ID: 1184385454

View in Genome Browser
Species Human (GRCh38)
Location 22:44171736-44171758
Sequence AGATCTGTGGGGAAGCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184385449_1184385454 26 Left 1184385449 22:44171687-44171709 CCACGTCACACTCTTGTGGGTTT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1184385454 22:44171736-44171758 AGATCTGTGGGGAAGCTACATGG 0: 1
1: 0
2: 1
3: 19
4: 170
1184385448_1184385454 27 Left 1184385448 22:44171686-44171708 CCCACGTCACACTCTTGTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1184385454 22:44171736-44171758 AGATCTGTGGGGAAGCTACATGG 0: 1
1: 0
2: 1
3: 19
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184385454 Original CRISPR AGATCTGTGGGGAAGCTACA TGG Intronic
900810661 1:4799226-4799248 AGTTCTGTGTGGAAGCTGCCAGG - Intergenic
902149574 1:14432166-14432188 TGTTCTTTGGGGAAGCTAAAGGG - Intergenic
903868938 1:26418609-26418631 AGGACTGTGGGGAGCCTACATGG - Intronic
905142858 1:35862331-35862353 AAATCTGGGTGGAAGTTACATGG - Intergenic
905452730 1:38067398-38067420 AGATCTGTAAGGAAGCAAGAGGG - Intergenic
906110468 1:43318893-43318915 AGGTCTCTGGGGAAGCTGGAGGG + Intronic
906218782 1:44060928-44060950 AGATCTGTGAGCAAGCTACCTGG + Intergenic
907454557 1:54566875-54566897 AGGCCTGGGGGGAAGCTGCAAGG + Intronic
907762759 1:57377781-57377803 AGAGTTATGGGGAAGCTGCAGGG + Intronic
908845978 1:68324556-68324578 AGGTCTGAGTGGAAGCTATAAGG + Intergenic
910520798 1:88119896-88119918 AGCTCTGTGAGGAATATACAAGG + Intergenic
912423759 1:109567386-109567408 AGACCTGTGAGGAAGGTTCAAGG + Intronic
912659088 1:111512784-111512806 AGACTTGTTGGGAAGCCACAGGG + Intronic
913076208 1:115342538-115342560 GGATCTGTGGGGCAGCTGCCTGG - Intergenic
918972074 1:191432783-191432805 AGAACTGGGGAGAAGCCACAGGG + Intergenic
919856524 1:201709801-201709823 ATACCTGTGGGGAAGCTGCCTGG + Intronic
919883386 1:201915576-201915598 GGATCTGTGGGGAGGCAACGTGG + Intronic
920572543 1:207028613-207028635 AGAGTTGGGAGGAAGCTACATGG - Intronic
923870155 1:237983824-237983846 AAATCTGTGTGGAAGAGACACGG + Intergenic
1063481179 10:6377967-6377989 AGATGTGTGCGGAAACTGCAGGG + Intergenic
1063740269 10:8810004-8810026 AGTTCTGAGGAGAAGCTGCAGGG + Intergenic
1069830388 10:71279189-71279211 AGCTCTGTGAGGAAGCTTCTGGG + Intronic
1074611198 10:115023823-115023845 AGAAATGTGGGTAAGCTCCAGGG + Intergenic
1074870159 10:117569944-117569966 AGGTCTGTGGGGTAGATCCAAGG - Intergenic
1074901227 10:117817818-117817840 AGCACTGTGGGGTAGCGACATGG + Intergenic
1075777540 10:124998212-124998234 AGATCAGTGGGGAAGCCCCAGGG + Intronic
1078096540 11:8300792-8300814 AGCTTTGTGGGGAGGATACAGGG - Intergenic
1078909109 11:15714256-15714278 AGATGTGAGGGGCAGGTACAGGG + Intergenic
1079470230 11:20771005-20771027 AGAGCCGGGGGGAAGCTAGAGGG - Intronic
1083908124 11:65687480-65687502 AGATCTATGAGCAAGCTACCTGG + Intergenic
