ID: 1184391699

View in Genome Browser
Species Human (GRCh38)
Location 22:44206884-44206906
Sequence GGGCCCCAGAGTCACCCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 259}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184391690_1184391699 8 Left 1184391690 22:44206853-44206875 CCACACCCACCTGCTTCTCACTC 0: 1
1: 1
2: 5
3: 72
4: 775
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391688_1184391699 10 Left 1184391688 22:44206851-44206873 CCCCACACCCACCTGCTTCTCAC 0: 1
1: 0
2: 6
3: 64
4: 674
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391683_1184391699 30 Left 1184391683 22:44206831-44206853 CCACCTTTTCCAGCCCAGCTCCC 0: 1
1: 0
2: 3
3: 65
4: 675
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391684_1184391699 27 Left 1184391684 22:44206834-44206856 CCTTTTCCAGCCCAGCTCCCCAC 0: 1
1: 0
2: 5
3: 74
4: 677
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391687_1184391699 16 Left 1184391687 22:44206845-44206867 CCAGCTCCCCACACCCACCTGCT 0: 1
1: 1
2: 9
3: 111
4: 1061
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391693_1184391699 3 Left 1184391693 22:44206858-44206880 CCCACCTGCTTCTCACTCGGGAG 0: 1
1: 1
2: 0
3: 4
4: 113
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391689_1184391699 9 Left 1184391689 22:44206852-44206874 CCCACACCCACCTGCTTCTCACT 0: 1
1: 0
2: 7
3: 38
4: 484
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391694_1184391699 2 Left 1184391694 22:44206859-44206881 CCACCTGCTTCTCACTCGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 172
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391686_1184391699 17 Left 1184391686 22:44206844-44206866 CCCAGCTCCCCACACCCACCTGC 0: 1
1: 2
2: 8
3: 92
4: 901
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391685_1184391699 21 Left 1184391685 22:44206840-44206862 CCAGCCCAGCTCCCCACACCCAC 0: 1
1: 0
2: 8
3: 169
4: 1493
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259
1184391696_1184391699 -1 Left 1184391696 22:44206862-44206884 CCTGCTTCTCACTCGGGAGGATG 0: 1
1: 0
2: 25
3: 70
4: 202
Right 1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 29
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184391699 Original CRISPR GGGCCCCAGAGTCACCCTCC AGG Exonic
900088864 1:910556-910578 GGGCCCCTCAGGCTCCCTCCCGG + Intergenic
900185021 1:1328873-1328895 GCACCCCAGCGTCTCCCTCCTGG - Exonic
900402847 1:2479675-2479697 GGGGCCCAGCGTCCCCCTGCTGG - Intronic
900690231 1:3976413-3976435 GGTCACCAGAGCCGCCCTCCAGG - Intergenic
901879792 1:12187050-12187072 GGGTCTCTGAGTGACCCTCCAGG - Intronic
901927296 1:12574470-12574492 GGGCCTCAGAATCACCATCATGG - Intronic
902448815 1:16484172-16484194 GGGCGCCAGACGCTCCCTCCAGG + Intergenic
