ID: 1184388933

View in Genome Browser
Species Human (GRCh38)
Location 22:44192119-44192141
Sequence AGGGCCCATGGGTGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 0, 2: 11, 3: 80, 4: 741}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184388933 Original CRISPR AGGGCCCATGGGTGGGGCTG GGG Intronic
900148854 1:1169599-1169621 AGGGCCCATCTCTGGGGCTGAGG + Intergenic
900164084 1:1237777-1237799 GGGGCCCCTGGGGGAGGCTGGGG - Intergenic
900164850 1:1240575-1240597 AGGGTGAATGGGGGGGGCTGGGG - Intergenic
900312757 1:2042299-2042321 AGGGCCAAGGTGGGGGGCTGTGG - Intergenic
900314000 1:2048165-2048187 AGGCCCCATGGCCAGGGCTGTGG - Intergenic
900487694 1:2931233-2931255 CGGGCCTCTGCGTGGGGCTGAGG + Intergenic
900585695 1:3431304-3431326 AGGGCCCCTGGGGGTGGGTGGGG - Intronic
900806618 1:4771764-4771786 CGTGCCCCTGGGTGAGGCTGAGG + Intronic
900899779 1:5508738-5508760 AGGGCTCAGGGGTGGGGAGGTGG - Intergenic
901022701 1:6263075-6263097 ATGGGTCATGGGTGGAGCTGGGG + Intergenic
901023583 1:6267418-6267440 AGGGCCCTGGAGAGGGGCTGAGG + Intronic
901026049 1:6279288-6279310 AGGGCCGATGGGTGGCACGGTGG + Intronic
901299578 1:8189666-8189688 GGTGCCCATGGCTGGGGCAGGGG - Intergenic
901322113 1:8346196-8346218 ATGGCCCATGGGGGAGGCCGGGG - Intergenic
901456085 1:9363606-9363628 ACAGGCCATGGCTGGGGCTGGGG + Intronic
901844229 1:11971798-11971820 AGGGCCCAGGCGTGGGGCACAGG - Intronic
901926615 1:12570351-12570373 CGGGCCCATGTGAGGGCCTGGGG - Intronic
902063363 1:13664023-13664045 AGGGCCAAGAGGTGGCGCTGGGG + Intergenic
902383311 1:16062602-16062624 TGGGGCCCTGGGTGGGGGTGGGG + Intronic
902731629 1:18373682-18373704 AGAGCCCAAGGGTGGAGGTGGGG - Intronic
902745939 1:18474414-18474436 AGGGCACCTGGCTGGGTCTGGGG - Intergenic
903004171 1:20287700-20287722 AGGGCCTGTGGGTGGGGGTGAGG - Intergenic
903144554 1:21362577-21362599 AGGGGCTGTGGGTGGGGTTGCGG + Intergenic
903603106 1:24556278-24556300 AGGGCCCGGGGGTGGGGACGAGG + Intronic
903641494 1:24863182-24863204 AGGGACCTTGGGAGGGCCTGTGG - Intergenic
903739376 1:25549767-25549789 AAGGCCCATTGGTAGGGCTCAGG - Intronic
903879607 1:26500208-26500230 AGGGTCCAGGAGTGGGGTTGAGG - Intergenic
903884823 1:26535128-26535150 AGGGCCCAGGGGCTGGGCTGTGG - Intronic
903887927 1:26551746-26551768 AGGGCCCCGGGATGGAGCTGAGG + Intronic
904029514 1:27525638-27525660 AGGGCCCAAGGGGCCGGCTGGGG - Intergenic
904421577 1:30397846-30397868 AGGGCCCATGCCTGGTGCTGAGG + Intergenic
904442664 1:30541752-30541774 AGTGTCCTTGGGTGGGGCCGAGG - Intergenic
904836215 1:33338828-33338850 AAGGCCGATGGGAGAGGCTGGGG + Intronic
905002852 1:34686732-34686754 AGGTCACATGGGTGGGGCGTGGG - Intergenic
905230758 1:36513740-36513762 AGGGCCTATGGGAGAGGCAGTGG + Intergenic
905234554 1:36536929-36536951 CAGGCCCTTGGGTGGGGCTGGGG + Intergenic
905515860 1:38561544-38561566 TGGGGCCATGGGTGTTGCTGGGG + Intergenic
905630959 1:39518370-39518392 AGGGACTATGGCTGGGGTTGGGG + Intronic
905666801 1:39767806-39767828 AGGGACTATGGCTGGGGTTGGGG - Intronic
905886491 1:41494724-41494746 CAGGCCCAGGGCTGGGGCTGTGG + Intergenic
906175115 1:43764638-43764660 AGTCCCCATGGGGTGGGCTGAGG - Intronic
907414078 1:54302036-54302058 AGGGCGGCTGGGTGGGGGTGGGG + Intronic
907451174 1:54546871-54546893 ATGGCCCATGGATGGCCCTGAGG - Intronic
908289872 1:62654629-62654651 AGGGCCCATGTGTTAGGATGTGG - Intronic
908674908 1:66592407-66592429 AGGGCACAGGGTTGGGGCTAGGG + Intronic
909710677 1:78645989-78646011 AGGGCACAGGGGTGGAGGTGGGG + Exonic
910450039 1:87335165-87335187 GGGGCGCTTGGGTGGAGCTGAGG - Intronic
911114725 1:94235878-94235900 AGGGGGCATGCGTGGGGCAGCGG - Intronic
911166255 1:94727230-94727252 AGGGACCATGGGCGGGGGTGGGG - Intergenic
912704870 1:111904345-111904367 AAGGCCTATGGGTGGGGTTGGGG + Intronic
913531937 1:119739758-119739780 CAGGCCCCTGGGTGGGGCAGGGG + Intronic
913960529 1:143335499-143335521 AAGGCCCTGGGGTGGAGCTGAGG + Intergenic
914054884 1:144161071-144161093 AAGGCCCTGGGGTGGAGCTGAGG + Intergenic
914124262 1:144805290-144805312 AAGGCCCTGGGGTGGAGCTGAGG - Intergenic
914676662 1:149911493-149911515 GGAGCCCAGGGGTGGGGCTGAGG + Intronic
914847227 1:151289896-151289918 AGGCCTCAAGGGTGGGGGTGGGG + Exonic
915283712 1:154839730-154839752 AGGGCTCTTGGGGGTGGCTGAGG - Intronic
915537945 1:156548786-156548808 AAGGCCCATGGGAGGGACTCGGG - Intronic
915570862 1:156744453-156744475 TGGGCACCTGGGTGGGGGTGGGG - Intronic
916058649 1:161084690-161084712 GGGGCCCAGGGGAGTGGCTGGGG - Intronic
919464900 1:197915411-197915433 AGGGCCCTGAGGAGGGGCTGGGG - Intronic
919574147 1:199285847-199285869 AGGACTCATGGGTAGGGCTTTGG + Intergenic
919914232 1:202130096-202130118 AGGGACCAGAGGTGGGGCTGGGG - Exonic
919972955 1:202592391-202592413 AGGAGGCAGGGGTGGGGCTGGGG + Exonic
920061250 1:203228487-203228509 AGAGCCCAGGGAAGGGGCTGAGG + Intronic
920123646 1:203676721-203676743 AGAGCCCAGTGGTGGGGATGAGG - Intronic
920216213 1:204363138-204363160 AGGGGCCCTGGGAGGGGCGGGGG - Intronic
920646228 1:207806330-207806352 AGGGGCCAAGGGTGGAGCAGAGG + Intergenic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
920704297 1:208240587-208240609 ACTGCCCCTGGGTGGGGCGGTGG + Intronic
921032474 1:211345594-211345616 AGGACCCATTGGTGGGCCTTGGG + Intronic
921053365 1:211526693-211526715 ATGGGCCAGGGCTGGGGCTGAGG + Intergenic
921276342 1:213524406-213524428 AGGCCCCTGGGCTGGGGCTGGGG - Intergenic
922364844 1:224854170-224854192 AGCCCCCATGGGTGGGGCAGCGG - Intergenic
922616051 1:226961721-226961743 AGGGCCCCTGTGTGAGGCTGTGG + Intronic
922720354 1:227897053-227897075 GGGGACTCTGGGTGGGGCTGTGG - Intergenic
922791717 1:228314590-228314612 ATCTCCCATGGGTGGGGGTGAGG + Intronic
922801809 1:228367966-228367988 AGGGTGCATGGCTGGGGCAGTGG - Intronic
923820044 1:237428586-237428608 AGGGCCTCTCGGTGGGGCGGGGG + Intronic
1062795810 10:344371-344393 AGTCCCCAAGGGTGGGGCGGGGG + Intronic
1062830746 10:603951-603973 TGGGGCCAAGGGTGGGGCAGTGG - Intronic
1062837316 10:644230-644252 CGGGCCCAAGAGTGGGGATGGGG + Intronic
1063606357 10:7526282-7526304 AGGGCCCAGCAGCGGGGCTGAGG - Intergenic
1063771118 10:9201863-9201885 CGGGGCCAGGGTTGGGGCTGGGG + Intergenic
1064122532 10:12632386-12632408 AGGGCCCGTGGCTGGAGCAGAGG + Intronic
1064449178 10:15426181-15426203 AGAGCCCATGGTGGGGGCGGGGG + Intergenic
1064991778 10:21262717-21262739 CGGCCCCAAGGCTGGGGCTGGGG + Intergenic
1065634406 10:27715845-27715867 AGGACCTATGGGATGGGCTGGGG + Intronic
1066018865 10:31276581-31276603 AAGACCCATGGGTGAGGCAGTGG + Intergenic
1066345300 10:34579408-34579430 AGGGCACCTGGGAGGGGCAGGGG - Intronic
1067038935 10:42938422-42938444 AGGGCCCAGGAGCTGGGCTGGGG - Intergenic
1067107690 10:43376737-43376759 GGGGCCCATGGGGTGAGCTGAGG - Intergenic
1067217777 10:44316802-44316824 AGGGCTGGTGGGAGGGGCTGAGG - Intergenic
1067781276 10:49209214-49209236 AGGGCCCAGGAGTGGGGTTGGGG - Intergenic
1068218382 10:54011410-54011432 AGGGACCTTGGCTGTGGCTGTGG - Intronic
1069564104 10:69451706-69451728 AGGGCCCGGGGATGGGGGTGGGG + Intronic
1069661408 10:70126026-70126048 AGGGCCCAGGGGCTGGCCTGGGG + Intronic
1069788523 10:71004892-71004914 TGGGCCCGTGGCTGTGGCTGGGG + Intergenic
1071277129 10:84065593-84065615 AGGGAGCTTGGGTGGGGATGGGG - Intergenic
1071515316 10:86293106-86293128 ATGGCACATGGGTTGGGCAGAGG - Intronic
1072082518 10:92045843-92045865 AGGGCCCCTGGGTGCGGGAGGGG + Intergenic
1073054172 10:100688481-100688503 AGGGCAGATGGGAGGGGCTGAGG + Intergenic
