ID: 1184384820

View in Genome Browser
Species Human (GRCh38)
Location 22:44167991-44168013
Sequence GTGATCAGGACTAAAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184384815_1184384820 17 Left 1184384815 22:44167951-44167973 CCACCTGCTCTCTCAGTAACCGA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 122
1184384817_1184384820 -2 Left 1184384817 22:44167970-44167992 CCGATGTCGTTTCTTACTCTTGT 0: 1
1: 0
2: 0
3: 8
4: 181
Right 1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 122
1184384812_1184384820 22 Left 1184384812 22:44167946-44167968 CCACCCCACCTGCTCTCTCAGTA 0: 1
1: 0
2: 4
3: 79
4: 467
Right 1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 122
1184384814_1184384820 18 Left 1184384814 22:44167950-44167972 CCCACCTGCTCTCTCAGTAACCG 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 122
1184384816_1184384820 14 Left 1184384816 22:44167954-44167976 CCTGCTCTCTCAGTAACCGATGT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 122
1184384813_1184384820 19 Left 1184384813 22:44167949-44167971 CCCCACCTGCTCTCTCAGTAACC 0: 1
1: 0
2: 1
3: 19
4: 266
Right 1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184384820 Original CRISPR GTGATCAGGACTAAAGCACA GGG Intronic
904558417 1:31380617-31380639 GTGACCAGGACTGGAGCCCAGGG + Intergenic
904752819 1:32751573-32751595 GTGATCAGTACTATATCAGAAGG + Intronic
904804408 1:33120615-33120637 GGGCTCAGGACTAAAGCAGAGGG - Intergenic
905687525 1:39919363-39919385 GTGATAATGACTAAAGCCCAAGG + Intergenic
909857616 1:80558915-80558937 GAGATTAGGACTAAATCAAAAGG - Intergenic
912669949 1:111616374-111616396 GTGATGAGGACAGAAGCCCAAGG + Intronic
913098448 1:115541281-115541303 GTGAACAGGCCTCAAACACAGGG + Intergenic
913522826 1:119662185-119662207 ATGATCAGCACTAAACCACCAGG + Intronic
916076346 1:161201996-161202018 GAGAGCAGGACTAAAGCATGAGG + Intronic
917501048 1:175585586-175585608 GTGATCTGGTATAAAGAACATGG - Intronic
918403746 1:184191448-184191470 GCGATGCTGACTAAAGCACAGGG + Intergenic
918983121 1:191589001-191589023 GTGATCAGGTATCAAACACAGGG + Intergenic
920090691 1:203450881-203450903 TTGATCGGGACTCAAACACACGG - Intergenic
920402030 1:205681921-205681943 GTCATAAGGCATAAAGCACAAGG - Intergenic
920447310 1:206028464-206028486 GTGATCAGCCCAAGAGCACATGG + Intergenic
920919794 1:210289082-210289104 GTAAACATGACTAAAGGACAGGG + Intergenic
921315483 1:213886438-213886460 GTGGGCATGACTGAAGCACAAGG + Intergenic
923532366 1:234821616-234821638 GCCATCTGGACTAAAGCATATGG + Intergenic
1074075074 10:110115433-110115455 CTGATCAGAACTAAAGACCAGGG + Intronic
1077881360 11:6353209-6353231 GTGATAAGGATTGAAGAACAAGG - Intergenic
1081018649 11:37915053-37915075 GTTATCTTGACTTAAGCACAGGG + Intergenic
1083670562 11:64297684-64297706 CTGATCAGGAATAAAGTAGATGG - Intronic
1084303083 11:68264040-68264062 GTGATCAGATGCAAAGCACAGGG - Intronic
1090503111 11:127281189-127281211 GTGCCCAGGATGAAAGCACAGGG - Intergenic
1090697081 11:129257034-129257056 CTGACCAGGACTAGATCACATGG + Intronic
1090975839 11:131679233-131679255 GCTATCTGGACTCAAGCACAGGG - Intronic
1091792422 12:3279490-3279512 CTGAGCAGGACTGAGGCACAGGG + Intronic
1093614307 12:21203491-21203513 GTAAGCAGCACTAAAGAACATGG - Intronic
1093665281 12:21805003-21805025 GTGAGCATGACAAAAGCACTTGG + Intronic
1096802372 12:54119688-54119710 GTGATCAGAAGCAAAGCTCAGGG + Intergenic
1098742876 12:74197151-74197173 ATGATCAGGATTCAAGGACATGG - Intergenic
1100897226 12:99197152-99197174 CTGATCAGAACTACAGCACTTGG + Intronic