902685069 1:18071141-18071163 GGGCTGCACAGTCAGCCTCCTGG + Intergenic
903331483 1:22599281-22599303 GGTCCCCACAGTCACTCACCAGG + Intronic
904035640 1:27557184-27557206 GGACCCGAGGGTCACCCTGCCGG + Intronic
904037364 1:27566019-27566041 GGGCTCCAGAGTCACCCCAAAGG - Intronic
904256960 1:29260147-29260169 GCGCCCCAGCGACACCCTGCCGG - Intronic
904518074 1:31072316-31072338 GGGCCCCAGACCCAACCACCTGG - Intergenic
904774540 1:32898723-32898745 GAGCTCCACAGTCACTCTCCAGG + Intronic
904825236 1:33269948-33269970 TGGCCTCAGAGACACCCTTCTGG + Intronic
905189669 1:36224109-36224131 GGGGCTCAGACTCTCCCTCCAGG + Intergenic
905408352 1:37752710-37752732 GGGACACAAAGTCACCCCCCCGG - Intronic
906561085 1:46757460-46757482 TGGCCCCAGAGTCATTCTGCTGG + Intergenic
911941817 1:104057068-104057090 AGGCACCAGAGGCACTCTCCTGG - Intergenic
914913725 1:151805602-151805624 TGGCACCAGAGCCTCCCTCCTGG - Exonic
921181777 1:212637137-212637159 GGGCTCCAGTGTCACCCCCTTGG - Intergenic
922157460 1:223051575-223051597 GGGCCCCCAAGTCAGCTTCCAGG - Intergenic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
923906744 1:238393689-238393711 GGGCTCCACAGATACCCTCCCGG - Intergenic
1062848449 10:725730-725752 GGGCTCCAGACACACCCTGCTGG - Intergenic
1062973261 10:1664758-1664780 GGCCCCCAGAGTCAGCCGCATGG - Intronic
1066477029 10:35757510-35757532 GGGTCCCCTTGTCACCCTCCTGG + Intergenic
1067077468 10:43196399-43196421 GGGCACGAGGGTTACCCTCCTGG - Intronic
1067847371 10:49735121-49735143 GGGCCCCACAGCCCCTCTCCTGG + Exonic
1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG + Intronic
1070349208 10:75575870-75575892 GGGCACCAGAGTAAATCTCCTGG - Intronic
1070830610 10:79415881-79415903 AGGCCCAAGAGGCAGCCTCCGGG + Intronic
1073067973 10:100775109-100775131 GGGTCCCAGCTGCACCCTCCAGG + Intronic
1073455792 10:103635964-103635986 GGGCCCCAGCTTTTCCCTCCCGG - Intronic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1074578924 10:114697448-114697470 GGGGACCAGAGCCAGCCTCCGGG + Intergenic
1075651386 10:124130009-124130031 GGGCCCCAGATCAGCCCTCCAGG - Intergenic
1076494081 10:130885476-130885498 GCTGCCCAGAGCCACCCTCCAGG + Intergenic
1076631829 10:131856296-131856318 GGGGTCCAGCCTCACCCTCCTGG - Intergenic
1076764314 10:132624830-132624852 GCCCCACAGTGTCACCCTCCTGG + Intronic
1077043084 11:533125-533147 GGGCCCCAGGGTCACCGCTCCGG + Intronic
1077426637 11:2482872-2482894 GAGCACGAGGGTCACCCTCCAGG + Intronic
1078105884 11:8357709-8357731 GAGGCCCACAGTCCCCCTCCAGG + Intergenic
1078427222 11:11261718-11261740 GGGCCCCAGTCTCACCCTGGAGG + Intergenic
1081991321 11:47339179-47339201 GGGCCCCACAGGGACCCTGCTGG + Intronic
1083638890 11:64134904-64134926 GGCCCTCAGAGTCTCCCTCCAGG + Intronic
1084297958 11:68225519-68225541 CTGCCTCAGAGTCAGCCTCCTGG - Intergenic
