ID: 1184396811

View in Genome Browser
Species Human (GRCh38)
Location 22:44247124-44247146
Sequence GTGGCCTTGCCTCCCTCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 2, 1: 0, 2: 3, 3: 36, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184396811_1184396814 -3 Left 1184396811 22:44247124-44247146 CCAGGAGAGGGAGGCAAGGCCAC 0: 2
1: 0
2: 3
3: 36
4: 368
Right 1184396814 22:44247144-44247166 CACCAGTTCCTTTTTGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1184396811_1184396812 -9 Left 1184396811 22:44247124-44247146 CCAGGAGAGGGAGGCAAGGCCAC 0: 2
1: 0
2: 3
3: 36
4: 368
Right 1184396812 22:44247138-44247160 CAAGGCCACCAGTTCCTTTTTGG 0: 2
1: 0
2: 1
3: 16
4: 186
1184396811_1184396819 30 Left 1184396811 22:44247124-44247146 CCAGGAGAGGGAGGCAAGGCCAC 0: 2
1: 0
2: 3
3: 36
4: 368
Right 1184396819 22:44247177-44247199 AGAGCATTGTCCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 190
1184396811_1184396817 22 Left 1184396811 22:44247124-44247146 CCAGGAGAGGGAGGCAAGGCCAC 0: 2
1: 0
2: 3
3: 36
4: 368
Right 1184396817 22:44247169-44247191 GCACCTACAGAGCATTGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184396811 Original CRISPR GTGGCCTTGCCTCCCTCTCC TGG (reversed) Exonic
900640926 1:3687753-3687775 GTGCCCCTTCCTGCCTCTCCTGG + Intronic
900715665 1:4141868-4141890 GTGGCCCCTCCTCCATCTCCAGG - Intergenic
901219858 1:7577368-7577390 GTGGCCTTGCTTCCCTCCTGAGG - Intronic
901320964 1:8339571-8339593 CCGGGCTTGCCACCCTCTCCAGG + Exonic
901630319 1:10644835-10644857 GTGGCCTGGGCCGCCTCTCCTGG - Intronic
901720526 1:11193638-11193660 GTGGCCTTGTCTCCTTCTACCGG + Exonic
901787482 1:11634331-11634353 AAGGCCCTGCCTCCCTCTCCAGG - Intergenic
902261318 1:15226893-15226915 GGGTCTTTTCCTCCCTCTCCTGG - Intergenic
902451829 1:16501152-16501174 GTGTCCTTGCCCCTCTCTCCAGG + Intergenic
902501122 1:16912513-16912535 GTGTCCTTGCCACTCCCTCCAGG - Intronic
902555145 1:17242541-17242563 GTGGTCTGGCCTCCATCTGCCGG + Intronic
902571141 1:17347707-17347729 GTGCCCTTCCCTCCTACTCCTGG - Intronic
903652569 1:24930557-24930579 GCGCCCTTGCCGCCCTCTCTCGG + Intronic
903764822 1:25727497-25727519 ATGGCCTTGCCCCCGACTCCAGG + Intronic
903764939 1:25728064-25728086 GGGGCCTGGCTTCCATCTCCTGG - Intronic
903773951 1:25781196-25781218 GTGGCTTGGCCTTCCACTCCAGG - Intronic
904343482 1:29853117-29853139 GTGGCTCTGCCTCTGTCTCCAGG - Intergenic
904836777 1:33342749-33342771 GTGGACTGGCCTCCATCACCAGG - Intronic
904877564 1:33668191-33668213 CTGCCCCTGCCTACCTCTCCTGG - Intronic
905769815 1:40630194-40630216 CTGGCCTTCCCTCCCTCCACTGG - Intronic
905878932 1:41451050-41451072 CTGGCCTCCCCTCCCTCTGCCGG + Intergenic
905937910 1:41839496-41839518 GTGGCCCTACCTTCATCTCCTGG - Intronic
906712527 1:47941622-47941644 ATCACCTTGCCTACCTCTCCAGG + Intronic
906821371 1:48933960-48933982 GAGCCCTTGCCTCTCTCCCCAGG + Intronic
907308705 1:53527523-53527545 GTGGCCATGCCTCCTGGTCCTGG - Intronic
912234573 1:107835488-107835510 CTGGGCATGCCTCCCTCTGCGGG + Intronic
912518244 1:110228971-110228993 TCGGCCTTGCCTTCCTCTCGGGG + Intronic
915355745 1:155254554-155254576 CTTGCCTCTCCTCCCTCTCCTGG - Intronic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
916989365 1:170225935-170225957 GTTGGCTTGCCTGCCTCTGCAGG + Intergenic
917475047 1:175362162-175362184 GTGGCCATAACTCCCTCACCCGG - Intronic
918523032 1:185435915-185435937 TAGGCCTTGGCTCACTCTCCTGG - Intergenic
918544753 1:185669905-185669927 ATTGCCTTGTCTCCATCTCCTGG - Intergenic
921355840 1:214283330-214283352 GTTGCCTTGGGTCCCTCACCAGG + Intronic
921726499 1:218529779-218529801 GTGGGCTTTCCTCCCTGACCTGG + Intergenic
922161657 1:223082662-223082684 GTGGCCTGGTGTCCCTCTGCGGG - Intergenic
922212094 1:223494249-223494271 GTGACCCTGTCTCCTTCTCCTGG + Intergenic