1084625052 11:70299996-70300018 AGATCTGTGGGGTAGGTGGAGGG - Intronic
1086501266 11:87456199-87456221 AGGTCTGGATGGAAGCTACAAGG + Intergenic
1087641420 11:100759177-100759199 AGATCTGTTAGCAAGCTGCAGGG - Intronic
1090009195 11:123030888-123030910 AGATCTATGGAGAATCCACAGGG + Intergenic
1091317036 11:134621797-134621819 TTATGTGTGGGGCAGCTACATGG + Intergenic
1092895155 12:13003407-13003429 ACATTTGTGGGGAAGTTACAGGG - Intergenic
1094332585 12:29311526-29311548 CGATGTGTGGGGAAGCTTCCTGG + Intronic
1097841472 12:64325870-64325892 AGATCTTTGGGGCAGCAATAGGG - Intronic
1099971576 12:89505772-89505794 TGTTGTGTGGAGAAGCTACAAGG + Intronic
1100376592 12:94021879-94021901 AGATGTGTGTAGATGCTACAGGG + Intergenic
1102893955 12:116583460-116583482 AGGGCTGTGTGGAAGCTACATGG - Intergenic
1103903653 12:124316298-124316320 AGATCTGGGGGGCAGCTCCTTGG + Intergenic
1109638248 13:65151513-65151535 ATGGCTGTGGGGAAACTACATGG - Intergenic
1113632214 13:111896115-111896137 TGATGTGTGGGGAAGTTAGACGG - Intergenic
1118271067 14:64342633-64342655 ACATCTGTCAGGAAGGTACATGG - Intergenic
1118637043 14:67757426-67757448 AGATCTATGGGGAAGGCAGAGGG - Intronic
1119733477 14:76965875-76965897 AGGTCTGTGGGGACGCTGTATGG + Intergenic
1119754712 14:77107710-77107732 AAATCTGTACTGAAGCTACATGG - Intronic
1119895522 14:78216482-78216504 ACAGCAGTGGGGAAGCTACAGGG + Intergenic
1120031140 14:79642291-79642313 AGAGCTGTGGGGATACCACATGG - Intronic
1120718745 14:87868082-87868104 AGGTCTGAGGGGCAGCCACAGGG - Intronic
1123832155 15:24151083-24151105 AAATCTGTAGAGAAGGTACAAGG - Intergenic
1124102969 15:26712855-26712877 AGATGTGCAGGGAAGCTTCAAGG + Intronic
1125315883 15:38430601-38430623 ACATTTGAGGGGAAGGTACATGG + Intergenic
1125778814 15:42244917-42244939 AGATCTCTGGGTAAGCTTCTAGG + Intronic
1125926214 15:43565319-43565341 AAATCTGAGGGGAATCTAGAGGG - Intronic
1125939358 15:43664870-43664892 AAATCTGAGGGGAATCTAGAGGG - Intronic
1129411125 15:75350884-75350906 AGTTCTGGGGTGAAGGTACAAGG - Intronic
1129915300 15:79264883-79264905 AGCACTTTGGGGAAGCTGCAGGG + Intergenic
1130668609 15:85890707-85890729 AGCTCTGTGGGGCAGCTTGATGG + Intergenic
1132403519 15:101528495-101528517 AAAGCTGTGGGGAGGCTTCAGGG + Intergenic
1138029895 16:53551830-53551852 AGGTCTGTGGGGCATGTACAGGG - Intergenic
1138577512 16:57917473-57917495 AGGTCTGTGGGGAAGGTTGACGG + Exonic
1138634983 16:58331111-58331133 AAAGCTCTGGGCAAGCTACATGG + Intronic
1138659358 16:58508480-58508502 AGAGCTGCTGGGAAGCTGCAGGG + Intronic
1139341732 16:66271879-66271901 AGTTCAGTGGGCAGGCTACAGGG + Intergenic
1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG + Intronic
1140587358 16:76309242-76309264 AGAGCTGGGGGAAAGCTCCAGGG + Intronic
1143379669 17:6488154-6488176 AGACCTGTGGGGAAGGTACAGGG - Intronic
1147990072 17:44327048-44327070 AGAGCTGTGGGGGAGCTCAAAGG - Intergenic
