ID: 1184386783

View in Genome Browser
Species Human (GRCh38)
Location 22:44181311-44181333
Sequence TGGGAGCCTCAGCTCAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 2, 1: 0, 2: 6, 3: 59, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184386778_1184386783 -9 Left 1184386778 22:44181297-44181319 CCTCCGAGGGCTTGTGGGAGCCT 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1184386783 22:44181311-44181333 TGGGAGCCTCAGCTCAGGGGCGG 0: 2
1: 0
2: 6
3: 59
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184386783 Original CRISPR TGGGAGCCTCAGCTCAGGGG CGG Intronic