923027088 1:230213229-230213251 GTTTCCTTGTCTGCCTCTCCGGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063112007 10:3046037-3046059 CCGGCCCTGCCTCCCGCTCCAGG - Intergenic
1063376755 10:5558604-5558626 GTGGCCTCGCCTCTCCCTCCTGG - Intergenic
1064176651 10:13080960-13080982 GTGGCCCTGCCCCTCTCTCGAGG - Intronic
1065186599 10:23174877-23174899 GCGGCCTGCCCTCCCCCTCCCGG - Intergenic
1067196398 10:44123254-44123276 GTGGGCCTGCCTCCCTCTCCAGG - Intergenic
1069583140 10:69578605-69578627 GTGGCCTCCCCTCCCCCGCCGGG - Intergenic
1069912096 10:71765914-71765936 CTGGCCTTCCCTCCCTCCCCAGG - Intronic
1070025166 10:72625655-72625677 GTAGCCTTGACTGGCTCTCCTGG - Intronic
1070385104 10:75917244-75917266 GTGGCCTCTCCTCTGTCTCCAGG + Intronic
1072615091 10:97043774-97043796 CTGGCCTTGCCTCCGTGCCCTGG + Intronic
1074974286 10:118567715-118567737 GAGACAGTGCCTCCCTCTCCAGG + Intergenic
1075083498 10:119399071-119399093 TCAGCCTTGCCTCCATCTCCTGG + Intronic
1075805639 10:125186948-125186970 TTGGCCTTGCCGCCTTCTCCGGG + Intergenic
1076564563 10:131389310-131389332 CTTGCCTGGCCTGCCTCTCCTGG + Intergenic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1076727525 10:132420493-132420515 CAGGCCTTGACTCCCTCTCCTGG - Intergenic
1076857098 10:133122741-133122763 CTGGCCGTGCCTCCCTGGCCTGG + Intronic
1078090085 11:8259639-8259661 CAGGGCCTGCCTCCCTCTCCAGG + Intronic
1078095291 11:8292667-8292689 GAGGCCCTGCCTCCTTCTCTTGG - Intergenic
1078267405 11:9765550-9765572 GTGGGCCTGCCTTCCTGTCCTGG - Intergenic
1078589454 11:12626886-12626908 GTTACCTTGTCTCCCTCCCCAGG - Intergenic
1078862094 11:15257986-15258008 GTTCCCTTTCCTACCTCTCCAGG - Intergenic
1080778225 11:35406198-35406220 GAAGCCTTCCCTCCTTCTCCAGG + Intronic
1083253130 11:61481267-61481289 CTGGCCTTGCCTGCCTCCCCTGG - Intronic
1083475472 11:62912484-62912506 GGAGGCTTCCCTCCCTCTCCTGG + Intronic
1083489698 11:63007185-63007207 GTTGCCTTTCTTCCCTCTCTGGG - Intronic
1085053076 11:73389622-73389644 GTGGACTTGCCTGCAGCTCCGGG - Intronic
1085054263 11:73394788-73394810 GGGGCCCTGCCTCCCCCTCCCGG - Intronic
1087474979 11:98623412-98623434 GTTCCCTTGTCTCCCTCTCAGGG + Intergenic
1088815072 11:113415213-113415235 TGGACCCTGCCTCCCTCTCCTGG + Intronic
1089383501 11:118052736-118052758 GTGCCCCTGCCTGCCTCTCCTGG + Intergenic
1089517855 11:119045081-119045103 GTGCTCTTTCCTCCCTCTGCGGG - Exonic
1089666576 11:120024220-120024242 GAGGCCCTGACTCCCCCTCCAGG - Intergenic
1090084736 11:123641130-123641152 GGGGCCCTGGCGCCCTCTCCTGG - Intronic
1091278566 11:134369065-134369087 GTGGCCTCCCCTCCCTGCCCAGG + Intronic
1092161882 12:6319566-6319588 GAGGCTCTGCCTCCCTCTCTGGG - Intronic
1092858718 12:12699763-12699785 CTGCCCTTGCCTCCATCTACTGG + Intergenic
1093176445 12:15918288-15918310 GCCGCCTCGCCTCCCTCTGCAGG + Intronic
1094043736 12:26145086-26145108 GTCACCTTGCCTCCCTCAGCTGG - Intronic
1094414261 12:30201278-30201300 GTGCCCTTGCCCTCCTCTCCTGG + Intergenic
1095976091 12:47942057-47942079 GTGCCTTTGCACCCCTCTCCGGG - Intronic
1095977795 12:47951622-47951644 ATGGTGTTGCCACCCTCTCCAGG + Intergenic
1096580146 12:52579838-52579860 GAGTACTTGCCTCCTTCTCCAGG + Intergenic
1096585123 12:52614939-52614961 CTGTCCTTGCCTCCCTCTGTTGG - Intronic
1097232352 12:57520545-57520567 ATGGCCTTGCCCTCCTCTCAGGG + Intergenic
1097730518 12:63123441-63123463 TCTGCCTTGCCTCCCTCTCTTGG + Intergenic
1097882227 12:64696266-64696288 GTGGACTTTCCTCCCTTTCTTGG - Exonic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1104241431 12:126993888-126993910 GTGGCACTGCCTTCCTCACCTGG + Intergenic
1104687440 12:130796891-130796913 GTTGCCTGGCCTCCCTCTGAGGG + Intronic
1104692993 12:130840349-130840371 CTGGCCTTGCCTTCTCCTCCTGG - Intergenic