1073357586 10:102869626-102869648 GGGGCCCAGGGAAGGGGCTGGGG - Intronic
1073379385 10:103066335-103066357 AGGCCCATTGGGAGGGGCTGAGG - Intronic
1073491214 10:103854832-103854854 AGGGCCCCTGGGGAGGGCCGAGG + Intronic
1074138093 10:110644666-110644688 AGGGACCACGGGTGCGCCTGGGG + Intronic
1074778376 10:116783158-116783180 AGTGCCAATGGGAAGGGCTGGGG + Intergenic
1075074709 10:119343031-119343053 AGGGTCCCAGTGTGGGGCTGGGG + Intronic
1075077162 10:119359186-119359208 AGAGGCCAGGGGTGGGGCTGGGG + Intronic
1075413188 10:122244169-122244191 AGGGAGCAGGGGTGGGGATGGGG - Intronic
1075435395 10:122436702-122436724 ATGGCCCATGGGTGATGGTGTGG + Exonic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076594299 10:131616324-131616346 AGGTCCCATAGGTGGGGATCTGG - Intergenic
1076627732 10:131832260-131832282 ATGGCTCATGGAAGGGGCTGAGG - Intergenic
1076667662 10:132102347-132102369 TGGACCCATGGACGGGGCTGAGG - Intergenic
1076717698 10:132374773-132374795 AGGACACCTGGGTGGGGCCGTGG + Intronic
1077229559 11:1452601-1452623 CGGGCCCTTGGGTGGGGCTGTGG - Intronic
1077229597 11:1452736-1452758 CGGGCCCTTGGGTGGGGCTGTGG - Intronic
1077234257 11:1472308-1472330 ACTGCCTGTGGGTGGGGCTGCGG - Intronic
1077336077 11:2005186-2005208 AGAGCACTTGGGTGGGGATGTGG + Intergenic
1077378572 11:2217289-2217311 GGTGCCCATGGGTGTGGCTGTGG - Intergenic
1077464308 11:2726317-2726339 AGGGCCCCTGGATGGGTTTGGGG + Intronic
1077481491 11:2816908-2816930 ACTGCCCAGGGGTTGGGCTGTGG - Intronic
1078145382 11:8718672-8718694 TGGGCCAAAGGGTGGGGGTGAGG + Intronic
1078628877 11:12983717-12983739 AGTGGACATGGGTGGGGGTGGGG - Intergenic
1080579739 11:33632445-33632467 AGGCCCCATCGATGGAGCTGGGG + Intronic
1080843631 11:36007007-36007029 AGGCCCACTGTGTGGGGCTGGGG - Intronic
1081702725 11:45162143-45162165 AGGGTCCAGGGCTGGTGCTGGGG - Intronic
1081764187 11:45597973-45597995 AGGGGCCAAGGGTAGAGCTGGGG + Intergenic
1081992794 11:47346715-47346737 AAGGCCCATGGGTGGGGTCCAGG - Intronic
1083225244 11:61280901-61280923 AGGGCCCCTGGGTGAGGAAGGGG + Exonic
1083262460 11:61530675-61530697 AGGGACCTCAGGTGGGGCTGAGG - Intronic
1083622532 11:64056237-64056259 TGGGCCCATGGGAGAGGCTGAGG + Intronic
1083799531 11:65038582-65038604 CAGCCACATGGGTGGGGCTGGGG - Exonic
1083945630 11:65921154-65921176 AGGGCCCGTGGGTGGGGCCTGGG + Intronic
1084039237 11:66531825-66531847 GGGGCTCCTGGGTGGGGGTGGGG + Intronic
1084125880 11:67098714-67098736 ATGCCCCATGGGTGGTACTGGGG - Intergenic
1084148578 11:67277727-67277749 AGGGCCCATGGGGTGGGGCGGGG - Intronic
1084792269 11:71482385-71482407 ATGCCCGATGGATGGGGCTGTGG + Intronic
1084930738 11:72553710-72553732 TGAGCCCAGGGCTGGGGCTGGGG + Intergenic
1084961044 11:72716879-72716901 GGGGCCAAGGGGTGGGCCTGTGG + Intronic
1084962070 11:72721988-72722010 CTGGCCCCTGGGTGGGTCTGAGG + Intronic
1084965274 11:72741321-72741343 AGGGTCCTGGGGTGAGGCTGTGG - Intronic
1085284214 11:75349696-75349718 AGGGCAGATGGATGTGGCTGGGG + Intronic
1085509754 11:77082300-77082322 AGGACCCCTGGGTGGGGTTCAGG - Intronic
1086840192 11:91675485-91675507 GGGACCCATGGTTGGGGCGGGGG + Intergenic
1086988001 11:93271046-93271068 ATGGACGATGGGTGGGGCGGGGG + Intergenic
1089598453 11:119597924-119597946 TGGGCCCATGGGAGAAGCTGGGG + Intergenic
1089690000 11:120181255-120181277 GGTGCCCATGGGAGGGGCTCTGG - Intronic
1090045108 11:123324738-123324760 AGGTGCCAGGGGTGGGACTGGGG - Intergenic
1090173469 11:124625815-124625837 AGGGCCCAGCACTGGGGCTGAGG + Exonic
1090329802 11:125922250-125922272 AAAGCCCATGGATGTGGCTGGGG + Intronic
1091224086 11:133947207-133947229 TGGGCCCAGGAGTGGTGCTGCGG - Intronic
1091356892 11:134944237-134944259 AGTCCCCATGGCAGGGGCTGGGG + Intergenic
1202819061 11_KI270721v1_random:60368-60390 AGAGCACTTGGGTGGGGATGTGG + Intergenic
1092201060 12:6583160-6583182 ACGGCCCATGGGTGGGGGGCGGG + Intronic
1093923019 12:24880952-24880974 TGGTCCCATCGGTGTGGCTGAGG - Intronic
1094874420 12:34625264-34625286 AGGGCCCATGGGTTGAATTGTGG + Intergenic
1095705679 12:45234721-45234743 AAAGCCCAGGGGTGGGGGTGGGG - Intronic
1095981199 12:47975702-47975724 CAGCCCCATGGGTGGGGCGGAGG + Intronic
1096239024 12:49949559-49949581 AGGGCCAGTGAGTGGGGCTGGGG + Intergenic
1096550703 12:52369957-52369979 TGAGCCCAGGGCTGGGGCTGGGG + Intergenic
1096782899 12:54001041-54001063 AGGGCCAGGGGATGGGGCTGGGG + Intronic
1097037925 12:56136310-56136332 AGGGGCCATGGATTGGGCAGAGG + Intronic
1097088690 12:56488252-56488274 GGGCCCGGTGGGTGGGGCTGGGG + Exonic
1097188118 12:57206439-57206461 AGAGGCCAGGGCTGGGGCTGTGG - Intronic
1097246597 12:57610890-57610912 AGGGGCCAGGGGTGGGGCGCGGG - Intronic
1098320801 12:69240685-69240707 GGGGCCCGGGGGTGGGGGTGGGG - Intronic
1100540047 12:95548893-95548915 CCGGCGCAGGGGTGGGGCTGTGG - Intronic
1100618476 12:96249778-96249800 GGCTCCCATCGGTGGGGCTGAGG + Intronic
1100798908 12:98211124-98211146 TGGGCCCAGGGCTGGGGCTTTGG - Intergenic
1101601710 12:106215418-106215440 AGGGGCTAAGGCTGGGGCTGGGG + Intergenic
1101711097 12:107267691-107267713 AGGGCCACAGGCTGGGGCTGGGG - Intergenic
1102005646 12:109587728-109587750 GGGGCCCAGGTGTGGCGCTGTGG - Intronic
1102040257 12:109796442-109796464 AGGGCCCTGGGGCTGGGCTGGGG - Intronic
1102776030 12:115519800-115519822 AGGGCCCTTAGCTGGGGGTGAGG + Intergenic
1103016459 12:117498461-117498483 CTGGCCCAGGGGAGGGGCTGAGG + Intronic
1103188185 12:118979873-118979895 AGGGCCCAGAGGTGGGGGTCAGG - Intergenic
1103364141 12:120369726-120369748 AGAGCCCTGGGGTGGGGGTGGGG - Intergenic
1103907828 12:124336302-124336324 AGGGAGCAGGGATGGGGCTGCGG - Intronic
1104765792 12:131329460-131329482 GGGTCCCTGGGGTGGGGCTGCGG - Intergenic
1104766342 12:131332817-131332839 AGGCCCCATGAGTCGGGGTGTGG + Intergenic
1104813065 12:131629780-131629802 AGGCCCCATGAGTCGGGGTGTGG - Intergenic
1104813476 12:131632402-131632424 GGGTCCCTGGGGTGGGGCTGCGG + Intergenic
1104940663 12:132393085-132393107 AGGAACCATGTGTGGTGCTGAGG + Intergenic
1104959612 12:132482328-132482350 AGGGCCAATGGGACTGGCTGGGG - Intergenic
1106207320 13:27612289-27612311 TGGGACCATGGCAGGGGCTGAGG - Intronic
1106563301 13:30864624-30864646 AGAGGCCAAGGCTGGGGCTGGGG + Intergenic
1107885334 13:44870443-44870465 AGGTCCCGTGGGTAGGGATGGGG + Intergenic
1108178305 13:47817098-47817120 ATGGGCCTTGGGTGAGGCTGAGG - Intergenic
1108590206 13:51906323-51906345 TGGGCCCAAGGGTGGAGCTATGG - Intergenic
1109299341 13:60574768-60574790 AGAGCCTAGGGGTGGGGTTGGGG + Intergenic
1112494375 13:99893784-99893806 AAGGCCCCTGGGTGGTGCGGAGG + Exonic
1112750112 13:102574430-102574452 AGGGCCTGGGGGTGGGGGTGGGG - Intergenic
1112762910 13:102710786-102710808 AGGGCCCAAAGGTCAGGCTGTGG - Intergenic
1113427600 13:110222219-110222241 AGATCCCATGGGTGTGTCTGAGG - Intronic
1113522632 13:110951486-110951508 TGGCCCCATGGGAGGGGGTGGGG + Intergenic
1113554178 13:111218029-111218051 AGGGCCCCAATGTGGGGCTGAGG - Intronic
1113618296 13:111696196-111696218 AGGCCCCATGGGTGTGTCTGGGG - Intergenic
1113623827 13:111781457-111781479 AGGCCCCATGGGTGTGTCTGGGG - Intergenic
1113670095 13:112170590-112170612 AGGGGTCCTGGGTGTGGCTGGGG - Intergenic
1114524491 14:23359511-23359533 AGGGCACTGGGGAGGGGCTGGGG + Exonic
1114614750 14:24062421-24062443 AGGGGCCATGCGGGGGACTGAGG + Intronic
1115528145 14:34301893-34301915 GGGGGCTAGGGGTGGGGCTGGGG - Intronic
1115823862 14:37242254-37242276 AGGGCCTATGAGTTGGGGTGGGG - Intronic
