ID: 1184394352

View in Genome Browser
Species Human (GRCh38)
Location 22:44224059-44224081
Sequence CAACAGTTCTAGAAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184394346_1184394352 24 Left 1184394346 22:44224012-44224034 CCTGAGACCCTGGGGGATGCCTT No data
Right 1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG No data
1184394344_1184394352 30 Left 1184394344 22:44224006-44224028 CCTTGCCCTGAGACCCTGGGGGA No data
Right 1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG No data
1184394345_1184394352 25 Left 1184394345 22:44224011-44224033 CCCTGAGACCCTGGGGGATGCCT No data
Right 1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG No data
1184394347_1184394352 17 Left 1184394347 22:44224019-44224041 CCCTGGGGGATGCCTTTCTTTTC No data
Right 1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG No data
1184394348_1184394352 16 Left 1184394348 22:44224020-44224042 CCTGGGGGATGCCTTTCTTTTCT No data
Right 1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG No data
1184394349_1184394352 5 Left 1184394349 22:44224031-44224053 CCTTTCTTTTCTCTGAGCCCTAG No data
Right 1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184394352 Original CRISPR CAACAGTTCTAGAAAACAAA AGG Intergenic
No off target data available for this crispr