1105880909 13:24606267-24606289 GTGGGCATGTCTCCCTCTGCAGG - Intergenic
1105900531 13:24748013-24748035 CTGGACTTCCCTCCCGCTCCGGG + Intergenic
1107484667 13:40814098-40814120 GTGGGCATGCCTCCCTATGCAGG + Intergenic
1108057465 13:46498904-46498926 GTGGCCTTGCACACCTCTCCAGG - Intergenic
1108901160 13:55410442-55410464 CTGGCCTTGCCTCACTTCCCCGG - Intergenic
1113047075 13:106167837-106167859 CTGGCCCTGCCTCCATCTGCCGG + Intergenic
1113220065 13:108089964-108089986 GTGTCCTTCCTTGCCTCTCCTGG - Intergenic
1113294055 13:108938568-108938590 GTGGCCTAACCTCCTACTCCAGG + Intronic
1113738654 13:112696341-112696363 GTGACCTTGCCCTGCTCTCCCGG + Intronic
1113914048 13:113860622-113860644 CTGGCCTTGCCTCTCCCTGCTGG - Intronic
1115109635 14:29806077-29806099 CTTGCCTTGCTTTCCTCTCCTGG - Intronic
1115355978 14:32448179-32448201 GTGGCAATGCCTCCCTTTCCTGG + Intronic
1119871728 14:78023608-78023630 GTTTCCTTGCCTCCAGCTCCTGG + Intergenic
1120203757 14:81566091-81566113 GTGGTCATGCCACCCTCTCGTGG - Intergenic
1121305916 14:92906817-92906839 GTGGCCCTGCCAGCCTCTCAAGG + Intergenic
1121690250 14:95873165-95873187 ATGGCCTTGCCTGCTTCTTCAGG + Intergenic
1122344879 14:101052269-101052291 GTTGCCCTTCGTCCCTCTCCAGG + Intergenic
1122960070 14:105090210-105090232 GAGGCCTCCCCGCCCTCTCCAGG - Intergenic
1124633958 15:31353278-31353300 GTGGGCGTGACTTCCTCTCCAGG - Intronic
1125795477 15:42401412-42401434 GTGGCTTTTCCTTCCTCTCTGGG - Intronic
1126102654 15:45129300-45129322 GCGGCGCCGCCTCCCTCTCCCGG + Intronic
1127702148 15:61512120-61512142 GTGGCTTTGTCTCCCTCAGCAGG - Intergenic
1128727825 15:70000764-70000786 CGGCTCTTGCCTCCCTCTCCGGG + Intergenic
1128764651 15:70243799-70243821 AGGGCTGTGCCTCCCTCTCCAGG + Intergenic
1128798108 15:70479506-70479528 GTGCCCATGCCTCCTCCTCCAGG + Intergenic
1129717655 15:77861548-77861570 GATGCCTTGCTTCCATCTCCTGG - Intergenic
1129909583 15:79214982-79215004 GTAGCCTATCCTCCCTCTCAGGG + Intergenic
1130332832 15:82934831-82934853 GTAGCCTTGCCGCCCACTCCCGG + Intronic
1130338459 15:82978166-82978188 TTGCCCCTGCCTTCCTCTCCAGG - Intronic
1130461106 15:84158698-84158720 GATGCCTTGCTTCCATCTCCTGG + Intergenic
1132250326 15:100331117-100331139 GTGGTCTTGCCTGCCCCTCCGGG - Intronic
1132407894 15:101555522-101555544 CTCGCCTTGCCTCCTCCTCCAGG + Intergenic
1132756197 16:1486653-1486675 GGTGCCTGGCCTCCCACTCCCGG + Intronic
1132855270 16:2042146-2042168 GTGGAAATACCTCCCTCTCCAGG - Intronic
1132913512 16:2328576-2328598 ATCGCCTTCCCTGCCTCTCCAGG - Exonic
1133021255 16:2967907-2967929 GTGGCCTTGCCCTGCTCCCCCGG + Exonic
1135105559 16:19646187-19646209 GTGGCCTTGTTCCCTTCTCCAGG + Intronic
1135887413 16:26323330-26323352 GTGGCTTTGCCTCAGTTTCCAGG - Intergenic
1136112715 16:28074949-28074971 CTGGGCTTGCCTCACTCTCGGGG - Intergenic
1136220221 16:28823575-28823597 GTGGCCGCGGCTCCCTCGCCCGG - Intronic
1138006042 16:53338640-53338662 GTCTCCTTTCCTCCCTCCCCTGG - Intergenic
1138350005 16:56341443-56341465 TTGCCCTCGCCTCCCTCACCAGG + Intronic
1139770924 16:69275622-69275644 CTGGCCTTGCCTCCCTCTGCAGG - Intronic
1140032701 16:71351122-71351144 CTGGCCCTGCCAACCTCTCCAGG + Intergenic
1140478274 16:75249738-75249760 GTGCCTTTGCGGCCCTCTCCTGG - Intronic
1141052586 16:80785037-80785059 TTGCCCTTGCCTACCTTTCCAGG - Intronic
1142113572 16:88344879-88344901 GTCGCCCTGCCTCCATCACCCGG + Intergenic
1142138824 16:88463544-88463566 GTGGCCTCACGTCCTTCTCCCGG + Intronic
1142276738 16:89122678-89122700 GTGGCTGTGCAGCCCTCTCCAGG + Intronic
1142407016 16:89895950-89895972 GTGGCCATGACACCCTCCCCTGG + Intronic
1142638505 17:1271769-1271791 CTGCCCCTGCCTGCCTCTCCCGG - Intergenic
1142694661 17:1627270-1627292 GTGGCCTTGCCTCCACCCCAGGG - Intronic
1142805893 17:2371034-2371056 GACGCCTTGCGCCCCTCTCCAGG + Intronic