1084350708 11:68597142-68597164 GGGCCACAGACTCTGCCTCCAGG + Intronic
1084408421 11:68992150-68992172 TGGCCCCAGAGGACCCCTCCCGG + Intergenic
1086291068 11:85309810-85309832 GGGCACCAGACTCAGCCTGCAGG - Intronic
1089129907 11:116203367-116203389 GGGCCCCTGGATCTCCCTCCAGG + Intergenic
1089387397 11:118077298-118077320 GGGCCCCACACTCACCATGCTGG - Exonic
1090515650 11:127423726-127423748 GGGCCTGAGACTCACCCTTCAGG + Intergenic
1091281223 11:134382974-134382996 GGGCCACACGGACACCCTCCTGG + Exonic
1091498247 12:991083-991105 GGGCCGCCGCGTCACGCTCCCGG + Intronic
1091716034 12:2776794-2776816 GGGTCTCAGGGTCACCCTCCAGG + Intergenic
1092002420 12:5043753-5043775 GGGCCCCAGCTGCGCCCTCCGGG + Intergenic
1092059074 12:5533609-5533631 GGGCAGCAGAGTTATCCTCCAGG + Intronic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1098150617 12:67542757-67542779 AGGTCCCAGAGACACTCTCCTGG - Intergenic
1100391909 12:94150834-94150856 GGGACTCAGAGTCACCACCCTGG + Intronic
1101759716 12:107648709-107648731 GCATCCCAGAGTCACCCTCTGGG + Intronic
1103714328 12:122935220-122935242 GGCCCACAGGGTCACCCTCAGGG - Intronic
1103719350 12:122965223-122965245 GGACCCCCGAGTCTCCATCCTGG - Intronic
1104780653 12:131417806-131417828 GAGCCCTAGACACACCCTCCAGG - Intergenic
1109311382 13:60698289-60698311 GAGCCCTATATTCACCCTCCAGG + Intergenic
1109697800 13:65983617-65983639 GTGTCCCAGAGACACCATCCTGG + Intergenic
1112216436 13:97434816-97434838 GCACCCCGGAGTCACCGTCCCGG + Intronic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113494556 13:110716092-110716114 GAGCCCCAGGGTCACCCCACGGG - Intronic
1113777397 13:112955628-112955650 GGGTCCCAGAGTCACCTGCCTGG - Intronic
1113936203 13:113996347-113996369 GGGCCCCAGATGCTCCCTCGAGG + Intronic
1113968682 13:114171364-114171386 GGGCACCAGAGACCCCTTCCTGG - Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1119079118 14:71675324-71675346 GGGGCCCTGTGTCTCCCTCCAGG - Intronic
1119471399 14:74902300-74902322 GGATCCCAGAGTCCTCCTCCTGG + Exonic
1121819408 14:96954211-96954233 AGGGCCCAGAGTCTCCCTCCAGG + Intergenic
1122445230 14:101762416-101762438 GAGCCCCAGAGCGTCCCTCCGGG - Intronic
1122575207 14:102737628-102737650 GGAGCCCAGACTCACACTCCAGG - Intergenic
1122638609 14:103143201-103143223 GGGACACAGACTCACCTTCCTGG - Intergenic
1125771335 15:42168409-42168431 GGGCTCCAGGGGTACCCTCCTGG - Intronic
1127842176 15:62841096-62841118 GAGGACCTGAGTCACCCTCCCGG - Exonic
1127997625 15:64162851-64162873 GGGGCCCAAAGTCACCGTCAAGG - Exonic
1128457873 15:67843039-67843061 GGGCCCCAGGATCAGCCCCCAGG + Intergenic
1128866814 15:71120523-71120545 GGTGCCCAGTGCCACCCTCCTGG - Intronic
1129298604 15:74613027-74613049 TGGCCCCAGGGTCACCTCCCTGG - Intronic