1115946088 14:38662400-38662422 AGGCACCATGGCTGGGGCAGGGG + Intergenic
1117988706 14:61413409-61413431 AGGGTACATGGGCGGGGCGGGGG - Intronic
1117995887 14:61478012-61478034 AGGCCCCTTGGCTGTGGCTGTGG - Intronic
1118323855 14:64768699-64768721 GGGGCCCGGGGGAGGGGCTGGGG - Intronic
1119073926 14:71616574-71616596 TGGGCAAATGGGTGGGGGTGGGG + Intronic
1119322687 14:73740969-73740991 AGAGCTGCTGGGTGGGGCTGTGG + Intronic
1119731444 14:76953705-76953727 AGGGGCCTGGGGTGGGGCGGAGG + Intergenic
1119777240 14:77256856-77256878 ATGGCCCATGGCTGGGGTGGTGG - Exonic
1120962537 14:90138752-90138774 AGGCCCCATGGGTGCAGCTATGG - Intronic
1121009565 14:90512148-90512170 GGGGCCCAGGGCTGGGCCTGGGG + Intergenic
1121013429 14:90534773-90534795 AGGGACCTGGGCTGGGGCTGGGG + Exonic
1121473723 14:94175079-94175101 TGGACCGATGGGTGGGCCTGGGG - Intronic
1121887289 14:97555303-97555325 AGGGTACATGGGTGGGGCAGTGG - Intergenic
1122116767 14:99531571-99531593 AGAGGCCATGGGTGGGGGGGGGG + Intronic
1122136583 14:99636287-99636309 TTGGCACATGGGTGGGGGTGGGG + Intergenic
1122207130 14:100153402-100153424 AGGGAGAATGGGTGGGGCTGGGG + Intronic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1122413477 14:101537702-101537724 AAGGTCCCTGAGTGGGGCTGGGG + Intergenic
1122556631 14:102584063-102584085 AGGGACCGGGGGTGGGGGTGGGG + Intergenic
1122649900 14:103220580-103220602 TGGGCCCGGGGGCGGGGCTGGGG + Intergenic
1122817431 14:104320626-104320648 AGGGGCCGTGGGTGGTGATGAGG - Intergenic
1122817441 14:104320652-104320674 AGGGGCCGTGGGTGGTGATGAGG - Intergenic
1122863308 14:104592090-104592112 GGAGCCCATGGGAGGGGCAGAGG + Intronic
1122885141 14:104707538-104707560 AGGGAGCAGGGGTGGGGGTGGGG - Exonic
1122930465 14:104931066-104931088 CAGCACCATGGGTGGGGCTGTGG + Intronic
1122944324 14:104999052-104999074 AGGGCCCATGGGTGTGGCAAAGG + Intronic
1122968813 14:105144164-105144186 GTGGCCCATAGGTGGGGGTGGGG - Intronic
1123118290 14:105904611-105904633 GGGCCCCATGGGGAGGGCTGTGG + Intergenic
1124438439 15:29670174-29670196 AGGATCCATGGTGGGGGCTGGGG + Intergenic
1124918292 15:33998161-33998183 ATGGCCCATTGCTGGGGCTTGGG - Intronic
1126817281 15:52466362-52466384 CTGGTCCATGGGTGGGGTTGGGG - Intronic
1126890758 15:53201683-53201705 AGAGTGCATGGCTGGGGCTGGGG + Intergenic
1127293681 15:57591884-57591906 AAGGCCCGGGGGTGGGGCCGGGG - Intergenic
1127388637 15:58487725-58487747 AGGTGCCAGGGGTGGGGATGGGG - Intronic
1127546631 15:59999307-59999329 AGGGCCTCTGGCTGTGGCTGGGG - Intergenic
1127626921 15:60788744-60788766 ATGGGCCGTGGGTGTGGCTGAGG - Intronic
1127910414 15:63411634-63411656 GGGGCCCAGGGGTGGGGGTGGGG + Intergenic
1128245698 15:66131259-66131281 ATGGCCCATGGGTGGCCATGTGG - Intronic
1128317262 15:66668927-66668949 TGGGCCCATGGGTGGAATTGAGG - Intronic
1128528981 15:68431508-68431530 AGGGCTGAAGGGTGGGGGTGAGG - Intronic
1129269130 15:74410284-74410306 AGAGCCCATGGGTCGGGGAGTGG - Exonic
1129409085 15:75338958-75338980 GGGACCCGTGGGTGGGGCAGGGG - Intronic
1129682882 15:77667926-77667948 AGGGCCCAGGGCTGGGGCTGAGG + Intronic
1130034234 15:80342792-80342814 AGGGTTCAGGGATGGGGCTGGGG - Intergenic
1130105194 15:80923547-80923569 AGGGCTCATGGGTGCAGGTGGGG + Intronic
1130302360 15:82689481-82689503 AGGGCACAAGGGTGGGGATGGGG + Intronic
1130972104 15:88741559-88741581 AGGGTGCCAGGGTGGGGCTGAGG - Intergenic
1131349898 15:91690028-91690050 ATGGACCAGGGGTGGGGGTGTGG + Intergenic
1132647152 16:1004373-1004395 CAGGCCCAGGAGTGGGGCTGGGG - Intergenic
1132664065 16:1073647-1073669 CGGGCACGTGGGTGGGTCTGGGG - Intergenic
1132669362 16:1096362-1096384 CGTGCCCATGAGCGGGGCTGGGG + Intergenic
1132673989 16:1114179-1114201 AGGGCTGGTGAGTGGGGCTGAGG - Intergenic
1132745242 16:1433680-1433702 AGGGCCCCCAGGTGAGGCTGAGG + Intergenic
1132779288 16:1614137-1614159 AGGGGCTAGGGCTGGGGCTGCGG + Intronic
1132786236 16:1658366-1658388 TGGGCTCATGGGAGGGGCTGAGG + Intronic
1132887111 16:2187124-2187146 AGGGGCAGTGGCTGGGGCTGGGG - Intronic
1132887743 16:2189907-2189929 GGAGGCCAGGGGTGGGGCTGGGG - Intronic
1132945117 16:2528161-2528183 GGGCCCCAGGGGCGGGGCTGGGG + Intronic
1132997839 16:2832517-2832539 AGGCCCGCTGGGTGGGCCTGGGG - Intronic
1133034784 16:3028590-3028612 GGGGCCCCTGGGTGGGAGTGGGG + Intronic
1133223172 16:4327905-4327927 AGGGCCCAGGGGTTGGGGCGAGG - Intronic
1134277959 16:12793281-12793303 GTGGCCAGTGGGTGGGGCTGTGG + Intronic
1134450526 16:14360642-14360664 AGGGACCAGGGCTGGGGCTAGGG + Intergenic
1134749669 16:16615858-16615880 AGGTCCTATGGGTGGGGGTAAGG + Intergenic
1134995801 16:18737766-18737788 AGGTCCTATGGGTGGGGGTAAGG - Intergenic
1135467617 16:22700951-22700973 AGGAGCCATGGGTAGGGCTTGGG + Intergenic
1135548419 16:23380666-23380688 AGGGCCCAGTGTTGGGGCTGCGG - Exonic
1136609965 16:31360190-31360212 GGGGCCTCTGGGTGGGACTGGGG + Intronic
1137526931 16:49244697-49244719 GGAGCCCAGGGGTGGGGATGGGG - Intergenic
1138206774 16:55131061-55131083 ACAGCCCAGGGGTGGGGCAGGGG + Intergenic
1138531578 16:57637359-57637381 AGGGACTATGGGTGGGGCTGGGG + Intronic
1138532790 16:57643870-57643892 AGGACCCATGGGTGCGGCTGAGG + Intronic
1138657695 16:58500480-58500502 AGAGCCCATAGCAGGGGCTGGGG + Intronic
1139355380 16:66364422-66364444 GGGCCCCAGGGGTGGGGCTGGGG - Intergenic
1139573263 16:67826290-67826312 AGGCCCCAGGAGTGGGGCTTGGG + Intronic
1141188506 16:81806696-81806718 AGGGTCCAGGTGTGGGGCTGGGG + Intronic
1141642113 16:85347382-85347404 AGGGCGCTTGGGTGCTGCTGGGG - Intergenic
1141950622 16:87336821-87336843 AGGGCGGACTGGTGGGGCTGCGG - Intronic
1142175486 16:88643248-88643270 GGGGCCGGTGGGCGGGGCTGGGG - Intergenic
1142302453 16:89266567-89266589 TGGGCCCCTGCGTGGGGTTGGGG - Intergenic
1142709284 17:1714825-1714847 ATGGCCCAGGGAGGGGGCTGGGG + Intergenic
1142859027 17:2749725-2749747 AGGGGCCGTGGGCGGGGCGGGGG + Intergenic
1142883990 17:2901435-2901457 TGGGTCCCTGGGTGGGTCTGGGG + Intronic
1142962159 17:3557738-3557760 AAGGCCCCCGGGTGGGACTGTGG + Exonic
1143023294 17:3927660-3927682 GGGGCCAATGGGTGGGGGTGGGG - Intronic
1143131707 17:4682636-4682658 AGGGCCCTTGTGGGGTGCTGGGG - Intronic
1143471129 17:7176955-7176977 AGGGCGCTGGGGCGGGGCTGGGG - Intronic
1143978155 17:10845271-10845293 GGTGCCCAAGGGCGGGGCTGTGG + Intergenic
1144196673 17:12901436-12901458 AGGACTCATGGGTGGGGCCATGG + Intronic
1144342019 17:14318041-14318063 AGGGGCAATGAGTGGGGATGAGG - Intronic
1144490442 17:15704324-15704346 AGGGGGCCTGGGAGGGGCTGAGG - Intronic
1144670588 17:17130581-17130603 TGGGCCCAGGGTTGGGGATGGGG - Intronic
1144721885 17:17476847-17476869 ACGGGCCGTGGGTGGGTCTGGGG - Intergenic
1144738703 17:17569215-17569237 AGGGCCAAGGGCTGGGGCTTTGG + Intronic
1144740755 17:17580901-17580923 AGGGTCCATGGGGAGGGCTCTGG - Intronic
1144783663 17:17820182-17820204 AGGGCCCCTGGCAGGGGCTGTGG + Exonic
1144831374 17:18133176-18133198 AGGGAGCTTGGGTGGGGCTGGGG - Intronic
1144833528 17:18144679-18144701 GGGGCTCATGGGTTGGGCTTGGG - Intronic
1144910526 17:18677645-18677667 AGGGGGCTTGGGAGGGGCTGAGG + Intronic
1145253574 17:21310488-21310510 AGTCCCCCTGGGTGGGGCTCTGG + Intronic
1145323002 17:21777473-21777495 AGTCCCCCTGGGTGGGGCTCTGG - Intergenic
1146403825 17:32520398-32520420 AGAGCCAAGGGGTGTGGCTGGGG + Intronic
1147157741 17:38552713-38552735 AGAGCTCAAGGGTGGGTCTGGGG - Exonic