1143780544 17:9226558-9226580 GTCACCTGGCCGCCCTCTCCTGG + Intronic
1144797002 17:17898522-17898544 CTGGCCTTGCCCCCCTCACAGGG - Intronic
1145810319 17:27760426-27760448 GTAGCCAGGGCTCCCTCTCCTGG - Intronic
1148679382 17:49464985-49465007 TTGCCTTTGCCTTCCTCTCCCGG + Intronic
1148744367 17:49910248-49910270 CTGGCCCTGCCTCCTCCTCCAGG - Intergenic
1148821210 17:50360732-50360754 CTGGGCCTGCCTCACTCTCCAGG + Exonic
1148866415 17:50631076-50631098 GTGGCCTGGAGTCCCACTCCAGG + Intergenic
1149986799 17:61353566-61353588 GTTGCCTTGTCTTCCTCTCTAGG + Intronic
1150210025 17:63436742-63436764 CTGGCCTTGCCCACCTCTTCTGG - Intronic
1151947384 17:77327154-77327176 CTGGCAATGCCTCCCTCTCCTGG + Intronic
1152258502 17:79254105-79254127 GTGAACTTGCCTCCCTGCCCAGG - Intronic
1152684276 17:81686468-81686490 GTGGCCTTGCCCACCTCCCTGGG + Intronic
1152718728 17:81912094-81912116 GCGGCCTTTCCTCGCTCACCAGG - Exonic
1152947040 17:83203571-83203593 CTGCCCTTGGCTCCCTCCCCCGG - Intergenic
1156274677 18:35573087-35573109 GTTGCCACTCCTCCCTCTCCTGG - Intergenic
1156460096 18:37316780-37316802 CTAGCCCTGCCTCCCTCACCTGG + Intronic
1156703210 18:39849283-39849305 GTGGCCTGGCCTCAAACTCCTGG + Intergenic
1157499768 18:48181464-48181486 ATTGCCTCGCCTCCTTCTCCTGG + Intronic
1157555151 18:48608681-48608703 GTGGCCTTGCAGGCCTGTCCAGG - Intronic
1157818486 18:50748499-50748521 CTAGACCTGCCTCCCTCTCCTGG + Intergenic
1158464157 18:57674937-57674959 TTGGCTTTGCCTTCCTCGCCAGG - Exonic
1158659485 18:59373202-59373224 GTGGCCTGACCTCACTCTGCAGG + Intergenic
1158962324 18:62596951-62596973 GCCTCCGTGCCTCCCTCTCCGGG - Intergenic
1160205088 18:76824842-76824864 CTGACCCAGCCTCCCTCTCCGGG + Intronic
1160209080 18:76861198-76861220 GTGACTGTGCCTCCCTCACCTGG + Intronic
1160929081 19:1561240-1561262 GTGGCCTCGGCTCCCACACCAGG - Intronic
1160989114 19:1853399-1853421 CTGGCCTCCCCTCCTTCTCCTGG - Exonic
1161346583 19:3771469-3771491 CTTGCTTTGCCTCCCTCCCCAGG + Intronic
1161587393 19:5113135-5113157 CTGGCCTGGCCTCCCTGCCCCGG + Intronic
1161628269 19:5339222-5339244 GGTGCCTTGCCTCCCCCTTCTGG - Intronic
1162372283 19:10286898-10286920 GGGGCCTCCCCTTCCTCTCCAGG + Intergenic
1162394552 19:10409261-10409283 CGGGCCCTGCCTCCCTCGCCTGG + Intronic
1162494103 19:11013608-11013630 GAGGCCTGGGGTCCCTCTCCCGG + Intronic
1162736841 19:12751733-12751755 GTGGGCGTGCCTCCCTTTCCTGG - Exonic
1162834642 19:13308282-13308304 GGGGCCCTGCCTCCCCCGCCTGG - Intronic
1163466843 19:17472867-17472889 GTGGACCAGCCTCCATCTCCTGG + Intronic
1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG + Intronic
1165664725 19:37618325-37618347 GTGGCCTCACCTCCTCCTCCTGG - Intronic
1165862917 19:38918530-38918552 GTGGCCTGGCCTCCTCCCCCAGG - Exonic
1165891613 19:39115926-39115948 GTGGCCCTGCTTCCCTTTCTGGG - Intergenic
1166374191 19:42317904-42317926 CTGTCCCTGCCTCCCTCTCGGGG + Intronic
1166463908 19:43015628-43015650 GTGGCCATGACTCCCTGCCCTGG - Intronic
1166483671 19:43194852-43194874 GTGGCCATGACTCCCTGCCCTGG - Intronic
1166490782 19:43258714-43258736 GTGGCCATGACTCCCTGCCCTGG - Intronic
1167089251 19:47332107-47332129 GTGGCCTTGTCTCGCTCTCAGGG - Intergenic
1167285388 19:48596260-48596282 GGAGCCTGGCCTCCCTCTCTGGG - Intronic
1167570110 19:50281614-50281636 GTGCCCCTGCCTCCTCCTCCTGG - Exonic
925082786 2:1082776-1082798 GTGGCTTTCCCTGACTCTCCCGG + Intronic
926116956 2:10219443-10219465 GGGGCCTTGCCTCTGTCTACAGG + Intergenic
926415966 2:12650048-12650070 GTGGTCATGCCTCCCTCACAGGG + Intergenic
926627881 2:15108587-15108609 GGTGCCTTGCCTCCCTCTCTGGG - Intergenic
927214698 2:20661768-20661790 GTTGCCTCTCCTCCCCCTCCCGG + Intergenic
927998869 2:27506162-27506184 CTGGACCTGCCTCCCTCTCCAGG + Intronic
928032484 2:27793477-27793499 GTGACCTTGTGTCCTTCTCCAGG - Intronic