1129516121 15:76158839-76158861 GGGCCTCAGAGTCTCCCACCTGG + Intronic
1131056080 15:89375924-89375946 GGGCACCATGGCCACCCTCCTGG + Intergenic
1131348984 15:91679331-91679353 GGGCCACAGTGTCACCTCCCTGG + Intergenic
1132008076 15:98249076-98249098 GGGACCCACAGTCACCCTGCTGG - Intergenic
1132602207 16:778401-778423 GGGCCGCAGAGACACACTCCAGG + Intronic
1132660203 16:1057848-1057870 GGACCCCGGTGTCACCCGCCAGG + Intergenic
1132749451 16:1450744-1450766 GGGCCTCACAGTCACCTTCCAGG + Intronic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1135663587 16:24317061-24317083 GGTCCCATGAGTGACCCTCCAGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1137401311 16:48156297-48156319 GGTCCCCTGAGTCCCACTCCAGG + Intergenic
1137491652 16:48938054-48938076 GGGCCCCAGAGCCATGCCCCAGG + Intergenic
1138023124 16:53502781-53502803 GGGCCCCAGAGCCCCCCCACTGG - Intronic
1138385454 16:56633010-56633032 GGGCCCCAGTGTTCTCCTCCAGG + Intronic
1138386022 16:56636099-56636121 GGGCCCCAGTGTTCTCCTCCAGG + Intergenic
1138535643 16:57658881-57658903 AGGCCCCAGTGTCACCATCCTGG - Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140480676 16:75261372-75261394 AGGCCCCCCACTCACCCTCCTGG + Intronic
1140995410 16:80254091-80254113 GGGCCGCAGAGTCACCTGCCTGG + Intergenic
1141742842 16:85905527-85905549 GGGCACCCGCGTCTCCCTCCTGG - Intronic
1142067221 16:88069540-88069562 GGGTCCCCGAGGCACTCTCCTGG - Intronic
1142283734 16:89162506-89162528 TGGCCTCAGAGCCACCCTCCAGG + Intergenic
1142585385 17:969302-969324 TGGCCCCAAAGTCACACCCCCGG + Intronic
1142808496 17:2384440-2384462 TGGCCCCCCAGTTACCCTCCAGG + Exonic
1142850804 17:2703873-2703895 GGGCCCCAGAGCACCCCTTCTGG - Intronic
1142971387 17:3614178-3614200 GGGAACCAAAGTCACTCTCCTGG + Intronic
1143274019 17:5696609-5696631 GGGCCCCAATGTCTCCCTTCTGG + Intergenic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1144631066 17:16872741-16872763 GGGGCTCAGAGTCAGACTCCGGG - Intergenic
1145098782 17:20055926-20055948 GGGTCTCAGACCCACCCTCCTGG + Intronic
1147656584 17:42094705-42094727 AGGACCCAGAGACACTCTCCTGG + Intergenic
1147965732 17:44193373-44193395 GGGACCCAGCCTCACCCTCCTGG - Exonic
1150009289 17:61489778-61489800 GGAACCCAGACTCTCCCTCCAGG + Intergenic
1151445452 17:74160687-74160709 GGGCCTCAGAGTCACCGTGTAGG - Intergenic
1151620220 17:75240634-75240656 GGGCCCCAGGGCCATCCTCCCGG - Intronic
1152291749 17:79443812-79443834 GAGCCCCAGAGTGACCCTCTGGG + Intronic
1152421466 17:80195573-80195595 GGGCTCCCGGGTCTCCCTCCGGG - Exonic
1152426852 17:80222710-80222732 GGGGCCCAGAGTCACATCCCGGG - Exonic
1152534731 17:80943892-80943914 GGGTCCCCAAGACACCCTCCTGG + Intronic
1152844444 17:82591209-82591231 CAACCCCAGAGTCACCTTCCAGG - Intronic