1147191802 17:38742221-38742243 AAAGCCCAGGGGTGGGGCTTGGG + Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1147951730 17:44111336-44111358 AGGCCCCATGGGGGGGGAGGCGG + Intronic
1149394954 17:56230875-56230897 ATGCCCCATTGGTGGGGGTGAGG + Intronic
1149660891 17:58333384-58333406 AGGGCCCCTGGCTGGGGGAGGGG + Intergenic
1149661933 17:58338527-58338549 AGGGCCCATAACTGGGGCAGGGG - Intergenic
1150610770 17:66731401-66731423 AGGGCTCAGGGATGTGGCTGTGG + Intronic
1151367784 17:73628550-73628572 AAGGCCCATGAGTGGGGTTAGGG - Intronic
1151477637 17:74352974-74352996 AGGGCACAGGGTGGGGGCTGGGG - Intronic
1151522679 17:74641562-74641584 AGGGGAGGTGGGTGGGGCTGGGG - Intergenic
1151660231 17:75515051-75515073 AGTGCCCCTGGGTTGGGCTTGGG - Intronic
1151697207 17:75723745-75723767 AGGGCCCGTGGGCAGGGCAGAGG + Intronic
1152040541 17:77899936-77899958 AGGGCTGGAGGGTGGGGCTGGGG - Intergenic
1152268373 17:79309436-79309458 GGCCCCCATGGGTGGGGCAGAGG - Intronic
1152273719 17:79341547-79341569 AGGCAGCATGGCTGGGGCTGGGG + Intronic
1152527073 17:80894356-80894378 AGGGCCCTGCGGTCGGGCTGGGG + Intronic
1152554265 17:81045296-81045318 AGGGCCCCAGGCTGGGGCTGGGG + Intronic
1152567805 17:81107963-81107985 AGCGCCCAGGTGTGGCGCTGGGG - Intronic
1152579645 17:81160314-81160336 TGCGGCCTTGGGTGGGGCTGGGG - Intronic
1152693618 17:81733155-81733177 AGGGCCAATGGGTGGGAAAGGGG - Intergenic
1152710107 17:81867152-81867174 AGGGCACTTGGCTGCGGCTGTGG + Intergenic
1152863296 17:82708799-82708821 TGGGGCCATGGGCGGGGCTGTGG - Intergenic
1152928555 17:83098893-83098915 AGGTCCCACGGGTGGGGGTGGGG + Intergenic
1153000837 18:454113-454135 GGGGCCCATGGGGAGGGCTTTGG - Intronic
1153910000 18:9698366-9698388 AAGGCCAATGAGTGGGGCTGTGG - Intergenic
1154004977 18:10519441-10519463 AGGGCATATGGGTGGGGTTGTGG - Intergenic
1154293689 18:13131967-13131989 AGCACCCATGAGTGGGGATGGGG + Intergenic
1154383834 18:13875734-13875756 AGACCCCAGGGGTGGGGCTGCGG + Intergenic
1154497764 18:14975052-14975074 AGGGGCTGGGGGTGGGGCTGGGG - Intergenic
1157443210 18:47725761-47725783 AAGGACCCTGGGTGGGGCTAGGG - Intergenic
1157618931 18:49004092-49004114 AGAGACTCTGGGTGGGGCTGGGG + Intergenic
1157818622 18:50749448-50749470 TGGGCCAAGGGGTGGGGCTTGGG - Intergenic
1160395846 18:78572020-78572042 AGGACCCGTGGGTGGTGGTGAGG + Intergenic
1160395866 18:78572079-78572101 AGGGCCCGTGAGTGGTGGTGGGG + Intergenic
1160395879 18:78572117-78572139 AGGACCCATGGGTGGTGGCGGGG + Intergenic
1160395900 18:78572174-78572196 AGGACCCATGGGTGGTGGTGGGG + Intergenic
1160455492 18:78996110-78996132 AGGGCCCATGGGAGGGGCGCTGG + Intronic
1160552682 18:79705088-79705110 AGGGCTGTTGGGTGGGGCCGCGG + Intronic
1160583724 18:79901455-79901477 AGGGCACAGGGCTGGGGCTCAGG + Intergenic
1160682311 19:417459-417481 AGGTCGCATGGCTGGGGCTCCGG + Intronic
1160710551 19:549190-549212 GGGGCGCCCGGGTGGGGCTGGGG + Intronic
1160722609 19:604118-604140 AGGCCCCAGGGGTGGGGCTATGG + Intronic
1160722652 19:604241-604263 AGGCCCCAGGGGTGGGGCTATGG + Intronic
1160733071 19:649867-649889 AGGGACCCTGGCTGGGGATGGGG + Intronic
1160733108 19:649959-649981 AGGGACCCTGGCTGGGGATGGGG + Intronic
1160733185 19:650143-650165 AGGGACCCTGGCTGGGGATGGGG + Intronic
1160739873 19:680747-680769 AGGTCACATGGGTGGCGGTGGGG + Intronic
1160856843 19:1221585-1221607 AGCCCCCGAGGGTGGGGCTGGGG - Intronic
1160883607 19:1334275-1334297 TGGAACCTTGGGTGGGGCTGGGG + Intergenic
1161027258 19:2042401-2042423 AGGGCCCGCGGGGAGGGCTGGGG - Intronic
1161059540 19:2208081-2208103 AGGGTCCATGGGTGGGGTCTGGG + Intronic
1161237698 19:3206079-3206101 TGGGGCCAGGGGTGGGGCCGGGG - Intronic
1161276898 19:3423509-3423531 GTGATCCATGGGTGGGGCTGGGG + Intronic
1161333606 19:3699723-3699745 AGGACACACTGGTGGGGCTGCGG - Intronic
1161466393 19:4433039-4433061 AGGGAACATGGGTGGGCATGAGG - Intronic
1161467145 19:4437295-4437317 GGGACCCAAAGGTGGGGCTGTGG + Intronic
1161659915 19:5539695-5539717 AGGGCTGATGTGTGAGGCTGGGG + Intergenic
1161735862 19:5991755-5991777 AGGCCCCATGGGCAGGGCTCGGG + Intergenic
1161810782 19:6470054-6470076 AGGGGCCGTGGGCGGGGCGGAGG + Intronic
1161988766 19:7672023-7672045 GGGGCACATGGGTGTGTCTGTGG - Intergenic
1162064911 19:8119427-8119449 AAGGCCCTGGGGTGGGCCTGAGG - Intronic
1162306280 19:9876199-9876221 AGCGCCCGTGGTAGGGGCTGGGG + Intronic
1162416958 19:10544045-10544067 AGGGCCCAGGTGGGGGGCTGCGG - Exonic
1162489581 19:10984313-10984335 CAGGCCCCTGGGTGGGGATGGGG - Exonic
1162531487 19:11238667-11238689 CAGGCCCTTGGGTGGGGCTTAGG - Intronic
1162796142 19:13088614-13088636 AGGGCCCAGGGATGGAGGTGAGG - Intronic
1163299575 19:16435399-16435421 AGGGGCCATGAGTGAGGCAGTGG + Intronic
1163426676 19:17244361-17244383 GGGGCCCAGCGGTGGGGGTGGGG - Intronic
1163460631 19:17435443-17435465 CAGGCCCATGGGTGGGACTTGGG - Intergenic
1163601172 19:18250086-18250108 TGGGGGCATGGATGGGGCTGGGG - Intronic
1163885537 19:19961714-19961736 CGGGCACAGGGTTGGGGCTGGGG - Intergenic
1163949668 19:20571950-20571972 ACAGCCCATGTGTTGGGCTGTGG + Intronic
1163968411 19:20769953-20769975 ACAGCCCATGTGTTGGGCTGTGG - Intronic
1164647454 19:29870172-29870194 AGGGCCGGGGGGTGGGGGTGGGG - Intergenic
1164672027 19:30077686-30077708 AGAGGCCATGGGAGGGGCAGAGG - Intergenic
1164748739 19:30635613-30635635 AGAGCTCCTGGGTGTGGCTGGGG + Intronic
1164767341 19:30781949-30781971 AGGTGCCCTGGGTGGGGTTGGGG + Intergenic
1165136548 19:33673416-33673438 AGGGACCCTGGGTGGGGCAGGGG + Intronic
1165476139 19:36032246-36032268 GGCGCTCCTGGGTGGGGCTGGGG + Exonic
1165578006 19:36838276-36838298 AGGGCCCGAGGCCGGGGCTGAGG - Intronic
1165778406 19:38418169-38418191 AGGGCCAAGGGGTGGGGCCACGG + Intronic
1165855957 19:38879384-38879406 AGGGTCCAGGGATGGGGCTCAGG + Intronic
1165955305 19:39498853-39498875 AGGGACCAAGGGCGGGGCGGGGG - Intergenic
1165994833 19:39836715-39836737 AGGCCCCATGGGAGGATCTGGGG - Intronic
1166267258 19:41691937-41691959 AGAATCCAGGGGTGGGGCTGGGG + Intronic
1166369324 19:42292494-42292516 GGGGACCCAGGGTGGGGCTGAGG + Intronic
1167077307 19:47257409-47257431 ATGGCCCATGGGTGGGGGCGGGG + Intronic
1167174045 19:47853163-47853185 AGAGGCCAGGTGTGGGGCTGAGG + Intergenic
1167383905 19:49153186-49153208 GGGGCCCTGGGGTGGTGCTGTGG - Intronic
1167614701 19:50526061-50526083 AGGGCCCAGGGGAGGGACAGGGG - Intronic
1167648311 19:50717401-50717423 AGGGCCGGGGGGTGGGGTTGGGG + Intronic
1167702643 19:51059778-51059800 AGGCCCCATAGGAGTGGCTGGGG - Intronic
1167706558 19:51084525-51084547 AGGGGCTAGGGGAGGGGCTGAGG - Intergenic
1167712389 19:51120397-51120419 GGGGCCCTGGGGTGGGGCTCTGG + Intergenic
1167768526 19:51499856-51499878 AGGGCCGCAGGGTAGGGCTGAGG - Intronic
1167793164 19:51692899-51692921 AGGGTCCCTGAGTGGGGCTGGGG - Intergenic
1168255321 19:55161616-55161638 GGGGCCCAGGAGAGGGGCTGGGG - Intronic
1168365252 19:55781137-55781159 AGGGGCCGGGGCTGGGGCTGGGG + Intergenic
1168695173 19:58400163-58400185 GGAGGCCAGGGGTGGGGCTGGGG + Intergenic
1202694365 1_KI270712v1_random:113746-113768 AAGGCCCTGGGGTGGAGCTGAGG + Intergenic
925292247 2:2755726-2755748 AGGGCCCCTGGGCGGTGGTGTGG - Intergenic
925592740 2:5526422-5526444 GGGGCCCAGGGTTGGGCCTGGGG - Intergenic
926171950 2:10558164-10558186 TGGGCCCAAGGGTAGGGGTGAGG - Intergenic
926684808 2:15690548-15690570 GGGGACCATGGGAGAGGCTGAGG - Intergenic
926905999 2:17806172-17806194 AGAGCCGATGGGTGTGGCTATGG + Intergenic
927104060 2:19809251-19809273 GGGGGCCATGGGTGGGGGCGGGG - Intergenic
