428 CATGCTCAGCACCTTCATGATGG - Intronic
1189741976 X:44128174-44128196 CATTCCCAACAGCAGCATGCCGG + Intergenic
1191942861 X:66499262-66499284 CATTCTCAGCCCAGGCCTCCGGG - Intergenic
1197833528 X:130670988-130671010 CATTATCAGCACAAGCTTGCAGG + Intronic
1199680533 X:150221452-150221474 CATTCTCAGCACGGCCAGACTGG - Intergenic
1201672387 Y:16538466-16538488 CATTCTCAGGACCTACATTCAGG - Intergenic