1159586539 18:70288674-70288696 GGCCCCCAGAGTCCCTGTCCTGG - Intergenic
1160498527 18:79389536-79389558 GGGCACCAGGGACGCCCTCCAGG + Intergenic
1160505448 18:79423929-79423951 GGGCCTCTGGGTGACCCTCCAGG + Intronic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160953277 19:1677781-1677803 GAGGCCAAGACTCACCCTCCAGG + Intergenic
1161052365 19:2171239-2171261 GGGCCCCAGAGGAGTCCTCCAGG + Intronic
1161064561 19:2231291-2231313 GTGCCACAGATCCACCCTCCAGG + Exonic
1161076014 19:2286132-2286154 AGGCCTCAGAGTCCCCGTCCAGG - Intronic
1161106193 19:2445214-2445236 GGGCCCCTGAGACTCCCCCCAGG + Intronic
1161215834 19:3094644-3094666 GGACTCCAGAGTCATCGTCCCGG - Exonic
1161457041 19:4374745-4374767 GGGCCCCTGAGTCACCCCTGAGG + Intronic
1162118330 19:8445450-8445472 GGCCCCCGAGGTCACCCTCCCGG - Intronic
1163834867 19:19567143-19567165 AGGCCCCAGAGGCTCCATCCTGG + Intronic
1164455118 19:28400386-28400408 GGGCCCCAAAGCCACTCTGCTGG - Intergenic
1164720556 19:30428916-30428938 GGGCCTCAGAGGCACCCACAGGG + Intronic
1165432583 19:35781065-35781087 GGGCCCCGGCCTCACCATCCTGG - Exonic
1165767237 19:38359225-38359247 GGGCCCCTGAGCCACCTTCTTGG + Intronic
1166041308 19:40204626-40204648 GGGGCCCCGGCTCACCCTCCAGG - Exonic
1166422807 19:42651953-42651975 GTGCCCCAGAGTCAGGGTCCTGG + Intronic
1166977680 19:46614250-46614272 TGGCCCCAGAGCCACCCTCTGGG - Intergenic
1167002709 19:46755585-46755607 CGGCCCCCGTGTCACCGTCCTGG + Exonic
1167516055 19:49923820-49923842 GGGCCCTAGAGCCAGCCTGCTGG - Intronic
1167570638 19:50286550-50286572 GGGCCCGAGCCTCACGCTCCCGG - Exonic
1167643844 19:50695422-50695444 GGGCCCCCGCGTTCCCCTCCCGG - Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
1167752416 19:51388925-51388947 GGGCCCCAGGAAAACCCTCCTGG + Exonic
925309786 2:2874469-2874491 GGGCCCAAAAGTCTCCCTCCAGG + Intergenic
925877281 2:8323165-8323187 GGGCCCCAGAATAAGCCCCCTGG + Intergenic
925918708 2:8625000-8625022 GGGCCCCAGTGTCATCATTCAGG + Intergenic
926190577 2:10724358-10724380 TGTCCCCAGAGTCAGCTTCCCGG - Intronic
926295026 2:11562774-11562796 GAGCTCCAGAGACACCATCCTGG + Intronic
926920334 2:17934251-17934273 AGGCCCTGGAGTCAGCCTCCTGG - Intronic
928324000 2:30305704-30305726 CTGCTTCAGAGTCACCCTCCTGG - Intronic
928376493 2:30778795-30778817 GGGCCTGAGAGTTCCCCTCCCGG - Intronic
928610275 2:32985776-32985798 GGGGCCCTGTGTAACCCTCCAGG + Intronic
937298566 2:120824519-120824541 CGGCTCCAGAGTGTCCCTCCAGG + Intronic
937313421 2:120916052-120916074 GGGCCTGTGAGTCTCCCTCCCGG + Intronic
937316512 2:120935201-120935223 TGGGCCCAGCGTCACCCACCAGG + Intronic
942306328 2:174610891-174610913 TGGCCCCACACTCAACCTCCCGG + Intronic
942892430 2:181007621-181007643 GGTCTCCAGAGTTACCATCCTGG + Intronic
946201185 2:218071756-218071778 GGGCCACAGTGTCCCTCTCCGGG + Intronic
