ID: 1184397264

View in Genome Browser
Species Human (GRCh38)
Location 22:44249680-44249702
Sequence CGTTTTCTGGAGGAAATACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184397258_1184397264 1 Left 1184397258 22:44249656-44249678 CCCCATCCTGAGGCACAGCAAAA 0: 2
1: 0
2: 1
3: 22
4: 386
Right 1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG 0: 1
1: 1
2: 0
3: 9
4: 157
1184397261_1184397264 -5 Left 1184397261 22:44249662-44249684 CCTGAGGCACAGCAAAAGCGTTT 0: 1
1: 1
2: 0
3: 3
4: 114
Right 1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG 0: 1
1: 1
2: 0
3: 9
4: 157
1184397257_1184397264 2 Left 1184397257 22:44249655-44249677 CCCCCATCCTGAGGCACAGCAAA 0: 2
1: 0
2: 2
3: 25
4: 202
Right 1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG 0: 1
1: 1
2: 0
3: 9
4: 157
1184397255_1184397264 24 Left 1184397255 22:44249633-44249655 CCGGGTGCTTCAGATCTCATCTC 0: 1
1: 0
2: 1
3: 25
4: 217
Right 1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG 0: 1
1: 1
2: 0
3: 9
4: 157
1184397259_1184397264 0 Left 1184397259 22:44249657-44249679 CCCATCCTGAGGCACAGCAAAAG 0: 2
1: 0
2: 0
3: 14
4: 183
Right 1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG 0: 1
1: 1
2: 0
3: 9
4: 157
1184397260_1184397264 -1 Left 1184397260 22:44249658-44249680 CCATCCTGAGGCACAGCAAAAGC 0: 1
1: 1
2: 1
3: 13
4: 232
Right 1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG 0: 1
1: 1
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184397264 Original CRISPR CGTTTTCTGGAGGAAATACA AGG Exonic
902649690 1:17828961-17828983 CTTTTCCTGCAGGAAATATAGGG - Intergenic
905669332 1:39780926-39780948 CGTTTTCTGGGAGACAAACAAGG - Intronic
908813740 1:68010685-68010707 TGTTTTGTGCAGGAAATACAAGG - Intergenic
910966908 1:92816999-92817021 CCTCTGCTGGAGGAAATACTTGG - Intergenic
910998216 1:93131947-93131969 CATTTTCTCGATGAAATATAAGG + Intronic
910998231 1:93132082-93132104 CATTTTCTCGATGAAATATAAGG + Intronic
919259455 1:195173107-195173129 GGTATTTTGGAAGAAATACAAGG - Intergenic
923455367 1:234160929-234160951 CATTTTATGGATGACATACATGG - Intronic
923804672 1:237244791-237244813 CGTTGTCTGGGGTAAATACCCGG - Intronic
1062970120 10:1641449-1641471 CATTTTTTGAAGGAAATAAAAGG + Intronic
1063689764 10:8275781-8275803 CGTTGTCTGGGGTAAATACCCGG + Intergenic
1064483300 10:15760904-15760926 TGGTTTCTGGAAGAAATTCAAGG - Intergenic
1064615741 10:17153507-17153529 CGAACTCTGGAGGAAATCCAAGG + Exonic
1067568631 10:47355693-47355715 CGTTTTCTAGAGGAAAAAAAAGG + Intronic
1072519708 10:96220312-96220334 CGTTGTCTGGGGTAAATACCTGG - Intronic
1073017644 10:100414445-100414467 CTTTTTGTGGAGCAAATAAATGG + Intergenic
1073094700 10:100972512-100972534 CGTTTTCTGAAGAAAAAACGGGG - Intronic
1075583841 10:123643239-123643261 CTTTTTATGGATGAAAAACAAGG - Intergenic
1077840656 11:5971236-5971258 CTTCATTTGGAGGAAATACAAGG - Intergenic
1080629321 11:34058945-34058967 CTTTTTCTGGGGGAAATGAATGG + Intronic
1085612890 11:77969280-77969302 CGTTTTCTGGGAGAATTGCATGG - Intronic
1086943540 11:92822439-92822461 CATTTTCTGCAGAAAATCCAAGG + Intronic
1087664896 11:101032734-101032756 CTTATGCTGGAGGAAGTACAGGG - Exonic
1087890124 11:103528431-103528453 CAATTTCTGTAGGAAAGACATGG - Intergenic
1090786659 11:130054673-130054695 CATTCCCTTGAGGAAATACAAGG - Intergenic
