ID: 1184389936

View in Genome Browser
Species Human (GRCh38)
Location 22:44197498-44197520
Sequence CACGTGGCCACCATGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184389936_1184389941 11 Left 1184389936 22:44197498-44197520 CCACCTCACATGGTGGCCACGTG No data
Right 1184389941 22:44197532-44197554 TGTGATATGGTGTGGCAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 160
1184389936_1184389939 -2 Left 1184389936 22:44197498-44197520 CCACCTCACATGGTGGCCACGTG No data
Right 1184389939 22:44197519-44197541 TGAGAAGTTTGTGTGTGATATGG 0: 1
1: 0
2: 1
3: 31
4: 312
1184389936_1184389944 19 Left 1184389936 22:44197498-44197520 CCACCTCACATGGTGGCCACGTG No data
Right 1184389944 22:44197540-44197562 GGTGTGGCAGCATGGCAGGGTGG 0: 1
1: 0
2: 4
3: 57
4: 495
1184389936_1184389940 3 Left 1184389936 22:44197498-44197520 CCACCTCACATGGTGGCCACGTG No data
Right 1184389940 22:44197524-44197546 AGTTTGTGTGTGATATGGTGTGG 0: 1
1: 1
2: 9
3: 72
4: 569
1184389936_1184389943 16 Left 1184389936 22:44197498-44197520 CCACCTCACATGGTGGCCACGTG No data
Right 1184389943 22:44197537-44197559 TATGGTGTGGCAGCATGGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 160
1184389936_1184389942 15 Left 1184389936 22:44197498-44197520 CCACCTCACATGGTGGCCACGTG No data
Right 1184389942 22:44197536-44197558 ATATGGTGTGGCAGCATGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184389936 Original CRISPR CACGTGGCCACCATGTGAGG TGG (reversed) Intronic
No off target data available for this crispr