946399532 2:219461170-219461192 GGGCACCAGAGTCAGCCTTGGGG - Intronic
946474276 2:219992684-219992706 GGGCCCCAGAGCAACCCACATGG - Intergenic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
949023181 2:241752775-241752797 GGGTGCCAGGGTCGCCCTCCTGG - Intronic
1168813377 20:720680-720702 GGCCTGCAGAGTCACCCTCTAGG + Intergenic
1169067800 20:2704281-2704303 GGGCCCCTAGGACACCCTCCAGG - Intronic
1169550556 20:6697460-6697482 GGTCCCAAGGGTCAGCCTCCTGG - Intergenic
1169918402 20:10706582-10706604 GGGCCTCCGAATCCCCCTCCAGG - Intergenic
1171290570 20:23980743-23980765 GGGCCGCAGAGCCACGGTCCAGG - Intergenic
1171347814 20:24479222-24479244 GGGCTCCCAAGTCACTCTCCAGG - Intronic
1171349193 20:24490062-24490084 GGGCCAGAGAGGCACCCTCCAGG + Intronic
1173226973 20:41167848-41167870 GGGCCCCGTAGTCAGGCTCCTGG - Exonic
1173737937 20:45374953-45374975 GGGCCCCAGAGTCAGGGTTCAGG - Intronic
1174040133 20:47693787-47693809 GAGCCCCTGACCCACCCTCCTGG - Intronic
1174107288 20:48171796-48171818 GGGCCCCAAAGCCCCCCTGCTGG + Intergenic
1174162104 20:48558742-48558764 AGGCTGCAGAGTCACCCTCATGG - Intergenic
1174666103 20:52259367-52259389 GGGCCACAGCATCACACTCCAGG + Intergenic
1175650255 20:60715540-60715562 CGGCCCCAGAGTTTTCCTCCAGG + Intergenic
1175776431 20:61656620-61656642 GGGCTCCACAGCCACTCTCCTGG + Intronic
1175807064 20:61835576-61835598 GGCCCACAGAGGCAGCCTCCTGG + Intronic
1175875750 20:62228442-62228464 AGGGCCCAGACTCCCCCTCCAGG - Intergenic
1175898804 20:62351908-62351930 GGACCCCACGGTCACCCGCCGGG - Exonic
1175924411 20:62464961-62464983 GGGCAAGAGAGTCATCCTCCTGG + Exonic
1175993894 20:62804007-62804029 AGTCCCCAGGGTGACCCTCCCGG + Intergenic
1180004359 21:45013233-45013255 AGTCCCCAGAGTCACCAGCCTGG - Intergenic
1180056777 21:45362970-45362992 GGGGCTCAGCGTCACCCTCCCGG + Intergenic
1180122798 21:45765212-45765234 GGGCACCAGGGTGACCCTCCAGG + Intronic
1180841543 22:18961324-18961346 GGGTGCCAGAGACACCCTCCTGG + Intergenic
1180860184 22:19074528-19074550 AGGGCCCAGACTCACCCACCAGG + Intronic
1181059945 22:20277469-20277491 GGGTGCCAGAGACACCCTCCTGG - Intronic
1181400505 22:22647797-22647819 GTCCCCCAGAGTCCCCTTCCTGG - Intronic
1181648867 22:24247994-24248016 GTCCCCCAGAGTCCCCTTCCTGG + Intergenic
1181702484 22:24628895-24628917 GTCCCCCAGAGTCCCCTTCCTGG - Exonic
1182257055 22:29046793-29046815 GGGCCCCACAGCTCCCCTCCCGG - Exonic
1183324102 22:37182165-37182187 GGGCCTCTGGGCCACCCTCCCGG - Exonic
1183978749 22:41527764-41527786 GGGCCCCATAGTCACTGCCCGGG + Exonic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
949249908 3:1971687-1971709 GGGCACTAGAGTCAAACTCCAGG + Intergenic
950338893 3:12224259-12224281 GGGCCCCAAATTCCCCCTTCAGG + Intergenic