927112385 2:19872949-19872971 AGTGCCCCTGGGTAGGACTGAGG + Intergenic
927130444 2:20054133-20054155 TGGGCCGGTGGGTGGGGGTGGGG - Intergenic
928134669 2:28679439-28679461 TGGGCCTGTGGGTTGGGCTGGGG - Intergenic
928437137 2:31261887-31261909 AGGGGCCATGTCTGGGCCTGGGG + Intronic
929938577 2:46313287-46313309 CAGCCTCATGGGTGGGGCTGAGG - Intronic
930014504 2:46961079-46961101 AGGGGCCATGGCAGGGCCTGGGG - Intronic
930702504 2:54472693-54472715 TGGGTACCTGGGTGGGGCTGGGG + Intronic
931038902 2:58275163-58275185 AAGGCACATGTCTGGGGCTGAGG - Intergenic
931198615 2:60076191-60076213 AGGGCCAATTCGTGGGGCCGGGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
931653839 2:64492030-64492052 AGGGACCAAGGGCGGGGGTGCGG + Intergenic
932086585 2:68767860-68767882 AGGCAAAATGGGTGGGGCTGAGG + Intronic
932417216 2:71580596-71580618 AAGACCTATGGCTGGGGCTGGGG + Intronic
932571788 2:72942128-72942150 AAGGCCCCTGGGAGTGGCTGAGG + Exonic
933419262 2:82025795-82025817 AGGCCCCATGGGTCTTGCTGGGG + Intergenic
933952196 2:87340818-87340840 AAGGCCCTGGGGTGGAGCTGAGG - Intergenic
934236440 2:90237156-90237178 AAGGCCCTGGGGTGGAGCTGAGG - Intergenic
934490481 2:94759233-94759255 AGAGCCTATGAGAGGGGCTGGGG + Intergenic
934519890 2:95013500-95013522 AGGGCCCATGGGAGCTGCGGTGG - Intergenic
934973945 2:98787179-98787201 AGGGCTCAGGGGTGGGGCTGGGG + Intergenic
936493971 2:113001640-113001662 AGTGCACAGGGTTGGGGCTGGGG - Intergenic
936501912 2:113073356-113073378 AGGGTCCATGGGAGGGGCAGAGG - Intronic
936709315 2:115113463-115113485 TGGGCCAAGGGGTGGGACTGGGG - Intronic
937043048 2:118835846-118835868 AGGGGCGATGGCTGGAGCTGCGG + Intergenic
937875759 2:126824111-126824133 TGTGCCCATGGTTGGGGCTCAGG + Intergenic
937982358 2:127623100-127623122 AGGGCCCATGGGCTGGGGAGAGG + Intronic
938139482 2:128784176-128784198 AGGCACCGTGGGTGGGGCGGGGG + Intergenic
938263862 2:129912667-129912689 AGGGCACAGAGGAGGGGCTGAGG + Intergenic
938278402 2:130048377-130048399 AGAGCCAATGAGAGGGGCTGGGG + Intergenic
938329378 2:130439236-130439258 AGAGCCAATGAGAGGGGCTGGGG + Intergenic
938360570 2:130682267-130682289 AGAGCCAATGAGAGGGGCTGGGG - Intergenic
938436973 2:131288975-131288997 AGAGCCAATGAGAGGGGCTGGGG - Intronic
938762958 2:134441919-134441941 AGTGCCCTGGGGTGGGGGTGGGG + Intronic
941247043 2:163111780-163111802 TGGGGCTATGGGTGGGGGTGGGG - Intergenic
941718378 2:168787295-168787317 AGTGCCCATGGGGAGGGATGAGG - Intronic
941878513 2:170459541-170459563 TGGGCTCCTGGGTGGGGGTGGGG - Intronic
941934683 2:170973667-170973689 AGGGCCCCTGGGCGGGGCCGGGG + Intergenic
942911536 2:181250470-181250492 GAGGCCCATGGGTGGGGGTTGGG - Intergenic
946180789 2:217947766-217947788 AGGGGCCCTGGGTGGGGCTGGGG - Intronic
946375761 2:219308252-219308274 AGAGGGCATGGGTGGGGCTGGGG + Intronic
946902293 2:224384162-224384184 AAGGCCCAGTGGAGGGGCTGTGG - Intronic
947535049 2:230934915-230934937 AGGGGTCCTGGGTGGGGGTGGGG - Intronic
947542024 2:230986261-230986283 AGGGGCCAGGGGTGGGGAAGTGG - Intergenic
948024308 2:234764911-234764933 GAGGCCCAGGGGAGGGGCTGGGG - Intergenic
948369739 2:237481080-237481102 TGGGCCCATGAGGGGGGCTCTGG + Intergenic
948465617 2:238150353-238150375 AGTGCCCCTGGGAGGGGTTGTGG - Intronic
948513227 2:238487266-238487288 TGAGCACATAGGTGGGGCTGAGG - Intergenic
948537570 2:238657689-238657711 AGGGCCCAGGTGGGAGGCTGTGG + Intergenic
948896426 2:240929986-240930008 ATGGCCCCAGGGTGGGGTTGGGG + Intronic
1168865323 20:1081127-1081149 AGGGACCATGGTTGGGGCTTTGG - Intergenic
1169208740 20:3754194-3754216 GGGCCGCATGGGTGGGGCCGGGG - Intronic
1169226487 20:3860161-3860183 TGGACCTATGGGTGGGGCGGGGG + Intronic
1169268566 20:4182285-4182307 AGGGCCTCTGGGGCGGGCTGAGG - Exonic
1170434870 20:16315873-16315895 AGGTCCTACAGGTGGGGCTGGGG + Intronic
1170568516 20:17620085-17620107 AGGGCCCGTGGCTGGGTCTCAGG + Intronic
1170769181 20:19317515-19317537 ATGGCCCATGGGCCTGGCTGTGG - Intronic
1170949795 20:20926271-20926293 AGGAAGCATGGGTGGGGGTGGGG + Intergenic
1171111032 20:22482727-22482749 AGGGCCCAAGGAGTGGGCTGAGG + Intergenic
1171223388 20:23421054-23421076 AGGGACCCTGGGGGGGCCTGTGG + Intronic
1172274802 20:33673750-33673772 TGGGGCCATGGGTGGCCCTGCGG - Intronic
1172332033 20:34081948-34081970 AGAGCCCATGGTGGAGGCTGAGG + Intronic
1172525572 20:35599174-35599196 TGGGGCCTTGGGTGGGGGTGTGG - Intergenic
1172528904 20:35617406-35617428 AGGGGCCGGGGGTGGGCCTGGGG - Intronic
1172641428 20:36442675-36442697 AAGGACCAGGGCTGGGGCTGGGG - Intronic
1172740882 20:37165991-37166013 AGCCCCCATGTGTGGGCCTGTGG + Intronic
1172763250 20:37336621-37336643 AGGGCTCTGTGGTGGGGCTGGGG - Intergenic
1172804080 20:37598578-37598600 AGAGCCCACGGGTGGGGGCGGGG + Intergenic
1173136441 20:40443239-40443261 AGATCCCCTGGGTGGGGCTGTGG - Intergenic
1173646459 20:44636157-44636179 GGGGCCTCTGGGTGGAGCTGGGG + Intronic
1173811768 20:45960170-45960192 AGGGCTGGTGAGTGGGGCTGGGG + Intronic
1173855812 20:46250064-46250086 GGGGCCCATGTGTGATGCTGGGG - Intronic
1174049360 20:47757123-47757145 AGGGTCCCTGGGTTAGGCTGAGG - Intronic
1174382967 20:50169224-50169246 AGGGCACATGGGTGGCTCAGGGG - Intergenic
1174787318 20:53444866-53444888 AGGAGCCAGGGGTTGGGCTGGGG - Intronic
1175220566 20:57414326-57414348 AGGAGGCATGGGTGGGGCTTAGG - Intergenic
1175241407 20:57552217-57552239 AGGGCCCATGGGGTGGTTTGGGG - Intergenic
1175819052 20:61898649-61898671 AGGGACCAAGGGTGGGGCCAGGG - Intronic
1175907295 20:62387159-62387181 CGGGCTCAGGGCTGGGGCTGGGG + Intronic
1175940847 20:62536904-62536926 AGGGGCCAAGGGTGGCTCTGGGG - Intergenic
1175960592 20:62634564-62634586 AGGGCCTCTGGATGGGGGTGGGG - Intergenic
1175972166 20:62692146-62692168 AGGCCCCAGGGGTGGGTCTTGGG - Intergenic
1176024469 20:62978709-62978731 AGGGGCCATGGAGGGGGCGGAGG - Intergenic
1176052839 20:63129753-63129775 GGGGCCCGGGGGTGGGGATGGGG - Intergenic
1176147891 20:63573575-63573597 AGGACCCCTGGCTGGGGCAGAGG - Intronic
1176260687 20:64177929-64177951 AGAAACCCTGGGTGGGGCTGGGG + Intronic
1179022736 21:37654905-37654927 AAGGCCAATGGGTAGGCCTGTGG + Intronic
1179625978 21:42650029-42650051 GGGGACCTTGGGTGGGGATGAGG - Intergenic
1179625989 21:42650054-42650076 GGGGACCCTGGGTGGGGTTGAGG - Intergenic
1179905739 21:44422125-44422147 AGGGCCCTTGGTACGGGCTGAGG - Intronic
1180128010 21:45805176-45805198 AGGCCACAGGGGTGTGGCTGTGG - Intronic
1180749757 22:18116144-18116166 AGGGCCCACGTGTGCAGCTGGGG - Intronic
1180842560 22:18966111-18966133 AGGCCGGCTGGGTGGGGCTGGGG - Intergenic
1180949709 22:19715495-19715517 AGGCCCCTGGGGTGGGGCGGGGG + Intronic
1180982537 22:19885577-19885599 GGGCCCCATGGGCAGGGCTGGGG + Intronic
1181055650 22:20259450-20259472 AGGGCCCATGTGTCAGGCCGAGG + Intronic
1181100806 22:20537547-20537569 AGGACCCCTAGGAGGGGCTGAGG - Intronic
1181590780 22:23883726-23883748 AGGGACCATGGCTGGGTGTGTGG + Intronic
1181638540 22:24185310-24185332 AGGGCCCAGGAGAGGGGATGAGG + Intronic
1182282633 22:29226156-29226178 GGGGGCCATGGATGAGGCTGAGG - Intronic
1182303503 22:29352095-29352117 AGGCCCCATGGGACGGGCTTGGG + Intronic
1182316927 22:29453908-29453930 AGTGCCTATGGTTGAGGCTGGGG + Intergenic
1182422329 22:30254555-30254577 AGGGTCCAGGGGTGGGGTGGGGG - Intergenic
1182475180 22:30573265-30573287 AGAGGTCATGGGTTGGGCTGGGG + Intronic
1182484291 22:30630092-30630114 AGGGCACATGGGAGGGGCTGTGG - Intergenic
1182555704 22:31127316-31127338 ATGGCTCATGGGCGGGGCTTAGG - Intronic