1095921616 12:47537353-47537375 AGTTTTCTTTAGGAAATACATGG + Intergenic
1095967078 12:47875715-47875737 CTGTTCCTGGAGGAAACACAGGG + Intronic
1097289071 12:57898693-57898715 CTTTTTCTAGAAGAAACACACGG + Intergenic
1097996739 12:65896223-65896245 GGTATTCTGGAGCAAATAAAGGG - Intronic
1099298581 12:80862414-80862436 CTGTTTCTAGAGAAAATACATGG + Intronic
1100069125 12:90689870-90689892 TGTTTTCTAAAGTAAATACAAGG - Intergenic
1101896726 12:108762464-108762486 CCATTTCTGGAAGAAATATATGG + Intergenic
1102420046 12:112796289-112796311 GGTTTCCTAGAGAAAATACACGG - Intronic
1103341193 12:120222013-120222035 AGTGTTGTGGAGGAAACACAGGG - Intronic
1104392799 12:128405229-128405251 CGTTTCCGGGAGAAAACACACGG + Intronic
1107382824 13:39875645-39875667 TGTTTTCTGGAGGACATGAAGGG + Intergenic
1110593460 13:77291854-77291876 GGTTTCCTTGGGGAAATACAAGG - Intronic
1112714370 13:102166847-102166869 CTGTTTCAAGAGGAAATACACGG - Intronic
1116949587 14:50866978-50867000 TGTTTTCTAGAGGGAATACTGGG + Intronic
1117536414 14:56707323-56707345 CCTTTTCTGGAGAGAACACACGG - Intronic
1124641740 15:31400203-31400225 CATTTTCTGCAGGGAATCCACGG + Intronic
1126844438 15:52745866-52745888 CATTGTCTGGAGTAAATACCTGG - Intergenic
1128507113 15:68280914-68280936 CATGTTCTGGAGGAAATGTAAGG + Intronic
1130120056 15:81040259-81040281 CTTTTTCTTGTAGAAATACAAGG - Intronic
1130561905 15:84965410-84965432 AGTTTTTTGGTGGCAATACATGG + Intergenic
1130969301 15:88719480-88719502 CTGTTTCTAGAGGAAATAGAGGG + Intergenic
1134451583 16:14367326-14367348 GATTTCCTGGAGGAAAGACAGGG + Intergenic
1136047642 16:27627550-27627572 CTGCTTCTAGAGGAAATACAGGG - Intronic
1136359528 16:29769627-29769649 TGTTTTCAGGAGGAAAAACCTGG + Intergenic
1137409153 16:48213360-48213382 CGTGTTCTGGAGGAACATCATGG + Intronic
1140875990 16:79152973-79152995 AGCTTGCTGGGGGAAATACAAGG + Intronic
1147194162 17:38754038-38754060 GGTTTTCAGGAGGGAATACGTGG + Intronic
1147636870 17:41969327-41969349 CGTTTTCAGATGGAAAAACATGG + Intronic
1148289019 17:46425648-46425670 CAATCTCTGGAGGAAATACTCGG - Intergenic
1148311188 17:46643225-46643247 CAATCTCTGGAGGAAATACTCGG - Exonic
1148383107 17:47214456-47214478 CGTTTGGTGGAGGAAACAGAGGG - Intronic
1153616711 18:6941711-6941733 AGTTTTCTTGAAGAAATAAAAGG + Intergenic
1156338463 18:36189330-36189352 CGTAATGTAGAGGAAATACAAGG - Intronic
1156728870 18:40165133-40165155 AGTTGTCTCTAGGAAATACATGG + Intergenic
1157509029 18:48254640-48254662 TGTTGTCTGGGGTAAATACATGG - Intronic
1157763100 18:50279427-50279449 TGCTTTATGGAGAAAATACAAGG - Intronic
1159140007 18:64382055-64382077 CGTTGTCTGGGGTAAATACCCGG - Intergenic
1159478908 18:68961050-68961072 AGTTTTCTGGGGCAAAGACATGG - Intronic
1160570841 18:79816574-79816596 CCATTTCTGGAAGAAAAACAGGG - Intergenic
1167779194 19:51586038-51586060 AGTTTTCAGAAGGATATACAGGG + Intronic
1168488498 19:56786511-56786533 ATTATTTTGGAGGAAATACATGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925378291 2:3404731-3404753 CGTCTTCTTGAGTAAATAAAGGG + Intronic
927612443 2:24554959-24554981 CGTTGTCTGGGGTAAATACCCGG + Intronic
928922083 2:36536792-36536814 AGTTTTCTGGGGGAAAAAAATGG + Intronic
929334725 2:40727468-40727490 CTCTGTCTGGAGGAAACACATGG - Intergenic
930494582 2:52125565-52125587 TGTTGTCTGGAGTAAATACCTGG + Intergenic
932012756 2:67994578-67994600 CCCTTTCTGGAGGAAAAATATGG - Intergenic