952919907 3:38277080-38277102 GGGCCTGAAAGACACCCTCCAGG + Exonic
953368385 3:42366546-42366568 TGACTCCAGTGTCACCCTCCAGG + Intergenic
954117211 3:48473482-48473504 GGGCCCCAGGGTCGCCCTCTGGG - Intronic
960697568 3:120411188-120411210 GGGCCACTGAGTTACCCTTCTGG + Intronic
961446753 3:126984618-126984640 GGGCCCCACTGGCACCCCCCAGG - Intergenic
961696332 3:128707851-128707873 GGGACCCAGAGTCTCCATCATGG - Intergenic
968090478 3:195895690-195895712 GGGCCCCAGAGCCACCAACTGGG + Intronic
968649013 4:1753094-1753116 GGACCCCAGAGCCCCCCACCTGG - Intergenic
968920180 4:3518445-3518467 GGGGTCCAGAGTCAGCCCCCAGG - Intronic
969524283 4:7696221-7696243 GGGCCCCAGAGGCCCCACCCTGG - Intronic
969574688 4:8030061-8030083 GGGCTCCAGCTTCATCCTCCAGG + Intronic
977527798 4:98165955-98165977 TGGCCTGAGACTCACCCTCCAGG + Intergenic
985669636 5:1200804-1200826 AGGACCCAGAGCCACCCTCTAGG - Intergenic
985708558 5:1415323-1415345 GGGCACCAGCGTCCTCCTCCTGG + Intronic
987023777 5:13902384-13902406 AGGCCCCAGTGCCACCCCCCAGG - Intronic
990575269 5:57117765-57117787 AGGCCCATGAGTCACCCTCCAGG - Intergenic
992170636 5:74098229-74098251 TGGCCTCTGAGTTACCCTCCTGG + Intergenic
998135419 5:139671734-139671756 GGCCCTGAGAGCCACCCTCCAGG + Intronic
1001542793 5:172551118-172551140 GGGCCCCAGAGTCCCCAGCAGGG + Intergenic
1002280011 5:178124410-178124432 TGGCCCCAGAGCCACCCAGCCGG - Exonic
1002340035 5:178509767-178509789 GGGGCCCAGAGGCTCCCTCCAGG - Intronic
1003212326 6:4079083-4079105 GGGGCCCAGAGAGACCTTCCGGG + Exonic
1011411071 6:87067090-87067112 GGGCCCCACAGGCAGCCTCTGGG - Intergenic
1012777937 6:103521860-103521882 GGGCACCAGAGTGAATCTCCTGG - Intergenic
1017935493 6:159001288-159001310 GAGCCCCCAAGTTACCCTCCAGG - Intergenic
1019419605 7:944902-944924 GTCACCCAGAGTCACCCCCCCGG - Intronic
1019497118 7:1345883-1345905 GGACCCCAGTGACACCCTCTGGG - Intergenic
1019619672 7:1985448-1985470 GGGCCTCACAGTCACTCTCTCGG + Intronic
1020086201 7:5312242-5312264 GGGACGCAGAGCCACCCTCGTGG - Intronic
1020257220 7:6508993-6509015 GGGCCCCCGGGTCACCATCGTGG - Exonic
1022982087 7:35613263-35613285 GGGCCCTGGAGCCACCCTCAGGG + Intergenic
1024291454 7:47807481-47807503 GGGCCCCAGGGCCACCCCCAGGG - Intronic
1025747356 7:64255090-64255112 GACACCCAGAGTCCCCCTCCAGG - Intronic
1025992461 7:66506209-66506231 GGACTCCAGAGTCATCGTCCCGG + Intergenic
1030106075 7:105988451-105988473 GGGTCCACGAGTCACCCTGCTGG + Intronic
1031026551 7:116685987-116686009 GGCCACCAGGGTCCCCCTCCTGG + Intronic
1032080194 7:128854794-128854816 GGCCCCCAGCGCCAGCCTCCCGG - Exonic
1035372974 7:158391225-158391247 TGGCCCCAGAGGGTCCCTCCAGG - Intronic
1036813503 8:11884523-11884545 GAGCCCCAGAGACTCCCTCAAGG + Intergenic
1037813859 8:22101881-22101903 GGACCCCAGAGGCACCAGCCTGG - Intronic