1101054946 12:100902854-100902876 GTGACCATGGCTAAAGGACATGG - Intronic
1106434729 13:29713296-29713318 TTGATCATGAATAAAGCAGAGGG - Intergenic
1106448254 13:29856009-29856031 GTAATCAGGAAGAAAACACATGG + Intergenic
1121755801 14:96401084-96401106 GAGATCAGGACTAAGGCACATGG - Intronic
1121873175 14:97427678-97427700 GTGATCAGCACATAAACACATGG - Intergenic
1123168007 14:106344841-106344863 GTGATCAGGACTAAAGACAGAGG - Intergenic
1123170646 14:106369554-106369576 GTGATCAGGACTAAAGACAGAGG - Intergenic
1123194313 14:106601800-106601822 GTGATCAGGACTAAAGACAGAGG - Intergenic
1123222267 14:106868100-106868122 GTGATCAGGACTAAAGACAGAGG - Intergenic
1124095084 15:26641784-26641806 GGCATCAGGAATAAAGAACAGGG + Intronic
1124496184 15:30188769-30188791 GTGATACTGACTAATGCACAAGG - Intergenic
1124747390 15:32349878-32349900 GTGATACTGACTAATGCACAAGG + Intergenic
1126579713 15:50231807-50231829 GTGATCAGAACTAAAACCAATGG + Intronic
1127314398 15:57781284-57781306 CTGAGCAGGACTCCAGCACAGGG + Intronic
1131255706 15:90860607-90860629 GTGTTCAAGATGAAAGCACAGGG - Intergenic
1131259824 15:90882528-90882550 GTGGTCAGGACACCAGCACAGGG - Exonic
1135308306 16:21385888-21385910 CTCATCAGGACGGAAGCACAGGG + Intergenic
1135613483 16:23888862-23888884 GTGATAGGGTCTGAAGCACAAGG - Intronic
1136305050 16:29365015-29365037 CTCATCAGGACGGAAGCACAGGG + Intergenic
1139094416 16:63687079-63687101 GTGGTGAGGAGTAAAACACATGG + Intergenic
1140855093 16:78971127-78971149 TTGCTCAGGAATAAAGCATATGG - Intronic
1142630627 17:1223840-1223862 GTGATCAGGACAACAGCCCGGGG + Intronic
1149517618 17:57292449-57292471 GTCACCAGGTCTAAGGCACATGG - Intronic
1150853880 17:68732159-68732181 GTTATCAGGAGCAAAGCAGATGG + Intergenic
1152348232 17:79768006-79768028 GTGATCATGAATAAATCTCACGG - Intergenic
1153420852 18:4903294-4903316 GTTATCAGGTCCAAATCACAGGG - Intergenic
1155364223 18:25034258-25034280 GTTACCAGGAATGAAGCACAGGG + Intergenic
1157279265 18:46334961-46334983 GTGAGCAGGGCAATAGCACAAGG - Intronic
1158075244 18:53520458-53520480 CTGATCAGGTCTCAGGCACAAGG + Intronic
1159060404 18:63508811-63508833 GTGACAAGGACAAAAGAACAGGG - Intergenic
1160110058 18:76018290-76018312 CTGATCAGGTCCAAATCACAAGG + Intergenic
1161792541 19:6368970-6368992 GGGGTCAGGACAAAAGCAGAAGG - Intergenic
1165505800 19:36228285-36228307 CCCATCAGAACTAAAGCACATGG - Intronic
1168300172 19:55400467-55400489 GTGATAATGACTAAATCACAGGG - Exonic
927558762 2:24054038-24054060 TGGATCAGGGCTAAAGCCCAAGG + Intronic
929668792 2:43853356-43853378 GTGTTCAGGACCCAAGCAAAGGG - Intronic
939325761 2:140686148-140686170 GTGAGTAGGACTAGAGGACAGGG + Intronic
944420406 2:199524216-199524238 GTAATGAGAAGTAAAGCACAGGG + Intergenic
947739177 2:232477141-232477163 GTGAGCAGGACTTGAGCCCAGGG - Intergenic
948854878 2:240725416-240725438 GGGAGCAGGACTCAGGCACAAGG + Intronic
1170983705 20:21238964-21238986 GTGATGAGTACTTAGGCACAGGG - Intronic
1171794369 20:29554898-29554920 GTGATCAGGAACAAAGCTCAGGG - Intergenic
1171854104 20:30329493-30329515 GTGATCAGAAACAAAGCTCAGGG + Intergenic
1172992636 20:39047762-39047784 GTGACCAGGACCTAAGCAGAGGG + Intergenic
1174821231 20:53728118-53728140 GAGATCAGGTCTATACCACATGG + Intergenic
1175126130 20:56752848-56752870 GTTATCAGGACTCATGCACTCGG - Intergenic
1182394225 22:30023676-30023698 GTGATCAGGAGGGGAGCACATGG - Intronic
1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG + Intronic
954793620 3:53150098-53150120 GTGATCAGGAGGACAGGACATGG + Intergenic
958151310 3:89697632-89697654 TTGGTCAGGACGAAATCACAGGG + Intergenic