1183294735 22:37022857-37022879 AGGGCACATGGCTGGGTGTGTGG - Intronic
1183316990 22:37142315-37142337 AGGCCCAATGGCTGGGGCTGTGG - Intronic
1183428330 22:37751326-37751348 CGGGCCCATGGGAGGGTCCGTGG + Intronic
1183597926 22:38823309-38823331 AAGGCCCATGGCTGAGGCAGTGG + Intronic
1183601110 22:38841175-38841197 GGGGCCTCTGGGAGGGGCTGGGG - Intronic
1183605150 22:38863705-38863727 TGGGCCCCTGGGGGTGGCTGGGG - Exonic
1183608245 22:38879624-38879646 AAGGCACATGGGTGGGCTTGGGG + Intergenic
1183627643 22:39014466-39014488 GGAGCCCAGAGGTGGGGCTGGGG - Intronic
1183632369 22:39041066-39041088 GGAGCCCAGGGCTGGGGCTGGGG - Intronic
1183638187 22:39077467-39077489 GGAGCCCAGGGCTGGGGCTGGGG - Intronic
1183641822 22:39097431-39097453 GGAGCCCAGGGCTGGGGCTGGGG - Intronic
1183931773 22:41239595-41239617 AGGGGACATGGGTGGAGCTCCGG + Exonic
1184102360 22:42347514-42347536 AGGGCCTGGGGCTGGGGCTGCGG - Intergenic
1184240121 22:43207445-43207467 AGGGGCCAGGGCTGGGGCAGGGG + Intronic
1184247383 22:43242510-43242532 AAGGCCCATGGGTGAGGAGGAGG - Intronic
1184388933 22:44192119-44192141 AGGGCCCATGGGTGGGGCTGGGG + Intronic
1184411817 22:44330517-44330539 TGGCCCCAGGGGTGAGGCTGGGG + Intergenic
1184464458 22:44660640-44660662 AGGGCTCAGGGGTGAGGCCGAGG + Intergenic
1184777833 22:46632166-46632188 AGGGGCCCTGGGTGGGCTTGAGG + Intronic
1184806562 22:46798396-46798418 AGGGGGCAGGGGTGAGGCTGGGG + Intronic
1184847883 22:47100267-47100289 AGGGCACAAGAGTGAGGCTGTGG + Intronic
1184852433 22:47128247-47128269 AGGGGGGATGGGTGGGGCGGGGG - Intronic
1185098077 22:48822413-48822435 GGGTCCCATGGGTGGGCCTGTGG - Intronic
1185098108 22:48822514-48822536 GAGTCCCATGGGTGGGCCTGTGG - Intronic
1185151174 22:49164721-49164743 GGGGGCCGTGGGTGGGGCTGTGG - Intergenic
1185151189 22:49164758-49164780 TGGGGCTGTGGGTGGGGCTGTGG - Intergenic
1185151209 22:49164807-49164829 GGGGGCCGTGGGTGGGGCTGTGG - Intergenic
1185151224 22:49164844-49164866 GGGGGCTGTGGGTGGGGCTGTGG - Intergenic
1185279698 22:49964797-49964819 AGGCCCCTGGGGTGGGGGTGGGG - Intergenic
1185374391 22:50475313-50475335 ACGGCCCAGGGGTGGGGTTCGGG - Intergenic
1185381295 22:50508474-50508496 TGGGCCGGCGGGTGGGGCTGCGG + Intronic
949799136 3:7884118-7884140 AGTGCTTTTGGGTGGGGCTGGGG + Intergenic
950143023 3:10628177-10628199 AGGGCCCATGGCCAGGGCTTTGG + Intronic
950462784 3:13135319-13135341 TGGCCCTATGGGTGGGGCTCAGG + Intergenic
950580721 3:13860303-13860325 AGGGAGCTGGGGTGGGGCTGAGG - Intronic
950652129 3:14413698-14413720 TGGGGCCGGGGGTGGGGCTGGGG + Intronic
950667199 3:14504869-14504891 AGGGGCCACGCGTGGAGCTGGGG + Intronic
951041958 3:17997969-17997991 CAGGCCCATGGGGAGGGCTGTGG + Intronic
952386081 3:32842765-32842787 AGGGTTCTTGGGTGGGGGTGGGG - Intronic
952908864 3:38165535-38165557 TTGGCCCGTGCGTGGGGCTGGGG + Exonic
953193723 3:40713018-40713040 AGGACCCACGGTTGGGTCTGTGG - Intergenic
953385191 3:42502295-42502317 AGCGCCCTGGGATGGGGCTGAGG + Intronic
954063441 3:48088299-48088321 AGGGATTATGGGTGGGGCTGAGG - Intronic
954304266 3:49717237-49717259 AGGGCCTCTGGCTGGGGCTTAGG + Exonic
954370706 3:50168392-50168414 AGTGCCCAAGAGTGGGTCTGTGG + Intronic
954401303 3:50321229-50321251 AGGCCCCACGTGTGGGGCGGGGG - Exonic
954439988 3:50516569-50516591 CTGGCCCAGGGGTGGGCCTGGGG - Intergenic
954577506 3:51684674-51684696 AGGCCCCTTGGGTGGAGCTGAGG + Intronic
954784476 3:53082791-53082813 AGGGCAGTTGGGTGGGGGTGGGG + Intronic
955988692 3:64601979-64602001 CGAGCACATGGGTGCGGCTGGGG + Exonic
956715038 3:72071771-72071793 AGTTCTCAGGGGTGGGGCTGGGG - Intergenic
956872885 3:73435588-73435610 ATGGACCAAGGGTGGGGATGAGG - Intronic
959258677 3:104048089-104048111 ATGACCCCTGGGTGGGGATGAGG - Intergenic
960084475 3:113575905-113575927 AGGGCACATTGGAGGGGCAGGGG + Intronic
960394245 3:117117025-117117047 AGGCCCCAGGGGAGGAGCTGTGG - Intronic
961352174 3:126311052-126311074 AGGGTCCCAGGCTGGGGCTGGGG + Intergenic
961524998 3:127490954-127490976 GGGGCCCTGGGGAGGGGCTGAGG - Intergenic
961652726 3:128425360-128425382 AGGGCCCCGAGGTGTGGCTGTGG + Intergenic
961658450 3:128455971-128455993 AGGGCCCAGGGAGGAGGCTGGGG + Intergenic
961754936 3:129121875-129121897 TGGGCCCGAGGGTTGGGCTGGGG - Intronic
961780443 3:129317394-129317416 AGGGCACAGGAGTGGGGCTGGGG + Intergenic
962007674 3:131363695-131363717 AGGGCCCCTGGGATGAGCTGTGG - Intergenic
962274287 3:134000398-134000420 AGGGCCGATGGGAGGTGTTGAGG + Intronic
962374758 3:134850617-134850639 AGGGGCTATGGGTGAGTCTGGGG + Intronic
965590230 3:170356131-170356153 AGGGAACTTGGGTGGGGGTGCGG + Intergenic
966828219 3:183983542-183983564 CGGGCCCATGGGAGGGTCTCTGG - Intronic
968001450 3:195209528-195209550 AGGGCCCAAGTGTGCGGCTTCGG - Intronic
968042301 3:195598921-195598943 AGGGCTGATGGGTGGGGGTCAGG - Intergenic
968440822 4:623681-623703 AGGGCCCTGGGGTGGGGCTGGGG - Intergenic
968757766 4:2425798-2425820 AGGTCCCCTGGGAGGGGCTCTGG + Intronic
968916872 4:3500472-3500494 AGGGCTGCTGGGTGGGGCTGGGG - Intronic
969057815 4:4413242-4413264 AGGGCCCAGGGGTTGGGCATGGG + Intronic
969174107 4:5385920-5385942 GGGGGCTGTGGGTGGGGCTGTGG - Intronic
969174153 4:5386051-5386073 AGGGGCTATGGGTGGGGCTGTGG - Intronic
969317970 4:6393631-6393653 ACTGCCCATGGGAGGGGCAGTGG - Intronic
969325441 4:6441396-6441418 GGGGCTCATGGGGCGGGCTGAGG - Intronic
969477253 4:7428651-7428673 AAGGCCCTGGGGTGGGCCTGGGG + Intronic
969694201 4:8725570-8725592 AGGGGCCAGGGGCGGGGCAGAGG + Intergenic
970146751 4:13043980-13044002 CAGTCCCATGGCTGGGGCTGGGG - Intergenic
972778677 4:42266293-42266315 AGAGCCCATGGGTGGGGGGAAGG - Intergenic
975810517 4:78163969-78163991 AGGGCCAGTGGGTGGGGCAGTGG - Intronic
977941158 4:102860894-102860916 AGGGCTCATGGGTGAGCCTATGG + Intronic
978338530 4:107696551-107696573 AGGGCCTATCGGTGGGGAGGTGG + Intronic
978822322 4:112980092-112980114 AGGGGCCAGGGGAGTGGCTGAGG - Intronic
979486331 4:121275049-121275071 AGGGGCCAGGGGTGGGAATGGGG - Intergenic
984172767 4:176380786-176380808 TGGACCCAGGGGTGGGGATGGGG + Intergenic
984704343 4:182836843-182836865 AGGGGCCAGGGCTGTGGCTGGGG - Intergenic
985081489 4:186269592-186269614 AGGGGCCAGGGGAAGGGCTGAGG + Intronic
985529170 5:423870-423892 AGGGCCCAGGAGTGGGGCACAGG + Exonic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985627902 5:999531-999553 TGGGGCCATGTGTGGGGCGGTGG + Intergenic
985719627 5:1482407-1482429 GGGGCCAGGGGGTGGGGCTGCGG + Intronic
985732509 5:1557220-1557242 AGGGCCCGGGTGTGGAGCTGTGG + Intergenic
985781806 5:1875579-1875601 AGGGCCACGGGGAGGGGCTGGGG + Intergenic
985988736 5:3538351-3538373 AAGGCCCATAGGAGGGGCTGAGG - Intergenic
985988770 5:3538469-3538491 AGGATGCAGGGGTGGGGCTGTGG - Intergenic
986047186 5:4050456-4050478 AGGGCCAAATGGTGAGGCTGGGG - Intergenic
986161357 5:5232409-5232431 AGTGGCCATGGGTGGGCTTGGGG - Exonic
987083313 5:14445935-14445957 ACCGCCCCTGCGTGGGGCTGGGG - Intronic
988528546 5:32007805-32007827 AGGGGCCAGGGAGGGGGCTGGGG - Intronic
989099916 5:37813902-37813924 AGGCTCCATGTGTGTGGCTGTGG + Intronic
990200455 5:53366981-53367003 TGTGCCCAAGGATGGGGCTGTGG - Intergenic
990486365 5:56262948-56262970 AGGGACTTTGGCTGGGGCTGGGG + Intergenic
990748486 5:58985521-58985543 AAGGCACATGGGGGGCGCTGGGG - Intronic
990914550 5:60889974-60889996 AGGTCCCAGGGAAGGGGCTGAGG + Intronic
991445932 5:66699749-66699771 AGGGCCTGTTGGTGGGGCGGGGG + Intronic
991489384 5:67167057-67167079 AGGGCCCAGGGGCAGGACTGTGG + Exonic