1038210990 8:25518937-25518959 AGGCCCCTGAGTCAGCCTCCGGG + Intergenic
1041761918 8:61376478-61376500 GGACGCCAGTGTGACCCTCCAGG + Intronic
1044828684 8:96223973-96223995 ATGCCCCAGAGTCAGACTCCAGG - Intergenic
1045485571 8:102628371-102628393 TGGCCCCAGCACCACCCTCCTGG - Intergenic
1048179315 8:132180641-132180663 GGGCCCCAGAGTGAATCTCAAGG - Intronic
1049315341 8:141964067-141964089 TGGCCCCAGCGTCACCCTGAGGG + Intergenic
1049391961 8:142376286-142376308 GGGCCCCAGGGTCGCCCTTGCGG - Intronic
1053117992 9:35522350-35522372 GGGCCCCAGAGGCACCTCCAGGG - Intronic
1057081005 9:92174662-92174684 GGGCCCTAGAGTCATCATCAGGG - Intergenic
1057218628 9:93243695-93243717 GGGACCCAGCGTCAACCTGCCGG - Intronic
1057353846 9:94319818-94319840 GGGCCCCATTCCCACCCTCCTGG + Intronic
1057653906 9:96937774-96937796 GGGCCCCATTCCCACCCTCCTGG - Intronic
1058069397 9:100586249-100586271 GGGGCCCAGAGACTCGCTCCTGG - Exonic
1059329634 9:113526697-113526719 GGGCCCCAGAGATAGCTTCCTGG - Intronic
1060050975 9:120377874-120377896 GAGCACCAGAGTCACCCACTGGG - Intergenic
1060552408 9:124491996-124492018 GAGCCCCAAAGACACCCCCCTGG + Intronic
1060890947 9:127187959-127187981 GGCCCACAGAATCAACCTCCAGG + Intronic
1060936089 9:127517093-127517115 GGGCCCCAGGCCCACCCACCTGG + Exonic
1061059645 9:128244081-128244103 GGTGCCCAGAGTCACTCCCCAGG - Intronic
1061233427 9:129328212-129328234 GGGTCCCAGGGTCTCCCTCCTGG + Intergenic
1061396784 9:130347901-130347923 GAGCCCCAGAGCCCACCTCCGGG + Intronic
1061397065 9:130349046-130349068 AGAGCCCAGAATCACCCTCCTGG - Intronic
1061796195 9:133087149-133087171 GGGCCTCAGAGTCACCCGTAGGG - Intronic
1061851175 9:133416708-133416730 GGACTCCAGAGTCAGCCACCTGG + Intronic
1061912720 9:133733594-133733616 TGGCCCCAGCTTCACTCTCCAGG + Intronic
1061979211 9:134090516-134090538 GGCCCCAAAAGACACCCTCCTGG + Intergenic
1062053376 9:134458469-134458491 GGGCCCCAGTGTCAAACCCCAGG - Intergenic
1187319644 X:18228040-18228062 GTGCCCCAGAGTCATGCACCTGG - Intergenic
1190085750 X:47393853-47393875 GAGCCCCATACTCAACCTCCTGG - Intronic
1191902501 X:66054694-66054716 GGGGCCCAGCCTCACTCTCCTGG - Intergenic
1191950996 X:66593036-66593058 GGGCCTCAGAGTCACAGTCTTGG + Intergenic
1192211247 X:69129210-69129232 GGGCCTCAGAGCTACCCACCAGG - Intergenic
1192368339 X:70493713-70493735 TGGTCCCAGGGTCAGCCTCCAGG + Intronic
1192964111 X:76159323-76159345 GGGCACCAGAGTGAATCTCCTGG - Intergenic
1195082805 X:101386913-101386935 GGGCCCCTGAGAAAACCTCCAGG - Intronic
1196317286 X:114242929-114242951 GTGCCCTACAGTCTCCCTCCTGG - Intergenic
1197724640 X:129768412-129768434 GGGCCCCAGACACCGCCTCCTGG + Exonic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic
1200151648 X:153954192-153954214 GGCACCCAGCGTCACCCCCCAGG - Exonic