959339193 3:105107001-105107023 CTGATCAGGACAAAAGAACAGGG + Intergenic
961225287 3:125239087-125239109 GTTATCAGGACTGAAGAAGAGGG + Intronic
962153535 3:132918777-132918799 GTCGACATGACTAAAGCACAAGG - Intergenic
964778131 3:160303129-160303151 GGAATGAGGAATAAAGCACATGG + Intronic
968006480 3:195246640-195246662 CTGATGAGGAATAAACCACAAGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
975175729 4:71286393-71286415 CTGATCAGTACAAAAGCATATGG - Intronic
978879386 4:113682856-113682878 GAAATAAGGACTAAAGTACATGG + Intronic
979220133 4:118213282-118213304 GTGAACAGGAATAAAGCCCAGGG + Intronic
980229113 4:130025109-130025131 GTGATCAGGAATGAGGCCCATGG + Intergenic
984841874 4:184076299-184076321 CTGATCAGGACTATTGCAAACGG + Intergenic
987163375 5:15168557-15168579 GCCAAAAGGACTAAAGCACATGG + Intergenic
989343370 5:40402227-40402249 GAGAACAGAACTGAAGCACAGGG - Intergenic
991779008 5:70114329-70114351 GAGAGCAGGAGTAAAGCAAAGGG + Intergenic
991858300 5:70989794-70989816 GAGAGCAGGAGTAAAGCAAAGGG + Intronic
991871457 5:71114680-71114702 GAGAGCAGGAGTAAAGCAAAGGG + Intergenic
992369380 5:76127156-76127178 GTGATGAGGAGTAAAGCAAAGGG + Intronic
993686249 5:90941973-90941995 GTGAGGAGGAATAAAGAACATGG - Intronic
1000341397 5:160279759-160279781 GTGATGAGGAGAAAGGCACAGGG + Intronic
1001598768 5:172915417-172915439 GTGATGAGGAATAAAGCCAAGGG + Intronic
1003663694 6:8088864-8088886 GTGATAAGGACTAAAGATAAAGG + Intronic
1006267041 6:32934241-32934263 GTGATGAGGATCAAAGCACCTGG + Intergenic
1010384072 6:75258674-75258696 GAGACCAAAACTAAAGCACAAGG + Intronic
1011561499 6:88621878-88621900 GGGATAAGGATTAAAGCAGAGGG - Intronic
1011971466 6:93229189-93229211 GTGATCAGGGCTAATACAGAGGG + Intergenic
1015563653 6:134543092-134543114 GTGAGGAGGACTGAAACACAAGG + Intergenic
1017981209 6:159402245-159402267 TTCATCAGGACTGAAGCGCATGG + Intergenic
1018068649 6:160141905-160141927 GTGATAAGGACTAAGACAGAGGG - Intronic
1019843464 7:3473614-3473636 GTAGTCATGAATAAAGCACATGG - Intronic
1020064108 7:5174585-5174607 GTGATCAGGACTAGAGGAGTGGG - Intergenic
1023799197 7:43818714-43818736 GCCAACTGGACTAAAGCACAAGG - Intergenic
1030083794 7:105800048-105800070 GTGCTGGGGCCTAAAGCACAAGG + Intronic
1034462996 7:151208816-151208838 GTGATCTCTACTAAAGCAAATGG + Intronic
1042419933 8:68575142-68575164 GTCATTAGGAGAAAAGCACAAGG + Intronic
1042824258 8:72964248-72964270 GTGATCAGGATGAAAGAAAAGGG - Intergenic
1046812295 8:118546134-118546156 GTGATGAGAAGAAAAGCACAGGG + Intronic
1053791912 9:41692774-41692796 GTGATCAGAAACAAAGCTCAGGG + Intergenic
1054153239 9:61621991-61622013 GTGATCAGAAACAAAGCTCAGGG - Intergenic
1054180319 9:61904793-61904815 GTGATCAGAAACAAAGCTCAGGG + Intergenic
1054473036 9:65553195-65553217 GTGATCAGAAACAAAGCTCAGGG - Intergenic
1054657273 9:67676349-67676371 GTGATCAGAAACAAAGCTCAGGG - Intergenic
1056322046 9:85444445-85444467 GAAATCAGGAATAAATCACACGG - Intergenic
1056683953 9:88744282-88744304 GTGATCAGAGCCAAAGCACGTGG + Intergenic
1056934755 9:90907791-90907813 GTGATCAAGATTAAAGAACTGGG - Intergenic
1058244772 9:102609137-102609159 GTGATCAGGACTCAGACACTAGG - Intergenic
1059111781 9:111564759-111564781 GTGATTAGGACTTAAACATATGG - Intronic
1059758105 9:117312679-117312701 GTCATCAGGACAAAAACTCAGGG + Intronic
1190055183 X:47177354-47177376 GTGATCAGGAGCAAGGCACAGGG - Intronic
1190303723 X:49071004-49071026 TGGATCAGCATTAAAGCACAGGG - Intergenic
1195749964 X:108154358-108154380 GTGATCATGATTTAAGGACAGGG - Exonic
1199347213 X:146755744-146755766 GTGATAAGGACTACAGCATAAGG + Intergenic