1149438316 17:56653012-56653034 AGACCTGTGGGGCAGCTGGATGG - Intergenic
1149642316 17:58211160-58211182 AGATCTGTGGAGAAGTGTCAGGG - Intronic
1151368767 17:73634022-73634044 ACAGCTGTGGGGAAGCTACCAGG + Intronic
1152101364 17:78303718-78303740 GGATCAGTGGGGAAACGACACGG - Intergenic
1153690237 18:7585090-7585112 AGATCCGTGGGAAAACTGCAGGG + Intronic
1153807483 18:8721822-8721844 AGCTCTGTGGGGCAGGGACAGGG + Intronic
1162969083 19:14169467-14169489 AGTGCTGTGGGGAGGCTTCAAGG + Intronic
1168176753 19:54632407-54632429 AGATTTGTGGGGAAGCCTGAGGG + Intronic
925152208 2:1622756-1622778 AGAGCTGCGGGTCAGCTACAGGG - Intergenic
927875221 2:26650708-26650730 ATATCTGTGTGGCAGCTGCATGG + Intergenic
928852152 2:35761250-35761272 AGCTCTGATGGGAAGGTACAGGG + Intergenic
931104633 2:59042045-59042067 AGTTCTGTGGGTTAGCTAGAAGG + Intergenic
931893486 2:66702466-66702488 AGATCTGAGGGGGAGGTAAAAGG - Intergenic
934674829 2:96242127-96242149 AGTTCTGTGGGGAAGGTATGGGG + Intergenic
937291791 2:120786225-120786247 AGGACTCTGGGCAAGCTACAGGG - Intronic
940033801 2:149292090-149292112 AGAGGGGTGGGGAAGCTGCATGG + Intergenic
946047929 2:216836728-216836750 AGCCATGTGGAGAAGCTACATGG - Intergenic
946818794 2:223609174-223609196 AGATCCATGGTGAAGCCACAGGG - Intergenic
947867468 2:233409371-233409393 AGACCTGGGGGGAAGATACATGG + Intronic
948523581 2:238557423-238557445 AGCTCTGTGGGGAAGCTGTGGGG - Intergenic
948721085 2:239900445-239900467 AGAGGAGTGGGGAAGCTTCATGG - Intronic
948927850 2:241110828-241110850 AGATCTGAAGGGAAACTCCACGG + Intronic
1169205798 20:3739847-3739869 AGATCTGGTAGGAAGCTCCATGG - Intronic
1170464387 20:16609672-16609694 ACATCTGTGGGGCAACCACAAGG - Intergenic
1172106629 20:32520954-32520976 GGATCTGTGGGGAGGCAACTTGG + Intronic
1173536809 20:43821075-43821097 AGATCTCTGTGGAAGCTTGAGGG + Intergenic
1174842834 20:53916024-53916046 AGATCTGTGGGCATGATTCAGGG + Intergenic
1175952617 20:62591386-62591408 AGAGGTGAGGGGGAGCTACAGGG + Intergenic
1181782198 22:25201450-25201472 AGACCTTGGGGGCAGCTACAAGG + Exonic
1184385454 22:44171736-44171758 AGATCTGTGGGGAAGCTACATGG + Intronic
1184605818 22:45574332-45574354 TGCTCTGTGGGGAGGCTTCATGG - Intronic
1184692953 22:46125611-46125633 AGAGCTGTGGAGAAGCAAGATGG + Intergenic
954395589 3:50291808-50291830 GGCTCTGTTGGGAAGCTACCTGG - Intronic
954633923 3:52061320-52061342 AGATCTGTGGGGAATCCCCAAGG + Intergenic
954845123 3:53548796-53548818 AGATCTGTGTGGACGTTAAATGG - Intronic
955122984 3:56080060-56080082 AAATGTGTTGGGAAGATACAAGG - Intronic
955489590 3:59469114-59469136 AAATCTGTTGGGCAGTTACAGGG - Intergenic
959393026 3:105800253-105800275 AAATCTCTGGGGAAGGGACATGG + Intronic
960644044 3:119858487-119858509 AGAGAGGTGAGGAAGCTACAAGG - Intronic
964380117 3:156090159-156090181 AAAGCTGTAGAGAAGCTACATGG - Intronic