991974407 5:72172016-72172038 AGGTCCCTTGGGTTGGGCTAAGG + Intronic
992352916 5:75949332-75949354 GGGACCCATTGGTGGGGCTTGGG + Intergenic
996312515 5:122122808-122122830 AGGGCCCATGGTAAGGGATGAGG - Intergenic
997356746 5:133267333-133267355 AGGACCCATGAGAGGGCCTGGGG + Intronic
997363484 5:133310538-133310560 AGTTCCCATGAGTGGGTCTGGGG - Intronic
997606211 5:135177292-135177314 AGGGTCCATGGGAGGTGGTGAGG + Intronic
999249050 5:150170996-150171018 ATGGCCCATTGGGGTGGCTGAGG + Intronic
999261637 5:150242078-150242100 AGGGGCAGTGAGTGGGGCTGAGG + Intronic
999685433 5:154098468-154098490 AGGACCCATAGCTGGAGCTGGGG + Intronic
1001490550 5:172151774-172151796 AGGCCCCATGGTGGGGGCTGGGG - Intronic
1002134555 5:177099661-177099683 GAGGCCCATGGGTTGGGCTGCGG + Intergenic
1002309597 5:178306531-178306553 AGGACCCATGGGGGAGGGTGTGG + Intronic
1002377073 5:178796460-178796482 AGGGCTCATTGGTGGGGGTGCGG + Intergenic
1002576972 5:180179396-180179418 AGGGCCGATGGATGGGCCAGTGG + Intronic
1003313271 6:4987467-4987489 ATGGCCAATGGCTGGGGTTGGGG + Intergenic
1005031754 6:21515244-21515266 AGAGCCCAGTGGTGGGGCTTTGG - Intergenic
1005170615 6:22980655-22980677 ACAGCCCATGTGTTGGGCTGTGG - Intergenic
1005842517 6:29752945-29752967 GCGGCCCGTGGGAGGGGCTGAGG - Intergenic
1005871485 6:29977031-29977053 GCGGCCCGTGGGAGGGGCTGAGG - Intergenic
1006033977 6:31197734-31197756 GCGGCCCGTGGGAGGGGCTGAGG + Intergenic
1006058000 6:31400014-31400036 GCGGCCCGTGGGAGGGGCTGAGG + Intronic
1006397791 6:33798424-33798446 AGGGCCGATTGTTGGGGCTGGGG - Intronic
1006606335 6:35259986-35260008 AGGGACCCTGGGTGGGGGAGGGG - Intronic
1006795851 6:36731924-36731946 TGGGCCCATGGGTGCAGCTGGGG - Intronic
1007109501 6:39304713-39304735 TGGGCCCAGGAGTGGGGCTGTGG - Intronic
1007109972 6:39307703-39307725 AGGTGGCTTGGGTGGGGCTGTGG - Intronic
1007174544 6:39887072-39887094 AGGGCCTCTGGGTTGGGCAGTGG + Intronic
1007428055 6:41759855-41759877 GGGGCCCATGACGGGGGCTGGGG + Intergenic
1007451382 6:41942027-41942049 AGGGCCCGTGGGTGGGTAGGAGG - Intronic
1008130807 6:47718836-47718858 AGGGGGTATGGGTGGGGTTGCGG + Intronic
1010412451 6:75575892-75575914 AGGGCCAATCGGTGGTGGTGGGG + Intergenic
1012476699 6:99621515-99621537 AGGGGGCAGAGGTGGGGCTGGGG + Intergenic
1013369074 6:109454967-109454989 GGGGGCCGTGGGTAGGGCTGGGG + Intronic
1013613473 6:111818569-111818591 TGGGCCCCTGGGATGGGCTGTGG - Intronic
1014080475 6:117281108-117281130 ATGACCACTGGGTGGGGCTGTGG + Intergenic
1014146092 6:117999489-117999511 ATAGCCCAGGGGTGGGGGTGGGG - Intronic
1017906280 6:158759289-158759311 AGAGCCCAGGGGCGGGTCTGTGG - Intronic
1018003618 6:159600967-159600989 TATGGCCATGGGTGGGGCTGGGG - Intergenic
1019322053 7:420271-420293 AGGGCCCAGGGATGGGTCTCTGG - Intergenic
1019324540 7:431813-431835 CGGCCCCATGGCTGGGGCTGTGG + Intergenic
1019417602 7:934562-934584 AAGTCCCACGAGTGGGGCTGGGG + Intronic
1019487195 7:1294763-1294785 TGGGTGCATGGGTGGGTCTGTGG + Intergenic
1019555018 7:1624970-1624992 AGGTCCCATGAATGGGGGTGTGG + Intergenic
1019574011 7:1727530-1727552 AGGCCCCTTGAGTGGGGCTGGGG - Intronic
1019575213 7:1734516-1734538 AGGGCTCAGGGCTGGGGCTGGGG - Intronic
1019641480 7:2106004-2106026 CGGGGCCATGTGTGGGGCAGGGG - Intronic
1019686308 7:2384028-2384050 TGGGCCCAGGGAGGGGGCTGGGG - Intergenic
1019716316 7:2541081-2541103 AGGGTCCTAGGGTGGGGGTGGGG - Intronic
1019725914 7:2602655-2602677 AGGGGACATGGGTGGGGCAGGGG - Intronic
1019927975 7:4205873-4205895 CGGGGCCATGGCCGGGGCTGAGG - Exonic
1020078223 7:5272824-5272846 CGGGCCCCTTGGTGAGGCTGAGG - Intergenic
1020109470 7:5439945-5439967 AGGGCTCAAGGGCAGGGCTGGGG + Intronic
1020258948 7:6519941-6519963 AGTGCCCACAGGTGGGGCTCTGG + Intronic
1020272590 7:6606282-6606304 AGGGCCCCCAGGAGGGGCTGAGG - Intronic
1020279732 7:6644099-6644121 ATGGCCCCTGGGTGGGGCGGGGG + Intronic
1020280774 7:6648964-6648986 AAGGCTCAGGGCTGGGGCTGGGG - Intronic
1022101401 7:27171492-27171514 AGGTCCCATTGTTGGCGCTGAGG - Exonic
1023092178 7:36627680-36627702 AGGGGCCATGGATTGGGATGGGG - Intronic
1023390840 7:39710237-39710259 AGGCACCATTGATGGGGCTGGGG + Intergenic
1023803144 7:43852187-43852209 AGGGGCCCTGGGTTGGGCAGGGG + Intergenic
1023999177 7:45179733-45179755 AGGGCCCTTGCCAGGGGCTGAGG + Intronic
1024494152 7:50023873-50023895 TGAGCCCATCAGTGGGGCTGGGG + Intronic
1024505393 7:50158135-50158157 ATGGCCCATGGGTGAGGCCCAGG + Intronic
1025084038 7:56008278-56008300 AGAGCCCATCCATGGGGCTGTGG - Intergenic
1025200670 7:56959365-56959387 CGGGCCCCTTGGTGAGGCTGGGG + Intergenic
1025671273 7:63617567-63617589 CGGGCCCCTTGGTGAGGCTGGGG - Intergenic
1025942039 7:66082011-66082033 AGGGGCCTTGGGTGGGGCTTGGG - Intronic
1027250754 7:76397484-76397506 AGGGGCGATGGGCGGGGCCGGGG - Intronic
1029125996 7:98295583-98295605 AAGGGCCATGGCTGGGCCTGAGG + Intronic
1029397206 7:100316663-100316685 AGGACCCATGGGAGAGGCAGGGG - Intronic
1029489217 7:100861308-100861330 CGGGCTCAGGCGTGGGGCTGGGG + Intronic
1030232301 7:107221269-107221291 AGACCCCAGGGGTGGGGGTGGGG + Intronic
1030499980 7:110348238-110348260 AGTCACCATGGGTGGGGGTGAGG - Intergenic
1031075292 7:117206532-117206554 ATGGCCTATGTTTGGGGCTGCGG + Intronic
1031565119 7:123286799-123286821 AGGGCAAATGGGTGGGGATAGGG - Intergenic
1032000916 7:128264865-128264887 TGGGGCTATGGGTAGGGCTGGGG + Intergenic
1032015616 7:128378772-128378794 AGGGCCACTGGGAGGGGGTGAGG - Intergenic
1032086111 7:128884751-128884773 AGGGCACAGTGGTGGGGCTGGGG - Intronic
1032597171 7:133253302-133253324 AGAGCCCTGGGGAGGGGCTGCGG - Intronic
1032938914 7:136766210-136766232 AGTGCCCATGGAAGGTGCTGAGG - Intergenic
1033597574 7:142868062-142868084 AGAGGAAATGGGTGGGGCTGGGG + Intronic
1034162766 7:149005117-149005139 TGAGCCCGTGGCTGGGGCTGGGG - Intronic
1034569546 7:151944296-151944318 TGGGCCCGGGGCTGGGGCTGTGG - Intergenic
1035371642 7:158382939-158382961 ATGGACCATGGTTGGGGGTGTGG - Intronic
1035404477 7:158588416-158588438 AGGGCCCAGGGCGTGGGCTGGGG + Intergenic
1035450503 7:158974208-158974230 AGGGCCCGTGGGTGGGGCCTGGG + Intergenic
1035638153 8:1162824-1162846 AGGTCCCCTGGGTGCTGCTGTGG + Intergenic
1035650939 8:1264271-1264293 AGGGGCCTGGGATGGGGCTGGGG + Intergenic
1035675249 8:1451498-1451520 TGGGACCAGGGGTGGTGCTGAGG - Intergenic
1036153411 8:6319931-6319953 TGGGCCCATGGAGGGGGATGGGG - Intergenic
1036282982 8:7417345-7417367 AGGGACCCTGGGAGGGGCTCAGG + Intergenic
1036744059 8:11391485-11391507 CTGGCCCATGGGAGGCGCTGGGG + Intronic
1036770891 8:11577754-11577776 AGGGCCCAGCAGTGGAGCTGGGG + Intergenic
1037368712 8:18149972-18149994 AGGGCCCATGCTTAGTGCTGGGG - Intergenic
1037550022 8:19961502-19961524 GGTACACATGGGTGGGGCTGCGG - Intronic
1037908990 8:22732398-22732420 AGGGCCCATGGTGGGGGCGTGGG + Intronic
1038424558 8:27456038-27456060 AGGAGCCCTAGGTGGGGCTGTGG + Intronic
1038494126 8:27989810-27989832 AGGGCCTCTAGGTGGGGCCGCGG + Intronic
1038583593 8:28770677-28770699 AGGGCACCTGCGTGAGGCTGTGG - Intronic
1038615074 8:29086206-29086228 AGAGCCCAGGGTGGGGGCTGGGG + Intronic
1038805885 8:30790792-30790814 AGCTCCCAGGGCTGGGGCTGTGG - Intronic
1038841529 8:31188809-31188831 ATGGACCATGGGTGGGGAGGGGG + Intergenic
1039922831 8:41905308-41905330 AGGGCCCGGGGGAGGGGCAGTGG - Intergenic
1040323147 8:46328545-46328567 GGGCCCCATGGGTGGTGGTGGGG - Intergenic
1041748448 8:61234062-61234084 AGGGATGATGGGAGGGGCTGAGG + Intronic