928622800 2:33108203-33108225 GTGGCCTTGCTTCTGTCTCTGGG + Intronic
931867172 2:66425911-66425933 GTCTCCTTTCCTCCGTCTCCCGG + Intergenic
932416779 2:71578357-71578379 CTTGCCATACCTCCCTCTCCAGG - Intronic
933678068 2:85075633-85075655 ATGGCCCTGTCTCCCTCCCCAGG - Intergenic
933787367 2:85854260-85854282 GTGGCTTTGGCTCCTTCTCCAGG + Intronic
934686470 2:96325432-96325454 GTGGCCCTGCTCCCCTTTCCTGG - Intronic
935570979 2:104659713-104659735 GGGGCCTTTCCTTTCTCTCCGGG - Intergenic
935698001 2:105786661-105786683 GTGGCCTGGCCTGACTCTCCTGG + Intronic
936076018 2:109402347-109402369 TGGGCCTGGGCTCCCTCTCCTGG - Intronic
936189897 2:110330750-110330772 TTGTCCTGGCCTCCCTGTCCCGG - Intergenic
937266195 2:120616046-120616068 ATGGTCTTGCCTTCCCCTCCAGG + Intergenic
938721662 2:134072501-134072523 GTTTCCTTTCCACCCTCTCCAGG - Intergenic
938782893 2:134601511-134601533 GTGGCATTGCATCTGTCTCCTGG - Intronic
938809741 2:134842349-134842371 GTGTCCCTCCCTCCCTTTCCTGG - Intronic
939201702 2:139043964-139043986 GTGGCCTTCACTCTCTCTTCTGG - Intergenic
942051608 2:172146042-172146064 GAGGCTTTCCCTCCCTCTGCAGG - Intergenic
944615081 2:201451691-201451713 GCGGCCCCGCCTCCCTCCCCGGG - Exonic
946419758 2:219558142-219558164 TTGCCCTTGCCTCCCTGCCCTGG + Intronic
946767781 2:223056092-223056114 GTTGACTCTCCTCCCTCTCCTGG + Intronic
946854095 2:223935899-223935921 GTGCCTTTGCCTCCCTCACCAGG - Intronic
947089757 2:226496649-226496671 GTGGACCTGCCTCCCCATCCTGG - Intergenic
948310507 2:236982123-236982145 GTATCCTTGCTTCCTTCTCCTGG + Intergenic
948430587 2:237916028-237916050 GTGGCCTTCTCTCTCTGTCCTGG - Intergenic
948465408 2:238149598-238149620 GTGGCCTGTCCTCCTTCTCAGGG + Intronic
1169880425 20:10341309-10341331 ATTGCCTGGCCTCCTTCTCCTGG + Intergenic
1171783894 20:29445672-29445694 ATGGCCTTGCCTCTTCCTCCAGG + Intergenic
1172777526 20:37416163-37416185 GTGTCCTTCCTTCCCTCTCTGGG + Intergenic
1173561856 20:44011737-44011759 TTGGCCTTGCCCGCCTCTCCAGG - Intronic
1174112068 20:48204108-48204130 CAGCCCATGCCTCCCTCTCCAGG + Intergenic
1174287944 20:49485105-49485127 GAACCCTTGCCTGCCTCTCCAGG - Intergenic
1175223934 20:57433940-57433962 CTGGCCTGGACTCCCTCCCCTGG - Intergenic
1176189200 20:63799792-63799814 GTGGCCTTGCCTCTTAGTCCTGG - Intronic
1176264599 20:64202589-64202611 CCTGCCTTCCCTCCCTCTCCTGG - Intronic
1177829153 21:26117511-26117533 GTGCCCTTTCCTCCCTCTTATGG - Intronic
1178677995 21:34647280-34647302 AAGTCCTTGCCTGCCTCTCCAGG + Intergenic
1179592811 21:42421390-42421412 GTGGCCATCCCTCTGTCTCCAGG + Intronic
1179712227 21:43269786-43269808 GAGGCCTCCCCTCCCTCTGCGGG - Intergenic
1179880632 21:44292011-44292033 GTGGCTTTGCCTGCCTCTCAGGG - Intronic
1180557955 22:16592553-16592575 GTGGCCTCTCCTCTCTCTGCGGG - Exonic
1180823027 22:18845184-18845206 GTCTCCTTGTCTCCCTCTGCTGG - Intergenic
1181189934 22:21130828-21130850 GTCTCCTTGTCTCCCTCTGCTGG + Intergenic
1181209270 22:21279677-21279699 GTCTCCTTGTCTCCCTCTGCTGG - Intergenic
1181466071 22:23111345-23111367 GTGCGCTTGCCTCTCTCCCCTGG - Intronic
1181502639 22:23326509-23326531 GTCTCCTTGTCTCCCTCTGCTGG + Intergenic
1181574373 22:23784351-23784373 GTGGCCAGGCCTCCCCATCCTGG - Intergenic
1181593545 22:23898700-23898722 GTGGCTTGGCCTCACTCGCCAGG - Intronic
1181653439 22:24274910-24274932 GTCTCCTTGTCTCCCTCTGCTGG + Intronic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1182777197 22:32839852-32839874 GTTTCCTTGCCTCCCCTTCCCGG + Intronic
1183323206 22:37177543-37177565 GGGGACATGCCTCCCCCTCCAGG + Intergenic
1184201132 22:42970751-42970773 GGGGCCCTGCCTTCCTTTCCAGG - Intronic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1185061930 22:48611662-48611684 CTGGCCTTTCTTGCCTCTCCTGG + Intronic