934706143 2:96482980-96483002 CCTTTTCTGGAGGAAAACCGAGG - Intergenic
935918907 2:107988088-107988110 AGTCTTCTGAAGAAAATACAGGG - Exonic
936607994 2:113976726-113976748 CGGTTTGTGGAGGAAGTGCATGG - Intergenic
937962429 2:127470490-127470512 TGTTTTCTGGATGAAATACTAGG - Intronic
938324965 2:130392177-130392199 CGTTTTCTGGATGAGAAAAATGG - Intergenic
940486516 2:154303076-154303098 CGTTGTCTGGAGTAAATACTAGG + Intronic
940689410 2:156896631-156896653 CTTTTTCTAGAGGAGATCCATGG - Intergenic
941505902 2:166344947-166344969 CTTTTTCTCGAGGAACTAAATGG + Intronic
942521919 2:176813432-176813454 CATCTTCTGGAGGAAAAAAATGG - Intergenic
945835027 2:214829512-214829534 GATTGTCTGGAGGAAAGACATGG - Intergenic
946292226 2:218754117-218754139 TGTTTTCTGGAGGGAATAGGTGG - Exonic
946296917 2:218791815-218791837 CTTTTCCTGGTGAAAATACACGG + Intronic
947295316 2:228624354-228624376 TGTTTTCTGGAGGATAAAGAGGG + Intergenic
947814959 2:233030576-233030598 CGTCTTCGGGAGGAATCACAAGG - Intergenic
948441714 2:237995528-237995550 CGTTTGGTGGTGGAAATATAGGG + Intronic
1169700376 20:8439510-8439532 AATTTTCTTGAGGAATTACATGG + Intronic
1169897077 20:10515652-10515674 TGTCTTCTGGATGAAATTCATGG + Intronic
1170464303 20:16608984-16609006 TGTTTTAATGAGGAAATACACGG - Intergenic
1171304606 20:24094472-24094494 CGTTGTCTGGGGTAAATACCCGG - Intergenic
1172198487 20:33108639-33108661 CTTTTTATAGAGGAAATAAATGG - Intronic
1173375901 20:42483023-42483045 AGTGTTCTGAAGGAAACACAAGG + Intronic
1173729394 20:45317959-45317981 CGTTTTCTAGAGGAGGAACAGGG + Intergenic
1174259354 20:49282546-49282568 TGTTTTCTGGATGAAATACCAGG + Intergenic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1177676835 21:24310930-24310952 CCTTTCCTGGGGGAATTACAGGG - Intergenic
1177718700 21:24876088-24876110 AGGCTTCTGGAGGAAACACAGGG - Intergenic
1179906041 21:44423887-44423909 GGTTTTCTGGAGGACACACAGGG - Intronic
1182709705 22:32312815-32312837 GGTTTTCTGGAGGAAATACAAGG + Intergenic
1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG + Exonic
1185215016 22:49593788-49593810 CATCTTCAGGAGGAAATCCACGG + Intronic
953700581 3:45192482-45192504 GGTTTCCTATAGGAAATACATGG - Intergenic
956043792 3:65173923-65173945 GAATTTCTGAAGGAAATACATGG + Intergenic
963169626 3:142237706-142237728 TTTTTCCTAGAGGAAATACAGGG + Intergenic
965930552 3:174037752-174037774 CTTTTTCTGAAGTAAACACATGG + Intronic
967564130 3:190954004-190954026 AGCTTTCTGGAGAAAATAAAAGG + Intergenic
968867129 4:3220246-3220268 CTTTTCCTGGAGGAACTCCACGG - Exonic
970080858 4:12283460-12283482 CTCTTTCTGTAGGATATACATGG - Intergenic
972053613 4:34772026-34772048 CGTTGTCTGGGGTAAATACCTGG - Intergenic
975043777 4:69776660-69776682 CAATTTCTAGAGGATATACAGGG - Intronic
975292356 4:72692139-72692161 AGTTTTCTGGATAAAATAAATGG + Intergenic
976117924 4:81747995-81748017 GTTTTTTTGGAGGAAATACCTGG - Intronic
976259620 4:83133623-83133645 CGTTGTCTGGGGTAAATACCTGG + Intronic
978874856 4:113627394-113627416 CTGTTCCTGGGGGAAATACAGGG + Intronic
979762754 4:124427332-124427354 AGTTTTCTAGAGGAAATAAGGGG + Intergenic
979832649 4:125319512-125319534 CCATTGCTGAAGGAAATACAGGG + Exonic
981116882 4:141001713-141001735 TGTTTAATGGAGGAAATAAATGG + Intronic
982557311 4:156883910-156883932 CTTTATCTTGAGGATATACATGG - Intronic
982671720 4:158327987-158328009 CATTGTCTGGAGTAAATACCTGG - Intronic
