ID: 1184396134

View in Genome Browser
Species Human (GRCh38)
Location 22:44242580-44242602
Sequence GAGCTGTCTGTTCTGTTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184396131_1184396134 21 Left 1184396131 22:44242536-44242558 CCTTTGTCAAAGATCAGGTCACT No data
Right 1184396134 22:44242580-44242602 GAGCTGTCTGTTCTGTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184396134 Original CRISPR GAGCTGTCTGTTCTGTTCAT TGG Intergenic
No off target data available for this crispr