1185231911 22:49688402-49688424 GGGGCCCTGCCTTCCACTCCCGG + Intergenic
1185349080 22:50325041-50325063 CTTGCCTTTCCTCCCTCACCTGG - Intronic
1203217674 22_KI270731v1_random:15766-15788 GTCTCCTTGTCTCCCTCTGCTGG + Intergenic
1203273167 22_KI270734v1_random:71090-71112 GTCTCCTTGTCTCCCTCTGCTGG - Intergenic
949511186 3:4768633-4768655 GTGGCCTGGGTGCCCTCTCCAGG - Exonic
950430051 3:12945332-12945354 GTGGCCGGGCCTCCCTCTCCAGG + Intronic
950472820 3:13197127-13197149 GTAGCTTTGTCTGCCTCTCCAGG + Intergenic
950565930 3:13769601-13769623 GTGCCCTTGCCTCCCTCACAGGG + Intergenic
952494373 3:33902946-33902968 GTAGCCCAGCCACCCTCTCCTGG - Intergenic
953018143 3:39097725-39097747 GTGTACTTGCCCCCATCTCCTGG - Exonic
953481615 3:43256956-43256978 GTGGCCTTGCTGACCTCTTCAGG - Intergenic
953974378 3:47371345-47371367 GTGGCCTTGGCGCCATCTGCTGG + Intergenic
954380621 3:50217163-50217185 GGGCCCCTGCCTCCCTCTGCTGG - Intronic
954401696 3:50322581-50322603 GTTGCACTCCCTCCCTCTCCTGG - Exonic
954408110 3:50356723-50356745 GAAACCCTGCCTCCCTCTCCTGG + Intronic
955149894 3:56356615-56356637 CTGGCCTTTCCTTCCTTTCCTGG + Intronic
957321231 3:78633158-78633180 GTGGCATTTCTACCCTCTCCTGG + Intronic
961167860 3:124776046-124776068 CTGGCTTTCCTTCCCTCTCCTGG - Intronic
961402695 3:126658216-126658238 GTGCCCCTGCTCCCCTCTCCCGG - Intergenic
961580240 3:127875016-127875038 GGGGCCTGGGCTCCCTCTCCAGG - Intergenic
961752011 3:129102216-129102238 TAAGCCTTGCCTCCTTCTCCAGG + Intronic
963169008 3:142232346-142232368 AAGGCCTGGACTCCCTCTCCTGG + Intergenic
968221335 3:196942407-196942429 GCGGCCCGGCCTCCCTCACCCGG + Exonic
1202739029 3_GL000221v1_random:37783-37805 GTCTCCTTGCCTCCATCTGCAGG + Intergenic
968705731 4:2076566-2076588 GTGACCTTGGCTCTGTCTCCTGG + Intronic
969118188 4:4887585-4887607 GTGCCCTTGCTGCCCTCCCCTGG - Intergenic
973890815 4:55365598-55365620 TTGGCGTTACCTGCCTCTCCCGG + Intronic
976808412 4:89073823-89073845 GTCACCTTGACTCCCTCTTCCGG - Intronic
978104508 4:104884883-104884905 GTGACCAGGCGTCCCTCTCCTGG - Intergenic
978204494 4:106064055-106064077 GAGGCTTTTCCCCCCTCTCCCGG - Intronic
979197802 4:117941430-117941452 GTGGCCATGCCTCCCCCTAGGGG + Intergenic
980773495 4:137409389-137409411 GGGCCCCTCCCTCCCTCTCCTGG - Intergenic
981545822 4:145892196-145892218 CTGGCTGTGCCTGCCTCTCCAGG + Intronic
981967241 4:150619320-150619342 GTGGCTTTTTTTCCCTCTCCAGG + Intronic
983506475 4:168558429-168558451 GTGGCCCTTCCTCCATCACCAGG + Intronic
984215786 4:176911162-176911184 GTGGCCATCCCTCCCTCTAGGGG - Intergenic
984935332 4:184884536-184884558 GTGCCCTTGCCCCCGTCTCCTGG + Intergenic
985543682 5:498790-498812 CTGGCCTCGGCTGCCTCTCCTGG + Intronic
989819925 5:45784762-45784784 GAGGCTTTTCCTCCCTTTCCTGG + Intergenic
990684551 5:58286673-58286695 TTGGCCTCTCCTCCCTCTTCAGG + Intergenic
994838901 5:104895213-104895235 GTGCTCTTGCCTCCCTTTCAGGG + Intergenic
995132119 5:108641884-108641906 GTTTCCTAACCTCCCTCTCCTGG + Intergenic
995780450 5:115769779-115769801 GTGGCCTTGACTAGCACTCCTGG - Intergenic
998159942 5:139807778-139807800 GTGGACCCGCCTCCCTCCCCAGG + Intronic
1000457218 5:161465323-161465345 GTGGCCTTGTCAGCCTGTCCTGG - Intronic
1001036346 5:168299570-168299592 GTCGCCATCCCTCCCCCTCCCGG + Intronic
1001598070 5:172911031-172911053 GTGGACTGGGCGCCCTCTCCTGG + Intronic
1002060585 5:176623481-176623503 GAGGCCTGGCCTCCGTCTCCTGG + Intronic
1002451269 5:179320126-179320148 GTGGCCTCCCTTCCCTCACCAGG - Intronic
1003146043 6:3511594-3511616 CTCCCCTTGGCTCCCTCTCCTGG + Intergenic
1004373427 6:15072281-15072303 GTGGTCTTGTATCCCTATCCTGG + Intergenic
1006294098 6:33162146-33162168 CTTCCCTAGCCTCCCTCTCCTGG - Intergenic
1006626885 6:35403928-35403950 TCGTCCCTGCCTCCCTCTCCAGG - Intronic
1007248956 6:40482750-40482772 CAGGCCCTGCCTCCCCCTCCTGG + Intronic