985482676 5:126691-126713 TGTTTTCTGGGGTAAATACCCGG + Intergenic
987374651 5:17222353-17222375 AGTTCTCTTGAGAAAATACAAGG + Intronic
987725471 5:21693407-21693429 CTTTTTCTGGAGGAACCAAAAGG + Intergenic
988029462 5:25743974-25743996 TGTTTTCTGAAGGAAACAAAAGG + Intergenic
996309804 5:122092118-122092140 CGTTTACTGTAGGAATTAAAAGG - Intergenic
996510468 5:124310200-124310222 TGTTTTCTGGGGGAAAAAAAAGG - Intergenic
998192729 5:140041642-140041664 CTGTTTCTGGGGGAATTACAAGG - Intronic
999958388 5:156726908-156726930 AGTTTTCTGGATGCAAAACAGGG + Intronic
1005768767 6:29042914-29042936 CATTTTCTTGAGGAAATGCCAGG + Intergenic
1006676457 6:35767798-35767820 CATTTTCTAGACCAAATACAAGG + Intergenic
1008723924 6:54393268-54393290 CGTTGTCTGGGGTAAATACCTGG + Intergenic
1010694177 6:78949541-78949563 GGGTTTCTGCAGGAAATGCAAGG - Intronic
1011812572 6:91150116-91150138 CTTTTTCTGTAGTGAATACAGGG - Intergenic
1015097147 6:129429310-129429332 CATCTTCTTGAGGAAAGACATGG + Intronic
1015220061 6:130794283-130794305 TGGTTTCTGCAGGAAAGACAAGG + Intergenic
1021357510 7:19670191-19670213 TTGCTTCTGGAGGAAATACATGG - Intergenic
1022131698 7:27410672-27410694 AGTTTTCTGGAGTATATACCTGG - Intergenic
1026201775 7:68220672-68220694 CATTGTCTGGAGCAAATACCTGG - Intergenic
1026211376 7:68308773-68308795 CATTTTCTGGAGGAGTTACTAGG + Intergenic
1031757252 7:125660460-125660482 CGTTGTCTGGGGTAAATACCCGG - Intergenic
1031823890 7:126537995-126538017 CGTTTTCAGTCTGAAATACATGG + Intronic
1033805546 7:144950426-144950448 TATTTTCCAGAGGAAATACAAGG - Intergenic
1034887504 7:154809220-154809242 CAATTTGTGGAGCAAATACAGGG + Intronic
1037325078 8:17680884-17680906 CGTTCACTGGGGGGAATACAAGG + Intronic
1038953762 8:32445185-32445207 AGTATTCAGGAGGATATACAAGG - Intronic
1039273869 8:35913662-35913684 TGTTTTCTGGAGGGAATATTAGG + Intergenic
1042112554 8:65396095-65396117 CTTTCTCTGGAGAAAAGACAGGG + Intergenic
1042435977 8:68764858-68764880 AGTTTTCAGGAGTAAATTCATGG - Intronic
1043383502 8:79727171-79727193 TGTTTTCTGTAGGAAAGGCAGGG - Intergenic
1046549915 8:115702883-115702905 GCTTTTCTTGAGGAACTACATGG + Intronic
1047139736 8:122124372-122124394 AGTTTTCTGCAGGAAAAGCAAGG - Intergenic
1047934483 8:129763470-129763492 ATCTTTCAGGAGGAAATACAAGG - Intronic
1048190658 8:132285634-132285656 CGTCTTCAGGAGGAAATCAAGGG + Intronic
1049600790 8:143506663-143506685 AGTTTTCTGGAGGCAATAGCTGG - Intronic
1053356495 9:37450280-37450302 CGTTGTCTGGGGTAAATACCTGG - Intronic
1053874843 9:42533355-42533377 GTTTTTCTAAAGGAAATACATGG - Intergenic
1054267490 9:62933400-62933422 GTTTTTCTAAAGGAAATACATGG + Intergenic
1058256024 9:102764912-102764934 CCTTTCCTGTAGGAAGTACAAGG + Intergenic
1058992910 9:110271602-110271624 CATTTTCTTGTAGAAATACAAGG + Intergenic
1060429060 9:123533022-123533044 CATTTTATGTAGGAAATGCAGGG + Intronic
1189341753 X:40209874-40209896 CGTCCTCTTGAGGAAATACCTGG - Intergenic
1193841743 X:86415721-86415743 TTTTATCTGGAGAAAATACATGG + Intronic
1196137081 X:112221725-112221747 TGTTTTCTGAAGGAAATTCAGGG + Intergenic
1197602950 X:128552364-128552386 TTGTTTCTGGAAGAAATACATGG - Intergenic
1198562226 X:137863349-137863371 AGTTTTTTGAAGGAAATATATGG - Intergenic
1200978184 Y:9236091-9236113 GATTTTCTGGAGGATAAACAGGG + Intergenic
1201339093 Y:12912968-12912990 TGTTTTCTGGAGGAAACACGGGG + Exonic