966072478 3:175895769-175895791 AGCTCTCTGAGCAAGCTACATGG + Intergenic
966462875 3:180197186-180197208 AGATCTGTGGGGATGGGAGACGG + Intergenic
969264213 4:6054600-6054622 AGCTCTGTGGGGAAGCAGGAGGG - Intronic
969692517 4:8711412-8711434 AGATCTGAGAGGCAGCTCCAGGG + Intergenic
970193453 4:13535400-13535422 AGATCTGCGGGGCAGCAACTTGG + Intergenic
976185828 4:82441874-82441896 ACATCTGTGGGAAAACTACATGG + Intronic
979150868 4:117312381-117312403 GGATCTCTGGGGAAGTTACGTGG - Intergenic
980008029 4:127563319-127563341 AGATCTGGGCAGAAGCTGCAAGG - Intergenic
980552142 4:134352358-134352380 AGATCAGTGAGGAAGTTTCAGGG - Intergenic
981013839 4:139952886-139952908 AGATCCGTGGAGGAGCTACAAGG + Intronic
985262841 4:188130619-188130641 ATATCTGTGGGGAAGGTTCCGGG - Intergenic
985339127 4:188929874-188929896 AGATCTGTAGGGAAGGGACAAGG - Intergenic
985526092 5:402585-402607 AGATGTGTTGGAAGGCTACATGG + Intronic
986767844 5:10944057-10944079 AGATTCCTGGGGAAGCTACAAGG + Intergenic
987138108 5:14918503-14918525 AAATCTCTGGGGAAGCTTCCTGG - Intergenic
989297393 5:39845996-39846018 AGATCTCTTGGAAAACTACAGGG - Intergenic
990337917 5:54793344-54793366 AGAGCTATGGGGAAGACACAGGG - Intergenic
991898732 5:71434946-71434968 AGAACTGTGGGGAAACAACGAGG + Intergenic
991999720 5:72424184-72424206 AGATGTGAGTGGTAGCTACATGG - Intergenic
992272707 5:75082042-75082064 ATAACTGTGGGGAAGTTAAAGGG - Intronic
992362406 5:76053844-76053866 AGATTTGTAGGGCAGATACATGG - Intergenic
993626143 5:90227244-90227266 GGATATGTGGGGAAGTTCCATGG - Intergenic
995180030 5:109222527-109222549 AGATGTGAGCGGAAGCTGCATGG + Intergenic
996370247 5:122745740-122745762 AGACCTGTGGAGAAGTTTCATGG - Intergenic
998060995 5:139118675-139118697 AGATGTGTTGGGAAGCTCCCAGG + Intronic
999305186 5:150515019-150515041 AGATCTGTGGGGCAGGACCAGGG - Intronic
1000577185 5:162988812-162988834 AGAACTGTGAGCAAGCTACCTGG - Intergenic
1002495387 5:179608019-179608041 CAATCTATGGGGAACCTACAGGG + Intronic
1004078746 6:12370064-12370086 AGATCTGTGGGGAAGCCCCCTGG - Intergenic
1004437101 6:15606671-15606693 GGATTTTTGGGAAAGCTACAGGG + Intronic
1004639040 6:17496172-17496194 AGGCCTGTGGGGTAGCTTCAGGG - Intronic
1005354857 6:24972556-24972578 AGATATGTGGGTAGGCTTCAGGG + Intronic
1005690294 6:28298281-28298303 GGAGCTGTGGAGAAGCTAGAAGG + Intronic
1007702736 6:43774026-43774048 GGAAGTGTGGGGAAGGTACAGGG + Intronic
1008142324 6:47846208-47846230 GGGTCTGTGTGGCAGCTACAGGG + Intergenic
1009815243 6:68724994-68725016 AGACCTGTGGGAATGCTACTGGG + Intronic
1010067723 6:71704704-71704726 TAATCTGCGGGGAAGCTACTGGG - Intergenic
1012487393 6:99737473-99737495 AGATCTGGAGGGAGTCTACAGGG + Intergenic
1012735075 6:102928538-102928560 AGATCTGTGGGACAGGTAGAAGG + Intergenic
1014103401 6:117536712-117536734 AGATCTGTGGGGAAGGCAGATGG + Intronic
1018411199 6:163550482-163550504 AGATTTGGGGGGAAGCTATGTGG + Intronic