1042591421 8:70402587-70402609 CGGGCCCCTGGGGGGTGCTGGGG - Intronic
1042659811 8:71142019-71142041 AGGGCACATGTGTGGGGTGGGGG + Intergenic
1042875262 8:73435544-73435566 AGAGCCCAAGGGTGGGGTTGAGG - Intronic
1043226178 8:77733974-77733996 GGAGCCCGGGGGTGGGGCTGGGG - Intergenic
1044049065 8:87476873-87476895 AGAGTCCATGGGTGGGGCTAGGG + Intronic
1044810008 8:96050522-96050544 AGGACATATGGGTGGGGGTGGGG + Intergenic
1045370848 8:101521215-101521237 AGGGCCATGGGGTGGGGGTGAGG + Intronic
1046660046 8:116938743-116938765 AGGACCCATGGTGGGGGGTGGGG + Intronic
1047676829 8:127211862-127211884 TGGGGCCATGGGTGGGGTTTGGG - Intergenic
1048189675 8:132276454-132276476 AGAGCCCATTGCAGGGGCTGGGG - Intronic
1049203283 8:141352002-141352024 GGGGCCGAGGGGAGGGGCTGCGG - Intergenic
1049268511 8:141682079-141682101 GAGGCCCCTGGGCGGGGCTGGGG - Intergenic
1049310262 8:141930457-141930479 AGGGCCCAAGGATGGGTCTCAGG - Intergenic
1049419275 8:142509875-142509897 CAGGACCTTGGGTGGGGCTGGGG + Intronic
1049467229 8:142757117-142757139 AGGCCCCATGTGGGAGGCTGTGG + Intergenic
1049577849 8:143397872-143397894 AGGGCGGATGTGTGGGGGTGGGG + Intergenic
1049685650 8:143938274-143938296 AGGGCCTATTGGTGGCTCTGGGG - Intronic
1049757926 8:144318982-144319004 ACAGGCCATGGGTGGGGCAGGGG + Intronic
1050280250 9:4043129-4043151 TGGGACCTTGAGTGGGGCTGTGG - Intronic
1050495121 9:6232665-6232687 TGGGCCCAGGGTTGGGGATGGGG - Intronic
1051202207 9:14639357-14639379 AGGGTGCATGGGTGGAGCGGGGG + Intronic
1052799718 9:32956195-32956217 AGGGTCCCTGGGTGGGGGAGGGG - Intergenic
1053001086 9:34577750-34577772 AGGTCCCAGGGATGGGGCCGGGG - Intronic
1053522384 9:38793158-38793180 AGGGCCTGTCGGTGGGGGTGGGG - Intergenic
1053667519 9:40326471-40326493 AGAGCCAATGAGAGGGGCTGGGG - Intronic
1053917100 9:42951574-42951596 AGAGCCAATGAGAGGGGCTGGGG - Intergenic
1054454153 9:65420930-65420952 AGGGCCCCTGAGTGAGGGTGGGG - Intergenic
1054517092 9:66049814-66049836 AGAGCCAATGAGAGGGGCTGGGG + Intergenic
1055308341 9:74952772-74952794 AGGGCCTAGGGCTGGGGCTCCGG + Exonic
1055426852 9:76205357-76205379 AGGGCCCTCGTATGGGGCTGGGG + Intronic
1055785396 9:79864813-79864835 TGGGCTGAGGGGTGGGGCTGGGG - Intergenic
1055828966 9:80358395-80358417 TGGGCTGAGGGGTGGGGCTGGGG + Intergenic
1056548769 9:87634763-87634785 AGGGACCGTGGGTGGAGTTGGGG - Intronic
1056939063 9:90939635-90939657 AGGGCCCAAGGGTAGGGTGGCGG + Intergenic
1057125204 9:92611244-92611266 AGGGGCCATGGGAGGGGCACGGG - Intronic
1057505252 9:95628110-95628132 AGGAACCATGGCTGTGGCTGAGG - Intergenic
1057758891 9:97857216-97857238 AGAGCCCAGGCGTGGGACTGGGG + Intergenic
1057928112 9:99170749-99170771 GGGGAGCAGGGGTGGGGCTGGGG + Intergenic
1058161114 9:101571571-101571593 GGTGCCCAGGGGTGGGGGTGAGG + Exonic
1060552697 9:124492997-124493019 GGGGCCCAGGGGCGGGGCCGAGG + Intronic
1060937175 9:127522376-127522398 TGCGCCCAAGGGTGGGGCGGGGG + Intronic
1060939476 9:127535350-127535372 AAGGCCCCTGGGCTGGGCTGGGG + Intronic
1061133223 9:128719851-128719873 TGGGCCTCTGGGTGGGGGTGGGG + Intronic
1061149414 9:128820424-128820446 GGAGACCCTGGGTGGGGCTGGGG + Exonic
1061597998 9:131645026-131645048 AGGACCCAGGGATGGGGATGAGG - Intronic
1061802293 9:133119304-133119326 AGGGCCCAAGGGAGGGGGCGGGG - Intronic
1061817702 9:133206541-133206563 AGAGCTCGGGGGTGGGGCTGGGG + Intronic
1061817743 9:133206706-133206728 AGAGCTCAGGGGTGGGACTGGGG + Intronic
1062035191 9:134379809-134379831 AGGCCCCAGGGTTGGAGCTGGGG - Intronic
1062040429 9:134401914-134401936 TGGGGCCTGGGGTGGGGCTGTGG + Intronic
1062242650 9:135548478-135548500 AGAGCTCAGGGGTGGGACTGGGG - Intronic
1062242670 9:135548562-135548584 AGAGCTCAGGGGTGGGGCTGGGG - Intronic
1062287250 9:135778650-135778672 AGGGCCCGTGGCTGAGGATGCGG - Intronic
1062287293 9:135778859-135778881 AGGGCCCGTGGTCGTGGCTGTGG - Intronic
1062287305 9:135778895-135778917 AGGGCCCGTGGTCGTGGCTGTGG - Intronic
1062287317 9:135778931-135778953 AGGGCCCGTGGTCGTGGCTGTGG - Intronic
1062287327 9:135778967-135778989 AGGGCCCGTGGTCGTGGCTGTGG - Intronic
1062331815 9:136048207-136048229 AGGGGCCCTGGGTGGGCCTTGGG + Intronic
1062351728 9:136142892-136142914 AGGATCCCTGGGTGGGGGTGGGG + Intergenic
1062379091 9:136278224-136278246 AGGGGCATTTGGTGGGGCTGGGG - Intergenic
1062451166 9:136616412-136616434 AGGGGGCATGGGAGGCGCTGGGG - Intergenic
1062511758 9:136910053-136910075 GGGTCCCGTGGGTGGGGGTGGGG + Intronic
1062569416 9:137178251-137178273 AGGGCTCAGGGGTGACGCTGTGG + Intronic
1062581160 9:137229834-137229856 AGGGGCCGGGGCTGGGGCTGGGG + Intergenic
1186975338 X:14896344-14896366 AGAGCCAATGAGTGGGCCTGAGG - Intronic
1187023256 X:15406618-15406640 AGGGCCCAGGGGTGTGGGTGGGG + Intronic
1188549062 X:31342166-31342188 AGGGCTCCTGGGTGGGAGTGGGG + Intronic
1190344061 X:49321808-49321830 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190345155 X:49331353-49331375 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190346249 X:49340919-49340941 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190347501 X:49531948-49531970 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190348602 X:49541504-49541526 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190349703 X:49551060-49551082 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190350807 X:49560613-49560635 AGGGCCCTGGGTTGGGGGTGGGG + Intronic
1190351908 X:49570171-49570193 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190353009 X:49579720-49579742 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190354110 X:49589267-49589289 AGGGCCCTGGGTTGGGGGTGGGG + Intergenic
1190355212 X:49598791-49598813 AGGGCCCTGGGTTGGGGGTGGGG + Intronic
1190485469 X:50919293-50919315 AGGGTGCGTGGGTGGGGGTGGGG + Intergenic
1190590999 X:52000983-52001005 AGGGAGCATGGGAGGGGGTGAGG + Intergenic
1190702608 X:52999742-52999764 AGGCCCCATGACTAGGGCTGGGG - Intergenic
1190732488 X:53234732-53234754 TGGCCCCACAGGTGGGGCTGAGG + Exonic
1190735031 X:53250544-53250566 TGGGCCCAGTGGTGTGGCTGGGG - Exonic
1191815497 X:65240583-65240605 AGGGCTCACAGCTGGGGCTGAGG - Intergenic
1192146524 X:68686442-68686464 ATGGCCCAGGCGCGGGGCTGGGG + Intronic
1192183262 X:68929515-68929537 AGGGCACCTGGGTGGGGGAGGGG - Intergenic
1192209793 X:69120550-69120572 AGGGAGCATGGGCCGGGCTGGGG - Intergenic
1192264978 X:69531750-69531772 AGGGCACAGGGGTAGGGTTGGGG - Exonic
1192995211 X:76505859-76505881 AGGAGCCAGGGGTGGGGGTGGGG - Intergenic
1193402443 X:81062074-81062096 AGGGCGGGTGGGAGGGGCTGAGG - Intergenic
1194510185 X:94783849-94783871 AGGGCTCTGGGGTGGTGCTGGGG - Intergenic
1195714223 X:107803068-107803090 AGGAGCCAGGGGTGGGGATGGGG + Intergenic
1195923312 X:110003017-110003039 AGGGCCGGAGGGTGGAGCTGGGG + Intronic
1197774373 X:130110227-130110249 GGGGCCCCGGCGTGGGGCTGGGG - Intronic
1197911831 X:131491371-131491393 GGGACCCCTGGGTGTGGCTGGGG + Intergenic
1198311156 X:135426418-135426440 AGGGCCCCTGGGTGGGGGTGGGG + Intergenic
1198369319 X:135974508-135974530 GGGGCCGAGGGGCGGGGCTGGGG + Intergenic
1198773536 X:140155842-140155864 AGGGGCCTTGGGTGAGACTGAGG + Intergenic
1200108005 X:153725097-153725119 AGGCCCCCGGGGTGGTGCTGGGG - Exonic
1200397345 X:155999004-155999026 AGGGCCCAAGGGTTGAGCAGTGG - Intronic
1201416185 Y:13751543-13751565 AGGGCCCGTGGGCGGGTCTCTGG - Intergenic
1201593205 Y:15637772-15637794 GAGGCCAATGGGTGGGGCTCAGG - Intergenic