1007704129 6:43780880-43780902 GTAACCCTGCCTCCCTCCCCTGG + Intronic
1012378598 6:98591891-98591913 GTTTTCATGCCTCCCTCTCCAGG - Intergenic
1013409027 6:109868077-109868099 TTGGCTCTGCCTCCCTCTGCGGG + Intergenic
1016433094 6:144008247-144008269 GTGCTCTGGCCTCACTCTCCGGG - Intronic
1018230782 6:161673289-161673311 GAGGACTTGCCTCCTTCTCCAGG - Intronic
1018891850 6:167988351-167988373 GTGGCCGGGCCTCCCTCTGAAGG - Intergenic
1019168413 6:170114856-170114878 GTGTCCCTCCCTACCTCTCCTGG + Intergenic
1019382124 7:729271-729293 GTGGCCTCGCCTCTGTCTTCTGG + Intronic
1019600726 7:1882450-1882472 ATGGCCTTGCCTGCCTGTCAGGG + Intronic
1019613300 7:1947691-1947713 GTGGCCTTGCCTGCCGCACACGG + Intronic
1019911069 7:4100794-4100816 GCGGTCCAGCCTCCCTCTCCAGG - Intronic
1022219834 7:28302641-28302663 ATGGCCTTGCCTGCCTCTTTTGG - Intronic
1023487015 7:40698293-40698315 CTGGCCCTGCCTACCTCTTCTGG - Intronic
1025208060 7:57004629-57004651 GGGGCCTTGTCTCTCTCTGCTGG + Intergenic
1025663893 7:63572246-63572268 GGGGCCTTGTCTCTCTCTGCTGG - Intergenic
1029133096 7:98348948-98348970 GTGGCCTGGCCTTACTGTCCTGG + Intronic
1029453838 7:100657121-100657143 CTTCCCTTCCCTCCCTCTCCCGG - Intergenic
1029458280 7:100681905-100681927 TTGGCCTTGCTGCCCTCCCCGGG + Exonic
1029609081 7:101617088-101617110 GTGACCTGGCCACCCTCGCCCGG + Intronic
1029611770 7:101630425-101630447 GTGTCCTGGCGTTCCTCTCCGGG + Intergenic
1032080976 7:128858314-128858336 GTCCCTCTGCCTCCCTCTCCAGG + Exonic
1032091272 7:128912846-128912868 GTCCCTCTGCCTCCCTCTCCAGG - Intergenic
1033365613 7:140671022-140671044 CTGGCCTTCCCTTCCTCTCCAGG + Intronic
1034558891 7:151867132-151867154 GGGGCCTTGGCCACCTCTCCAGG + Intronic
1035010406 7:155710803-155710825 GCAGCCTTGCATCCCCCTCCAGG - Intronic
1035081189 7:156217650-156217672 GAGGCCTTGGGTCCCTCTCCAGG - Intergenic
1035750013 8:1990444-1990466 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750031 8:1990510-1990532 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750041 8:1990543-1990565 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750051 8:1990576-1990598 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750062 8:1990609-1990631 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750095 8:1990708-1990730 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750106 8:1990741-1990763 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750117 8:1990774-1990796 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750128 8:1990807-1990829 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750139 8:1990840-1990862 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750150 8:1990873-1990895 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750161 8:1990906-1990928 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750171 8:1990939-1990961 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750182 8:1990972-1990994 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750192 8:1991005-1991027 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035750212 8:1991071-1991093 GGGGCCTTGGCGCCCTGTCCGGG + Intronic
1035760341 8:2064229-2064251 GTGCCCTTACCTCCCTCCCAGGG + Intronic
1036422845 8:8613996-8614018 GTGCTCCTGCCTCCCTCGCCTGG + Intergenic
1036766889 8:11555051-11555073 GTGGCCCTAATTCCCTCTCCTGG + Intronic
1037833330 8:22201642-22201664 GTCGCCTGGCCTCCCACTCCCGG + Intronic
1039742469 8:40395164-40395186 GTGGCCTTCCCCTCCTCTGCTGG - Intergenic
1039787066 8:40843133-40843155 TTGGCCTTGCCTCTCTGTCAGGG - Intronic
1040464117 8:47678716-47678738 CTCGCCTTGCCTCACTCCCCAGG - Intronic
1040522982 8:48193640-48193662 CTGTCCATGCCTCCCTGTCCAGG - Intergenic
1041080698 8:54212418-54212440 GTGTCCAGGACTCCCTCTCCAGG + Intergenic