1019757422 7:2783188-2783210 CCATCTGTGGGGAATCTCCATGG + Intronic
1021656614 7:22880143-22880165 AGCTCTGTGGGGAAGGTGCAGGG - Intergenic
1021918941 7:25464458-25464480 AGATCTCTGGGGAAGGTAGAGGG - Intergenic
1022606957 7:31824846-31824868 AGGTCAGTGGGGAAGCTTGAGGG - Exonic
1023760999 7:43465270-43465292 AGAACTGTGGGGTAGATGCATGG - Intronic
1025611172 7:63076874-63076896 TGCTCTGAGGGGAAGCCACATGG - Intergenic
1026452340 7:70540325-70540347 AGATATGTGGGGAGCCTACTGGG + Intronic
1027492822 7:78851518-78851540 AGATCTGGGAGGAATATACAGGG - Intronic
1033443333 7:141399345-141399367 AGCACTGTGGGGAAGCTAGTGGG + Intronic
1033450151 7:141455085-141455107 TGACCTGTTGAGAAGCTACAGGG + Intronic
1035332629 7:158106242-158106264 GGAGCTGGGGGGAAGCTAGAGGG - Intronic
1035405891 7:158596943-158596965 AGAGCTGACGGGAAGCTCCACGG - Intergenic
1035995623 8:4543334-4543356 AGAACTATGGGGACGCTAAAAGG - Intronic
1036243995 8:7101300-7101322 GGAGCTGTGGGGCAGCAACAAGG + Intergenic
1040109254 8:43559259-43559281 AGATGTGTGGGGAAGGGATAAGG + Intergenic
1040706766 8:50137710-50137732 AGATCTGTGGGGAAGATTCCAGG + Intronic
1040745918 8:50642437-50642459 AGATCTGTCAGGGACCTACAAGG + Intronic
1041974463 8:63781408-63781430 ATAACTGTAGGCAAGCTACACGG + Intergenic
1042475030 8:69238243-69238265 GGATCTGAGGGGAAGCTTCTTGG - Intergenic
1043219663 8:77644703-77644725 AGATCTATGGGACAGTTACATGG + Intergenic
1044480461 8:92681561-92681583 AGATCTGGGGGGAAGAGACAGGG - Intergenic
1044559490 8:93598418-93598440 AGAACTGGGTGGAAGCTGCATGG + Intergenic
1046065413 8:109190734-109190756 AAATCCATAGGGAAGCTACATGG - Intergenic
1047987718 8:130252975-130252997 AGAACTGGTGGGAAGCTAAAAGG - Intronic
1048338756 8:133522941-133522963 AGCACTGTGGGGAAGAGACAGGG + Intronic
1048611162 8:136024701-136024723 AGATCTATAGGGAGGCCACATGG + Intergenic
1050085901 9:1965451-1965473 AGAGGTGTGGGGAAGCCATAGGG + Intergenic
1050703303 9:8365756-8365778 ACATCAAAGGGGAAGCTACAAGG - Intronic
1052505578 9:29349950-29349972 AAAGCTGTGGGGAAGCAACCAGG + Intergenic
1054840406 9:69732214-69732236 AGGTCTGTGGTGAAGCAGCAGGG - Exonic
1055100023 9:72454296-72454318 AGAGCATTGGAGAAGCTACAAGG - Intergenic
1056825765 9:89875351-89875373 AGATCAGTGCGGAAGCTGCCAGG - Intergenic
1057919359 9:99083996-99084018 ATATTTGTGGGGTACCTACAAGG - Intergenic
1187039372 X:15577449-15577471 AGATCTAAGGGGATGTTACAGGG + Intronic
1188838493 X:34987348-34987370 AGATCTCTGGGGATGCCAAATGG - Intergenic
1191664620 X:63687199-63687221 AGCTCTGTGGGAAAGCTGGATGG - Intronic
1192910044 X:75593663-75593685 ACAGCAGTGGGGAAGCTACAGGG - Intergenic
1194532845 X:95072148-95072170 AGAGCTCTGGGGAAGCTTTATGG + Intergenic
1195530046 X:105943808-105943830 ATATTTTTGGGGAAGCTACTTGG - Intronic
1196057863 X:111375348-111375370 AAATCTGGGGGAAAGGTACATGG + Intronic