1042126034 8:65538025-65538047 GGAGCCTTGCTTCCCTCTGCGGG - Intergenic
1042516870 8:69668554-69668576 TTGGGCTTGCCTCCTGCTCCTGG + Exonic
1048420489 8:134273669-134273691 GTGGTACTCCCTCCCTCTCCAGG - Intergenic
1049178538 8:141208500-141208522 GTGGCCCTGCCTCCCCCCCGGGG + Intronic
1049317058 8:141975053-141975075 GGGGCCTCTCCTTCCTCTCCAGG + Intergenic
1049320294 8:141992613-141992635 GTGGCCCTGGCACACTCTCCTGG - Intergenic
1049406967 8:142455915-142455937 GTGGCCCTACCTGCCTGTCCCGG + Intronic
1049432606 8:142572199-142572221 CTCGCCGTGCCTGCCTCTCCTGG - Intergenic
1049564559 8:143331479-143331501 GTAGGGTTGCCTCCCTCTGCAGG - Intronic
1049571168 8:143370937-143370959 GTGGCTGTGCCCCCCTCACCTGG + Intronic
1049657282 8:143804469-143804491 ATGGCCTTGCGGCCCACTCCAGG - Intronic
1049693923 8:143974550-143974572 CTGGCCTTGCAGCCCTCTCCTGG + Intronic
1049719200 8:144107868-144107890 GGGGCCTGGCCTCGCCCTCCGGG + Intronic
1050607593 9:7317546-7317568 GTGGCCATGCCTCCACCTCTAGG + Intergenic
1050611531 9:7359071-7359093 GTGGCAGAGGCTCCCTCTCCAGG - Intergenic
1051854076 9:21542111-21542133 GTTTCCCCGCCTCCCTCTCCTGG - Intergenic
1052457755 9:28722541-28722563 TAGGCCTTTCCTTCCTCTCCAGG - Intergenic
1053174629 9:35912999-35913021 GGAGCCTGGCCTCCCTCTGCAGG + Intergenic
1053280681 9:36818279-36818301 GTGGGCCAGCCTCCCTCCCCGGG - Intergenic
1053662111 9:40291299-40291321 GTCTCCTTGCCTCCATCTGCAGG + Intronic
1053912560 9:42921467-42921489 GTCTCCTTGCCTCCATCTGCAGG + Intergenic
1054154355 9:61629641-61629663 GTGGGCTTCCCTCCACCTCCTGG - Intergenic
1054374238 9:64437539-64437561 GTCTCCTTGCCTCCATCTGCAGG + Intergenic
1054522499 9:66084985-66085007 GTCTCCTTGCCTCCATCTGCAGG - Intergenic
1055299610 9:74869393-74869415 GTGGCGTTACCTCCGCCTCCTGG - Intronic
1055530328 9:77177438-77177460 GCCGCCTTTCCTCCCTCTCAGGG + Exonic
1055654808 9:78441577-78441599 GTGGCCTTGGCTCCCATTTCAGG - Intergenic
1056396301 9:86184392-86184414 CTGTCCTTTCCTCGCTCTCCTGG - Intergenic
1056800137 9:89685401-89685423 CTGGCCAGGCCTCCCTCTGCAGG + Intergenic
1057091676 9:92263720-92263742 GAGGCCTGGGCTACCTCTCCTGG - Intronic
1057114020 9:92503329-92503351 GTGGGCTTCCCTGTCTCTCCAGG - Intronic
1057558274 9:96106708-96106730 GATGCCTAGCCTCACTCTCCTGG + Exonic
1058907789 9:109495711-109495733 CTGACCTTGCCTCCCTAACCAGG + Intronic
1060485248 9:124042338-124042360 CTGCCCCTGCCTCCCCCTCCTGG + Intergenic
1060887165 9:127162622-127162644 ATGGCCTTGGCTCACACTCCTGG + Intronic
1060918970 9:127407090-127407112 ATGGCCTTTCCTCTCTCTGCAGG + Exonic
1060980321 9:127788151-127788173 CTGGTCTTGGCTCCCACTCCCGG + Intronic
1062070424 9:134552469-134552491 GTGGCCTGGGGTCCCTGTCCTGG + Intergenic
1062429050 9:136518896-136518918 GTGGCAATGCCGCCCCCTCCAGG + Intronic
1062670468 9:137705928-137705950 GTTGCAGTGCCTCCCTCTCCTGG + Intronic
1186357380 X:8801603-8801625 GAGTCCTTGCATCCCTCCCCAGG - Intergenic
1187289594 X:17940315-17940337 TGGCCCCTGCCTCCCTCTCCAGG - Intergenic
1188178209 X:27021140-27021162 GTGACTTGGCCTCCCTCTTCTGG + Intergenic
1190570867 X:51779927-51779949 CTGGCCCTGCCTACCTCTCCAGG + Intergenic
1191902501 X:66054694-66054716 GGGGCCCAGCCTCACTCTCCTGG - Intergenic
1192174395 X:68876817-68876839 TCTGGCTTGCCTCCCTCTCCAGG + Intergenic
1195107616 X:101616337-101616359 TTGGCCTTGCCTCCCCCTGAGGG + Exonic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic
1198565275 X:137897611-137897633 GTGCCCTTTCTTACCTCTCCTGG - Intergenic
1199724223 X:150565903-150565925 GATGGCTGGCCTCCCTCTCCAGG - Intergenic
1200045218 X:153397364-153397386 CTGCCCATGCCTCCATCTCCCGG + Intergenic
1202378154 Y:24256482-24256504 GATGCCTTGCTTCCATCTCCTGG - Intergenic
1202492628 Y:25413639-25413661 GATGCCTTGCTTCCATCTCCTGG + Intergenic